COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..3934686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(372..812) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene mioC CDS 1314..2159 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene kduI CDS 2178..2951 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2998..4002) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208790.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4168..5028) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene pstB CDS complement(5025..6281) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene pstA CDS complement(6274..7659) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene pstC CDS complement(7670..8659) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8544..8810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8933..10333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10404..11195) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 11286..12182 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(12211..13572) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene mnmE CDS complement(13679..15313) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene yidC CDS complement(15540..15863) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene rnpA CDS complement(15910..16044) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene rpmH CDS complement(16072..16281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(16298..17035) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(17032..17703) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(17860..18609) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 18941..20317 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene dnaA CDS 20384..21484 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene dnaN CDS 21496..22575 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene recF CDS 22594..25008 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene gyrB CDS 25058..25228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 25317..25757 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(25924..27882) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 28089..29090 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene msrP CDS 29169..29783 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene msrQ CDS complement(29788..30603) product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene nikE CDS complement(30597..31388) product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31385..32212) product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene nikC CDS complement(32209..33156) product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene nikB CDS complement(33158..34714) product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene nikA CDS 35155..37692 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 37877..38155 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 38155..38448 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38557..40371) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene atzF CDS complement(40373..43978) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene uca CDS complement(44101..44742) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(44739..45512) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(45523..46344) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090873437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(46346..47167) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(47221..48300) product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(48766..50013) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 50217..50420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(50510..51526) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(51550..53616) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene glyS CDS complement(53628..54548) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene glyQ CDS 54990..55547 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 55696..55959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 56250..56633 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene crcB CDS 56895..58874 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene thiC CDS 58884..60191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 60169..60990 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene thiF CDS 60974..61174 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene thiS CDS 61177..61941 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 61941..63077 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene thiH CDS complement(63270..65063) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 65366..65650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(65707..66171) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene asnC CDS 66314..67105 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 67210..67623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(67679..68554) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(68615..69040) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene uspA CDS 69199..69729 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951035.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene ftnA CDS 69801..70124 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene uspB CDS 70271..71458 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(71506..72207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 72742..73578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 73904..75886 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(76047..76304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 76424..76975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 76965..77777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 77940..78782 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(78779..82516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(82869..84599) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096531.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(85334..86218) product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(86374..86610) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(86610..88046) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369995.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 88276..88695 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(88676..89050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(89205..90482) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(90646..94485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(94475..95290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(95365..95784) product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209495.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(95803..96120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(96208..97395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(97407..99284) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(99478..99996) product type VI secretion system effector Hcp-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene hcp-2 CDS complement(100374..102050) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(102113..104008) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 104688..105095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 105362..106345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 106695..106850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 107068..108006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 108016..108843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 108879..109685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 109682..110905 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 110907..112028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 112043..113755 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene asnB CDS 113752..114594 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(114571..114750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 114920..116080 product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 116077..116697 product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene prfH CDS 116897..117541 product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 117534..118838 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(119020..119628) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 119825..120697 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(120742..122358) product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rtcR tRNA 122615..122690 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 122954..124126 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 124275..124769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 124847..126073 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(126208..128190) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(128202..129149) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 129388..129606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 129575..130273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 130377..131078 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971211.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 131145..131507 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 131690..132079 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(132102..132632) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(132735..133496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(133527..133832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 134364..135761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(136401..137141) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(137309..138106) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(138237..139136) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rarD CDS complement(139299..140576) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(140814..142079) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 142406..142897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 143100..144938 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene recQ CDS 145167..146564 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(147069..148166) product Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(148567..149652) product Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 150134..150652 product type VI secretion system effector Hcp-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene hcp-2 CDS 150848..151306 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(151355..152920) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(153018..153803) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113594001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 154012..155193 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 155195..156826 product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(156964..157809) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(157936..158991) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 159066..159683 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rhtB CDS 159694..160923 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(161048..161518) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 161731..162102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 163298..163576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 163794..164381 product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(164408..165007) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455148.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rsmD CDS 165332..166561 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ftsY CDS 166630..167310 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene ftsE CDS 167288..168262 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene ftsX CDS 168457..169311 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene rpoH CDS 169509..169868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 170245..170559 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene glpE CDS 170578..171411 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene glpG CDS complement(171438..171845) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 172018..172548 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 172559..173413 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene ubiA CDS complement(173476..175884) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene plsB CDS 176114..176731 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene lexA CDS complement(176815..178215) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene sthA CDS 178431..179045 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene fabR CDS 179060..179431 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(179490..180599) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene trmA CDS 180708..180971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 181010..182833 product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172310.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene btuB CDS 183062..183802 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene murI CDS complement(183771..184223) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 rRNA 184776..186313 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 186374..186450 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 186460..186535 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 rRNA 186827..189713 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 189839..189949 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 190015..190091 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(190823..192226) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene glnG CDS complement(192248..193297) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene glnL CDS complement(193618..195027) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene glnA CDS 195606..197435 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene typA CDS 197671..198513 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 198485..198919 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene dtd CDS 198954..199874 product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(199892..201787) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(201986..203614) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene pckA CDS complement(203946..204809) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene hslO CDS complement(204828..205214) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene hslR CDS 205577..206353 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene gspC CDS 206417..208417 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene gspD CDS 208420..209892 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene gspE CDS 209892..211115 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene gspF CDS 211170..211610 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene gspG CDS 211638..212219 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene gspH CDS 212206..212571 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene gspI CDS 212555..213190 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene gspJ CDS 213183..214226 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene gspK CDS 214180..215424 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene gspL CDS 215435..215926 product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene gspM CDS 215931..216698 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(216782..217612) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene cysQ CDS complement(217615..218175) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene nudE CDS complement(218275..218859) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene nfuA CDS 219395..219631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 219781..220548 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene bioH CDS 220696..221172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(221245..223563) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 223804..224283 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene greB CDS 224509..224790 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(224949..226310) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 226543..227262 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ompR CDS 227350..228657 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene envZ CDS complement(228722..230167) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(230337..232415) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene recG CDS complement(232520..233224) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene trmH CDS complement(233290..235401) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene spoT CDS complement(235450..235722) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene rpoZ CDS complement(235827..236450) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene gmk CDS 236875..238146 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 238425..239096 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(239148..240851) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(240863..241129) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(241487..241909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(241952..242845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 note possible pseudo, frameshifted CDS complement(243007..243507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 note possible pseudo, frameshifted CDS complement(243537..243782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(243933..245711) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(245908..247764) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 248002..248481 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene fxsA CDS complement(248490..248966) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene trmL CDS complement(249135..250622) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene cpxA CDS complement(250622..251314) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 251548..252129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 252267..253592 product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 253771..254679 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene fieF CDS 255108..256070 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene pfkA CDS complement(256155..257162) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene glpX CDS 257389..257697 product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene zapB CDS complement(257783..258682) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene metF CDS complement(258957..261365) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(261365..262531) product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 262808..263134 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005432736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene metJ CDS 263583..265895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 265892..266704 product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 266701..268557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 268574..269023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 269013..269816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 269819..270649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 270652..271458 product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 271635..272291 product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(272829..273410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(273606..273791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 274285..275628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 275996..277213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(277461..279428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 279898..280542 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(280629..281906) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(282203..282421) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene rpmE CDS 282754..284955 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene priA CDS 285361..286368 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene cytR CDS 286474..287052 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 287165..287698 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene hslV CDS 287743..289074 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene hslU CDS 289200..290117 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 290194..290724 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene rraA CDS complement(290759..292054) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(292287..293057) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene tpiA CDS complement(293273..293608) product DUF3135 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(293732..294349) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 294638..294928 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 295007..296644 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene groL CDS 296742..298205 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(298215..299237) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene epmB CDS 299272..299838 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene efp CDS complement(299847..300053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 300083..301507 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(301614..301976) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene frdD CDS complement(301987..302370) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene frdC CDS complement(302367..303116) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(303113..304921) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene frdA CDS 305237..306211 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene epmA CDS 306344..306778 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 306941..307423 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene secB CDS 307656..308684 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene gpsA CDS 308690..309559 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene cysE CDS complement(309679..310218) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(310585..313230) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene ppc CDS complement(313444..314580) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene argE CDS 314736..315740 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene argC CDS 315752..316543 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene argB CDS 316619..317836 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 317939..319813 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene argH CDS complement(320472..321200) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 321353..322258 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465160.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene oxyR CDS complement(322396..324840) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 325014..325922 product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene pilM CDS 325906..326475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 326472..327062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 327055..328179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 328366..328884 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene aroK CDS 328912..330000 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene aroB CDS 330029..331717 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 331786..332613 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 332744..333418 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rpe CDS 333514..334200 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 334348..335364 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene trpS CDS 335485..335670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 336139..338718 product GlyGly-anchored extracellular endonuclease Xds inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene xds CDS complement(338732..338887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 338902..339480 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 339758..340978 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458126.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 341207..342229 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000962042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene astA CDS 342299..343090 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(343210..343842) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene crp CDS complement(344098..344967) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(345045..345257) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(345287..346264) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(346336..346821) product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(346818..348731) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 348925..349494 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene kefG CDS 349494..351302 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene kefB CDS 351306..351506 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 351592..352152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 352554..353852 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 354068..354703 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 354943..357366 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene rnr CDS 357381..358118 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene rlmB CDS 358427..358738 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene rpsJ CDS 358753..359382 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rplC CDS 359399..360001 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rplD CDS 359998..360300 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rplW CDS 360316..361140 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rplB CDS 361161..361439 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rpsS CDS 361450..361782 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene rplV CDS 361802..362506 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene rpsC CDS 362518..362928 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rplP CDS 362928..363119 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene rpmC CDS 363119..363373 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rpsQ CDS 363530..363901 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene rplN CDS 363913..364230 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene rplX CDS 364257..364796 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene rplE CDS 364814..365119 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene rpsN CDS 365149..365541 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene rpsH CDS 365558..366091 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene rplF CDS 366101..366454 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene rplR CDS 366469..366969 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene rpsE CDS 366977..367153 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rpmD CDS 367159..367593 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene rplO CDS 367612..368946 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene secY CDS 369236..369592 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene rpsM CDS 369612..370001 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene rpsK CDS 370034..370654 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene rpsD CDS 370679..371671 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene rpoA CDS 371698..372069 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rplQ CDS complement(372291..372911) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 373235..373825 product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(373880..375841) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178336.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene cpdB CDS 376139..376957 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene cobA CDS 377012..377920 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene cysD CDS 377939..379366 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene cysN CDS 379445..381169 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 381188..381808 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene cysC CDS complement(381828..382742) product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(383006..383506) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(383516..384775) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(384772..385404) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(385558..386274) product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(386300..386620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(386682..387314) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene msrA CDS 387619..389250 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162809456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 389247..393008 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 393094..393438 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164258.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 394007..395191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 395726..396334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 396495..396881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(396980..397507) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene ppa CDS complement(397709..398719) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene fbp CDS 399113..400441 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene mpl CDS 400434..401069 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 401340..402350 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene thiB CDS 402350..403954 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene thiP CDS 403941..404642 product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene thiQ CDS complement(404769..405299) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene yjgA CDS 405406..406752 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene pmbA CDS complement(407002..408360) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene mgtE CDS complement(408584..408862) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(408867..409733) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene rapZ CDS complement(409753..410205) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene ptsN CDS complement(410208..410495) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene hpf CDS complement(410525..412006) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(412064..412789) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene lptB CDS complement(412796..413284) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene lptA CDS complement(413265..413828) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene lptC CDS complement(413825..414382) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene kdsC CDS complement(414382..415356) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene kdsD CDS complement(415392..416357) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 416703..417506 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene mlaF CDS 417496..418287 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene mlaE CDS 418290..418802 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene mlaD CDS 418808..419452 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene mlaC CDS 419449..419760 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 419774..420028 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene ibaG CDS 420094..421302 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene murA CDS 421406..422170 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(422255..422644) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(422886..423350) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene pyrI CDS complement(423367..424296) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene pyrB CDS complement(424741..425745) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(425864..427240) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 427737..430628 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rapA CDS complement(430707..432098) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(432506..433786) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 434189..434926 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene rluA CDS 434995..435957 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(436047..438908) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(439000..439452) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(439510..441018) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene pepA CDS 441225..442325 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene lptF CDS 442329..443399 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene lptG tRNA 444109..444193 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 444484..445125 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(445242..445844) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene leuD CDS complement(445860..447266) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene leuC CDS complement(447284..448375) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene leuB CDS complement(448465..450012) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene leuA CDS 450462..451121 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 451313..451846 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 451843..452907 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(453024..453215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 453282..454241 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140416966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene leuO CDS 454677..456398 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 456400..456894 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene ilvN CDS complement(456970..458415) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 459460..460680 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene arcA CDS 460802..461713 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene arcC CDS 461804..462808 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene argF CDS complement(462774..462947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 463328..463840 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(464211..466010) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(466220..467497) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene gabT CDS complement(467649..469076) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 469311..470327 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 470388..471005 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 470995..472317 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 472428..473303 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene mscS CDS complement(473780..475192) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene pykF CDS 475630..476394 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 476501..478333 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene glmS CDS complement(478436..478801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(478860..479084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 479575..479904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 479969..487018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(487179..487364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 487716..494972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 495212..496477 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(496654..497223) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 497356..498270 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 498507..499388 product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene nifH CDS 499439..500911 product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene nifD CDS 501003..502574 product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene nifK CDS 502659..502877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 502998..503684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 503690..503983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 504460..505800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(505931..506095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 506228..506470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 506467..507693 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 507878..508615 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 508615..510069 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 510357..511607 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 511816..512727 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 512724..513578 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 513585..514697 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266834.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(514784..515662) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 515792..516529 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 516957..517316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 517580..518419 product IS481-like element ISSod13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 note possible pseudo, internal stop codon, frameshifted CDS 518723..519751 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(520087..521373) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 521557..525237 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene metH CDS complement(525316..526668) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene lysC CDS complement(527026..527835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(528784..531606) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene uvrA CDS complement(531749..532621) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene galU CDS complement(532741..533388) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 533651..534184 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 534666..535214 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 535241..537385 product formate dehydrogenase H subunit alpha, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 537447..539144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 note possible pseudo, frameshifted CDS 539129..539524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 note possible pseudo, frameshifted CDS 539548..540384 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene fdhD CDS 540586..541167 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 541187..543469 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene hypF CDS 543599..543850 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 543857..544996 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene hypD CDS 544989..545990 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene hypE CDS 546003..546344 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene hypA CDS complement(546315..546653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 546791..547327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 547514..549523 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001924594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene csrD CDS 549593..550756 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 550880..551692 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene mreC CDS 551682..552170 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene mreD CDS 552086..552745 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 552764..554233 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene rng CDS 554245..558183 product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 558180..559013 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 559010..560455 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene tldD CDS 560574..560990 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rraB CDS 561265..561921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(562068..562505) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(562580..565147) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(565303..566274) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(566612..567082) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene argR CDS 567497..568429 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene mdh CDS complement(568563..569534) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene ispB CDS 569816..570127 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rplU CDS 570148..570405 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rpmA CDS 570646..571821 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene cgtA CDS 571955..572719 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 572710..573189 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 573254..573739 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene folA CDS complement(573829..574632) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene apaH CDS complement(574661..575041) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene apaG CDS complement(575093..575905) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene rsmA CDS complement(575915..576904) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene pdxA CDS complement(576904..578184) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780524.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene surA CDS complement(578214..580538) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene lptD CDS 580685..581545 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene djlA tRNA complement(581655..581730) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(581747..581822) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(581824..581899) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(581915..581990) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(582007..582082) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(582097..582172) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(582560..582635) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(582652..582727) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(582741..582816) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(582923..583987) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene mltC CDS complement(584140..584412) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(584658..585671) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene mutY CDS 585869..586588 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene trmB CDS 586801..587721 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene glsB CDS complement(587941..589131) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene hemW CDS complement(589131..589733) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(590014..590454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(590472..590762) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene flgM CDS complement(590976..591614) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene flgA CDS 591864..592226 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene flgB CDS 592229..592666 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene flgC CDS 592663..593337 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene flgD CDS 593376..594563 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene flgE CDS 594587..595318 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 595346..596131 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene flgG CDS 596160..596846 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene flgH CDS 596831..597991 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 598001..598549 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 598555..599928 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene flgK CDS 599938..600837 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene flgL CDS 600849..601892 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 602009..602782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(602748..603044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(603147..604124) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(604142..604999) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene motA CDS complement(605009..605734) product lateral flagellar system RNA polymerase sigma factor LafS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene lafS CDS complement(605747..606235) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(606259..607473) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(607470..607781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(607774..608160) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene fliS CDS complement(608182..609546) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene fliD CDS complement(610149..610991) product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462780.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene lafA CDS complement(611223..612503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(612697..613980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(614173..615447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(615659..616486) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(616479..618572) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene flhA CDS complement(618602..619729) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene flhB CDS complement(619726..620502) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene fliR CDS complement(620502..620771) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene fliQ CDS complement(620788..621543) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene fliP CDS complement(621559..621945) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462794.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene fliN CDS complement(621942..622760) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 623619..624176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 624173..625507 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 625522..625908 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene fliE CDS 625912..627663 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene fliF CDS 627617..628645 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 628649..629455 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene fliH CDS 629452..629793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 note possible pseudo, frameshifted CDS 629790..630815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 note possible pseudo, frameshifted CDS 630815..631258 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene fliJ CDS 631230..631397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 631683..632021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(632119..632409) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene yggU CDS complement(632409..632963) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087263.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(633010..633831) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene proC CDS complement(633918..634619) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461710.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(634692..635108) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene ruvX CDS complement(635141..635704) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(635736..636692) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene gshB CDS complement(636705..637436) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene rsmE CDS complement(637599..638174) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(638181..639332) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene metK CDS 639715..641712 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene tkt CDS complement(641769..643418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 643711..644739 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene epd CDS 644897..646060 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482432.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 646211..647287 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene fbaA CDS complement(647364..648593) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene serA CDS complement(648939..649595) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene rpiA CDS complement(649673..650281) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(650513..650812) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 651177..651755 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 651788..652960 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene ubiH CDS 652974..654191 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(654286..654492) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(654835..655323) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(655313..656359) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene ygfZ CDS 656433..656693 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 656728..657090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(657104..658705) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene nadB CDS 659166..659738 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene rpoE CDS 659755..660399 product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 660414..661379 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene rseB CDS 661376..661846 product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 661988..663781 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene lepA CDS 663876..664772 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene lepB CDS 664816..665493 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene rnc CDS 665486..666457 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene era CDS 666519..667250 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene recO CDS 667247..667987 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene pdxJ CDS 667991..668404 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene acpS CDS complement(668415..671195) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene barA CDS 671373..672695 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene rlmD CDS 672797..675019 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene relA CDS 675082..675897 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene mazG CDS complement(675913..676845) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 677113..677868 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 677865..679292 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 679289..679948 product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 680247..681887 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 681964..683265 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene eno CDS complement(683352..684614) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114766199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(684696..685304) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(685464..686723) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(686852..687532) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911782.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 687743..689263 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 689629..690885 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 691101..693986 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene glnE CDS 694124..695554 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene hldE CDS complement(695750..697060) product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene vpoC CDS 697293..697922 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene nudF CDS 697910..698365 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 698516..699244 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene cpdA CDS 699268..699837 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene yqiA CDS 700102..701982 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene parE CDS 701988..704252 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene parC CDS complement(704343..704819) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(704813..705580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(705564..706433) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(706481..706756) product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(706841..707032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(707029..707676) product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(707954..708157) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene yacG CDS complement(708175..708915) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207198.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene zapD CDS complement(708948..709556) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene coaE CDS complement(709557..710432) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(710668..711894) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(711891..713657) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pilB CDS complement(713658..714098) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020333947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(714273..715202) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene nadC CDS 715372..715932 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479703.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene ampD CDS 716035..716841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 716911..717690 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067113.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(717709..719682) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 719882..720802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(720931..721224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(721538..722320) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 722531..723070 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 724172..724852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 725003..725779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(726452..726958) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(726997..727230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(727190..727858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 tRNA complement(728554..728630) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(728792..729589) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene hutG CDS 729679..731046 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(731057..731800) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene hutC CDS complement(731905..733437) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene hutH CDS complement(733449..735146) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(735162..736421) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene hutI CDS complement(736635..738533) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rpoD CDS complement(738632..740398) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene dnaG CDS complement(740480..740923) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(740951..741166) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145625.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rpsU CDS 741391..742410 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene tsaD CDS complement(742452..743051) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene plsY CDS 743245..743598 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene folB CDS 743595..744089 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene folK CDS 744096..744899 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 745053..745334 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ftsB CDS 745335..746033 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ispD CDS 746036..746515 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ispF CDS 746540..747589 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129752.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene truD CDS 747586..748326 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene surE CDS 748332..748958 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(749265..749606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(749974..751659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(752061..753119) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 753530..754030 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene pncC CDS 754164..755228 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene recA CDS 755288..755767 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene recX CDS 755907..758489 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene alaS CDS 759032..759232 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene csrA tRNA 759402..759494 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 759525..759601 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 759616..759692 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 759707..759783 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 759817..759893 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 759898..759990 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 760017..760093 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 760403..760669 product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 760692..760892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 note possible pseudo, frameshifted CDS 760910..762484 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene oadA CDS 762494..763624 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 763745..764695 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 764689..765150 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 765164..768016 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 768124..769707 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene gshA CDS 769691..770299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 770322..770840 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene luxS CDS complement(770886..772070) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(772246..773049) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 773243..774625 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene ffh CDS 774805..775053 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rpsP CDS 775083..775631 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rimM CDS 775657..776400 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene trmD CDS 776442..776795 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rplS CDS complement(776874..777938) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490480.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene degS CDS 777994..778146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(778143..779510) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(779634..780086) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene zapG CDS 780271..781377 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene zapE CDS 781629..782057 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene rplM CDS 782058..782465 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rpsI CDS 782714..783349 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene sspA CDS 783350..783856 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene sspB CDS complement(783916..784584) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene can CDS 784908..785822 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 785830..786603 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 786793..787794 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene yiaK CDS 788170..789171 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094954.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene yiaK CDS 789199..789687 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 789684..790964 product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene yiaN CDS 790977..791951 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 792011..792703 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 792839..794329 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 794344..794994 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene ulaD CDS 794998..795762 product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene yiaJ CDS 795914..796798 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 797146..798684 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 798671..799708 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 799708..800820 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 800834..801718 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 801728..802216 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 802341..803093 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(803396..804283) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene panC CDS complement(804295..805089) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene panB CDS complement(805086..805595) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene folK CDS complement(805592..806962) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015297242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene pcnB CDS complement(807079..808113) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490360.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene gluQRS CDS complement(808152..808598) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene dksA CDS complement(808741..809469) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene sfsA CDS 809526..812024 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene hrpB CDS 812108..814351 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene mrcB CDS 814389..816668 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 816928..819525 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene acnB CDS 819686..820057 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 820245..820583 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene glnK CDS 820611..821840 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(822076..823101) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene rsmC CDS complement(823194..824228) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(824565..825956) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene hemL CDS 826250..826591 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene erpA CDS complement(826655..827944) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 828077..829264 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene tyrS CDS complement(829318..830565) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene dacB CDS complement(830866..831861) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490380.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 832473..832946 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene greA CDS complement(833013..833321) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene yhbY CDS 833431..834060 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene rlmE CDS 834101..836122 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ftsH CDS 836182..837015 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene folP CDS 837032..838375 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene glmM CDS 838616..838981 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene secG tRNA 838996..839079 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 839135..839211 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 839451..839906 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rimP CDS 839928..841415 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene nusA CDS 841439..844198 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene infB CDS 844295..844687 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rbfA CDS 844687..845625 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene truB CDS 845766..846035 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rpsO CDS 846308..848455 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene pnp CDS 848557..849438 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883460.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene nlpI CDS 849469..850779 product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene vmrA CDS 851046..852926 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019439542.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(852995..853885) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(853899..854909) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(854999..856945) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 857213..857782 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 857739..858248 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 858311..858721 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 858718..859161 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene rimI CDS 859283..860512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 860509..863562 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 863681..864583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 864849..866438 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene prfC CDS complement(866510..867739) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene srmB CDS complement(867996..868664) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 869018..870340 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene brnQ CDS 870663..871595 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene prfB note possible pseudo, frameshifted CDS 871628..873145 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene lysS CDS 873452..874204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 note possible pseudo, frameshifted CDS 874276..874791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 note possible pseudo, frameshifted CDS 875302..875553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(875669..876700) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(876977..877654) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene mutH CDS 878247..878765 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rppH CDS 878768..881017 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene ptsP CDS 881039..881833 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 881871..882674 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene lgt CDS 882694..883545 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 883634..883927 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(884025..884285) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene rpsT CDS 884545..886143 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene murJ CDS 886237..887172 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene ribF CDS 887233..890097 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene ileS CDS 890115..890603 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene lspA CDS 890731..891162 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene fkpB CDS 891207..892157 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene ispH CDS complement(892224..893705) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 894061..894405 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(894416..895342) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene murQ CDS complement(895353..896474) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 896576..897565 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene nagZ CDS complement(897576..898289) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene btsR CDS complement(898299..899990) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 900211..901278 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 901295..902422 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene tyrA CDS complement(902452..902835) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(902934..904601) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene ettA CDS 904804..906774 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene sltY CDS 906833..907147 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene trpR CDS complement(907202..907732) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene yjjX CDS complement(907735..908907) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene pheA CDS complement(909126..909452) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene raiA CDS 909519..909716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(909785..910513) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 910717..911694 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene rluD CDS 911694..912416 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene pgeF CDS 912518..915091 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene clpB rRNA 915637..917174 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 917241..917316 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 rRNA 917608..920494 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 920620..920730 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 rRNA 921058..922595 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 922656..922732 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 rRNA 923032..925918 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 926043..926153 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 tRNA 926219..926295 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(926296..926568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(926950..927492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, internal stop codon CDS complement(927502..929013) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138360839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene istA CDS complement(929202..929750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(929836..930138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 note possible pseudo, frameshifted CDS complement(930141..930479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 note possible pseudo, frameshifted CDS 930507..931241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 931471..932463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 933144..934061 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 934170..934505 product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 934515..935237 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene nfsA CDS complement(935513..935767) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196281.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(935769..937109) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene yegQ CDS complement(937352..938269) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264267.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rdgC CDS 938480..939151 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene phoB CDS 939172..940473 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene phoR CDS 940485..941441 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(941506..943014) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene ppx CDS complement(943001..945106) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene ppk1 CDS 945499..947628 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 947651..949303 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene pstA CDS 949306..950124 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene pstB CDS 950177..950881 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene phoU CDS complement(951099..951713) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 951910..952815 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 953297..954964 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene aceB CDS 955131..956441 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene aceA CDS complement(956585..957082) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 957352..958425 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene queA CDS 958476..959609 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene tgt CDS 959723..960055 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene yajC CDS 960109..961932 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene secD CDS 961951..962898 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene secF CDS complement(962951..963754) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene suhB CDS 963928..964659 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene trmJ CDS 964805..965287 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene iscR CDS 965316..966530 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 966578..966961 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene iscU CDS 967018..967341 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene iscA CDS 967418..967930 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene hscB CDS 967951..969807 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene hscA CDS 969824..970162 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene fdx CDS 970222..970416 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene iscX CDS 970762..972048 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene pepB CDS 972133..972558 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene ndk CDS 972836..973954 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 974318..975331 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rodZ CDS 975340..976464 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ispG CDS 976571..977764 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene hisS CDS 977796..978410 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 978430..979593 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene bamB CDS 979765..981252 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene der CDS 981665..981895 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(981899..983260) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene xseA CDS 983441..984907 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene guaB CDS 985067..986644 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene guaA CDS complement(986851..988410) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(988749..990350) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(990405..991214) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 991366..992184 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 992247..993023 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(993080..994594) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene dgt CDS 995201..997252 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 997240..997968 product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 997965..998954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 998951..1002826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 1002831..1003049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1003292..1003726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(1004008..1004910) product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1005210..1005749 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene rimJ CDS complement(1006423..1006998) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1007115..1008356) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 1008552..1009514 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1009548..1010453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1010555..1010704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 1010720..1011136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 1011659..1012141 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 1012205..1012462 product DUF2999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 1012630..1014012 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1014496..1016796 product N-acyl homoserine lactone acylase QqaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene qqaR CDS 1016961..1017974 product ribonuclease T2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(1018075..1018758) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(1018762..1020144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(1020370..1021680) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454697.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene dbpA CDS 1021953..1022504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(1022523..1023944) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1023941..1024627) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263107.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1024839..1025765 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058664.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1025944..1027071) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1027260..1028321 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1028318..1029196 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1029193..1030017 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1030054..1031166 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1031309..1032172 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1032317..1032775 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1033021..1033986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1034225..1035658 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1035706..1036590 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1036682..1038307) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1038772..1039458 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(1039513..1040241) product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1040395..1042557) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263609.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1042706..1043641) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1043813..1044310) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 1044440..1045381 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1045448..1046047 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1046290..1047000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 1047629..1049281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1049295..1049723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1049858..1050739) product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(1050744..1051391) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1051398..1052219) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1052271..1052963) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1052980..1053453) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1053524..1055281) product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1055646..1056401 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene ulaR CDS 1056566..1057633 product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene ulaG CDS 1058041..1059957 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1060475..1060996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 1061001..1063031 product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene hyfB CDS 1063031..1063984 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005345231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1063997..1065439 product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1065451..1066098 product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene hyfE CDS 1066103..1067689 product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1067707..1069449 product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1069463..1070035 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene hyfH CDS 1070032..1070841 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706330.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 1070828..1071256 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1071256..1071717 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene hycI CDS complement(1071823..1072023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1072376..1073737) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1073790..1075049) product serine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1075265..1075942) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1076760..1078535 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073582519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1078969..1080753 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073582519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1080813..1081667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1082855..1083076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1083309..1083851 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1083848..1084651 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1084725..1085408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1086146..1087300 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1087325..1087915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1088250..1088594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1088861..1090288) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene tnaA CDS 1090394..1090588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1090854..1091870) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1091870..1092889) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1092889..1093779) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1093791..1094744) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1094757..1096526) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1097221..1098531) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1098806..1101244) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1101563..1102987) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1103256..1105544) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene ptsP CDS complement(1105800..1106675) product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1106983..1107966 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1108327..1108599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1108634..1109086 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1109090..1109884 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene cpaB CDS 1109901..1111238 product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263118.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1111235..1111768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1111772..1113037 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1113030..1114319 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1114319..1115254 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1115251..1116132 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012535186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1116194..1117279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1117251..1117796 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 1117774..1118349 product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene tadF CDS 1118352..1119716 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1119720..1120433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1120593..1121516 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1121703..1122893 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1122877..1123065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1123116..1124432) product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1124947..1126296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1126527..1126811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1126903..1128834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1129101..1130051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1130453..1132036 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1132036..1133091 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1133091..1133927 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131974.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1133917..1134783 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1134773..1135498 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1135617..1136333 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1136436..1136744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1137153..1137410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1137405..1137569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1137691..1137876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1137836..1138255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1138266..1138694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1139087..1139731) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095431.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1139829..1140152) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1140600..1140959 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1140940..1141245 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1141234..1141449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1141871..1142773) product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1143075..1144652 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1144636..1145823 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1145827..1149051 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1149209..1151779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1151776..1152900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1152897..1154024 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1154089..1154376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1154608..1154835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1154807..1155019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1155197..1155553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1155555..1155956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1156173..1156559) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1156639..1157391 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1157600..1158571) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1158663..1159565 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1159575..1159814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1160066..1160461 product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1160726..1162171 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261842.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene hutW CDS 1162354..1162878 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene hutX CDS 1163003..1163563 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene hutZ CDS 1163868..1165388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1165415..1169155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1169176..1170963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1170963..1171805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1171805..1173187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1173187..1175298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1175279..1176676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1176661..1177350) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1177648..1177848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1177869..1178432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1178447..1179406 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene cpaB CDS 1179525..1180880 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1180899..1181540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1181558..1182769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1182766..1184127 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1184124..1185101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1185098..1186042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1186063..1186935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1186935..1187465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1187462..1188025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1188043..1188417 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1188598..1189359) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene kduD CDS 1189704..1190609 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1190694..1191260 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene sigZ CDS 1191411..1192433 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1192588..1192833 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1192977..1193252 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1193249..1193389 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene ykgO CDS 1194253..1197366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1197525..1199306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1199458..1200165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 note possible pseudo, frameshifted CDS 1200131..1204981 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189716469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1205153..1209262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1209259..1210905 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1210921..1211604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1211685..1212704 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1212848..1213852 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1214248..1216212 product hemagglutinin/proteinase HapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene hapA CDS 1216505..1217077 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1217147..1218244) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1218733..1221894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1222159..1225617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1225642..1226712) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1226712..1228331) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1228370..1229389) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479089.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1230122..1232044 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1232249..1232692 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1232719..1233414 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1233492..1234016 product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(1234075..1235103) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1235329..1237092 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1237808..1239277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1239359..1240132) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1240232..1240855 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1240975..1242018 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene rlmF CDS complement(1242130..1242876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1243376..1243924 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1244475..1246832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1247056..1247637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1247864..1248100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1248100..1248945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1249188..1249535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1249550..1250443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, frameshifted CDS complement(1250605..1251105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 note possible pseudo, frameshifted CDS complement(1251142..1251696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1251709..1253226) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1253236..1255206) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1255932..1257155) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107728.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 tmRNA complement(1257342..1257708) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 1257902..1258879 product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1258969..1259454) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene smpB CDS 1259590..1260021 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1260018..1260371 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1260555..1260896) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene bamE CDS complement(1261200..1262864) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene recN CDS complement(1262975..1263859) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene nadK CDS 1263994..1264608 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene grpE CDS complement(1264868..1266760) product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1266869..1267798) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1268286..1270202 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene dnaK CDS 1270425..1271564 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene dnaJ CDS 1271784..1272308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1272289..1272924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1272921..1274168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1274158..1274517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1274583..1275431) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene fghA CDS complement(1275517..1276656) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1276769..1277671 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1277713..1278222 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene tadA CDS complement(1278633..1280378) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene mltF CDS 1280702..1284595 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene purL CDS 1284877..1286988 product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1287105..1287296) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1287296..1287502) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391765.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1287688..1288626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1288731..1290452) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479053.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1290577..1291296) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene tsaA CDS complement(1291300..1291770) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1291767..1292060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1292357..1293397) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1293481..1293801 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1293794..1294558 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene truC CDS 1295013..1297079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1297091..1298425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1298425..1303767 product DUF6531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1303779..1304159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1304447..1306312) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171170.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene dxs CDS complement(1306334..1307218) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene ispA CDS complement(1307253..1307507) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene xseB CDS 1307897..1308661 product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene pomA CDS 1308679..1309644 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1309829..1311283 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene thiI CDS 1311747..1312670 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1312648..1313271 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1313261..1313668 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1313665..1314756 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene rlmM CDS complement(1314884..1315666) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene xni CDS complement(1315754..1317115) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene ppnN CDS complement(1317357..1318637) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1318680..1320959) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1320974..1321819) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene queF CDS 1321925..1322458 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene syd CDS 1322462..1323241 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1323315..1324124) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1324175..1324852) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1324842..1325876) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene metN CDS 1326170..1326724 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene gmhB tRNA complement(1326836..1326920) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1326979..1327063) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(1327220..1327819) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1328138..1329388 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1329455..1330420) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene lipA CDS complement(1330417..1331067) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene lipB CDS complement(1331278..1331556) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488798.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene ybeD CDS complement(1331805..1332644) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene pstB CDS complement(1332641..1333477) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene pstA CDS complement(1333470..1334408) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene pstC CDS complement(1334483..1335526) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene pstS CDS 1336023..1337279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1337276..1337911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1338201..1339376) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1339446..1340264) product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene rlpA CDS complement(1340264..1341385) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene rodA CDS complement(1341388..1343274) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene mrdA CDS complement(1343282..1343752) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rlmH CDS complement(1343756..1344073) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rsfS CDS complement(1344127..1345167) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene holA CDS complement(1345192..1345791) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071919558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene lptE CDS complement(1345901..1348474) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene leuS CDS 1348596..1349075 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1349097..1350614) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene lnt CDS complement(1350697..1351572) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene corC CDS complement(1351652..1352113) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene ybeY CDS complement(1352113..1353207) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1353264..1354739) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene miaB CDS 1355028..1356182 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1356232..1356741) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene crr CDS complement(1356846..1358570) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene ptsI CDS complement(1358703..1358960) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1359185..1360153) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene cysK CDS complement(1360359..1361108) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene cysZ CDS 1361357..1362214 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene zipA CDS 1362286..1364304 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene ligA CDS 1364333..1364731 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene cueR CDS complement(1364811..1365668) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1366051..1366878) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1366900..1367814) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1368001..1368735 product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1368732..1369523 product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1369513..1369863 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1370027..1370266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 note possible pseudo, frameshifted CDS 1370289..1370837 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene yfcE CDS complement(1370940..1371470) product transmembrane regulator ToxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181145.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene toxS CDS complement(1371461..1372357) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018134.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1372628..1374532 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene htpG CDS 1374853..1375500 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene adk CDS 1375624..1376589 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene hemH CDS complement(1376648..1378030) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1378348..1380012) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene asnB CDS complement(1380287..1381501) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013120.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1382004..1383674 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene glnS CDS 1383899..1389748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1389810..1390604 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene truA CDS 1390748..1391665 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene accD CDS 1391696..1392967 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene folC CDS 1392970..1393527 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1393590..1394081 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1394120..1395634 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334233.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene purF CDS complement(1395850..1397181) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1397346..1397990) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene rnt CDS 1398201..1399094 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045946.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1399091..1399528) product DUF2753 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1399628..1400044) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene gloA CDS 1400287..1400775 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1400850..1401260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1401609..1402085 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 1402082..1403140 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1403162..1404196 product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1404286..1405095) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1405088..1406080) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947988.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1406263..1407225 product transcriptional regulator NodD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene nodD1 CDS 1407317..1408288 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1408245..1410038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1410068..1410490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1410669..1411973) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1411998..1414457) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083198953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1414633..1415799) product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1415876..1417645) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1417986..1418609) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1418622..1419548) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1419667..1420587) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1420748..1421389) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1421437..1421763) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1421787..1422308) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1422333..1423094) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene kduD CDS 1423381..1424163 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene kdgR CDS 1424252..1426129 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1426132..1426848 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482923.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1426919..1428085) product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1428063..1428509) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene zntR CDS complement(1428777..1430249) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1430612..1431343 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1431400..1432587 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene uxuA CDS complement(1432647..1433846) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1434022..1434906 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1435121..1435273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1435260..1435499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1435802..1436314 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1436332..1437876) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1438297..1439811 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene glpK CDS 1440058..1440828 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1441167..1442708 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene glpD CDS complement(1442760..1443443) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1443412..1445040) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1445224..1446555) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943380.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1446650..1447015) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene frdD CDS complement(1447025..1447408) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene frdC CDS complement(1447410..1448153) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1448153..1449955) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene frdA CDS complement(1450793..1452082) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1452563..1453033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1453036..1453914) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1454167..1455246) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene alr CDS 1456132..1457136 product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1457136..1458110 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1458121..1458978 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974702.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1459148..1459783 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1460085..1461236 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene acrA CDS 1461240..1464395 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1464385..1465818 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1466042..1466251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1466310..1466666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1466679..1467845 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1467860..1468225 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1468222..1468803 product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1468812..1470134 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1470153..1471481 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1471468..1473084 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1473106..1474461 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1474865..1475974 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1476035..1477096 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1477090..1477875 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1478157..1478831 product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene cprR CDS 1478835..1480121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1480156..1481595) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1481842..1482828 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1483053..1484681 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1484830..1485771) product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1486361..1487305 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1487398..1489536) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091710.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene pta CDS complement(1489682..1490878) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1491219..1491671 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060891.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene yfbV CDS 1492058..1493023 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 1493079..1494014 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461508.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1494011..1494805 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1494906..1495862) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene dusC CDS 1495972..1496604 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1496828..1497385 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene lolA CDS 1497397..1498746 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1498906..1500213 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene serS CDS complement(1500285..1501769) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1502009..1502287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1502424..1503431) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1503886..1507446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1507592..1509337) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1509549..1510508) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1510891..1512036 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1512066..1512365) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1512575..1513960 product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene orpR CDS 1514235..1514654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1515078..1515533 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1515594..1516319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1516380..1517411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1517398..1518504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1518978..1519394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1519680..1520714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1521184..1522317) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1522494..1523129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1523730..1524581 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1524633..1525259 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1525265..1526476) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1526481..1527632) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene nagA CDS complement(1527632..1528444) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene nagB CDS 1528633..1530129 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene nagE CDS 1530274..1531743 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479031.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1532029..1533030 product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1533104..1533778 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1533784..1535145 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1535179..1535892) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1535913..1537481) product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene dpiB CDS 1538167..1539534 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1539604..1540731 product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1540828..1543452 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene acnB CDS complement(1543613..1544959) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1544968..1546773) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1547268..1548572 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene tig CDS 1548808..1549302 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene clpP note possible pseudo, frameshifted CDS 1549504..1550778 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460618.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene clpX CDS 1550897..1553248 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene lon CDS 1553437..1553709 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1553896..1555752 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene ppiD CDS 1555885..1556187 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021449594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1556397..1557086 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene cmk CDS 1557196..1558866 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rpsA CDS 1558949..1559233 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ihfB CDS 1559376..1559654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1559718..1560833 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene lapB CDS 1560889..1561584 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene pyrF CDS complement(1561636..1562247) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1562485..1563249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 1563542..1564516 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene cysB CDS 1564881..1565375 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene lrp CDS 1565563..1568382 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene ftsK CDS complement(1568435..1568842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1569034..1570626) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene nhaB CDS 1571248..1572084 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene fadR CDS complement(1572115..1573275) product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 1573693..1574043 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene hinT CDS 1574163..1575533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1575694..1576284 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750164.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene lpoB CDS 1576337..1577197 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062354.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1577277..1577825 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene ycfP CDS 1578105..1579409 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456272.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1579467..1580240) product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1580286..1583747) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene mfd CDS complement(1583758..1584327) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999601.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1584492..1585700 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene lolC CDS 1585693..1586376 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene lolD CDS 1586382..1587629 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene lolE CDS complement(1587766..1588275) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1588713..1590533 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 1590699..1592318 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene msbA CDS 1592369..1593334 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053055813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene lpxK CDS 1593315..1593494 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1593495..1594256 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene kdsB CDS complement(1594288..1595820) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1595834..1597105) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1597255..1599189) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1599439..1599939) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1600167..1600907) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103941.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene pflA CDS 1601292..1603172 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1603249..1605525) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene pflB CDS complement(1606046..1606852) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene xthA CDS complement(1606886..1607071) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene rsmS CDS complement(1607128..1607907) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1607925..1610006) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489085.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene dinG CDS 1610517..1611464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1611590..1612237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1612270..1612659) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459984.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1612671..1613414) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene lpxH CDS complement(1613481..1613975) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1614142..1615524 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene cysS CDS 1615607..1616128 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene ruvC CDS 1616212..1616826 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene ruvA CDS 1616823..1617827 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene ruvB CDS 1618290..1619876 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene cydA CDS 1619894..1621030 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene cydB CDS 1621146..1621451 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene ybgE CDS 1621773..1622189 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene ybgC CDS 1622179..1622868 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene tolQ CDS 1622868..1623311 product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1623323..1624330 product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene tolA CDS 1624369..1625718 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476637.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene tolB CDS 1625754..1626299 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene pal CDS 1626320..1627078 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ybgF CDS 1627203..1628246 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene nadA CDS complement(1628324..1628896) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1629190..1629630 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1629770..1629976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1630160..1630813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1630823..1631506 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1631494..1632753 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1632746..1633507 product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1633507..1634775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151653979.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1634775..1635836 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1635842..1636630 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1636723..1636995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 tRNA 1637449..1637536 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1637822..1639123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1639138..1640031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 note possible pseudo, frameshifted CDS complement(1640193..1640693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 note possible pseudo, frameshifted CDS complement(1640730..1640966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1641557..1641793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1641780..1642121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1642333..1643157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1643633..1643842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1644094..1645359 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene codA CDS complement(1645392..1646303) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 1646395..1646670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1646923..1647945 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene trpS CDS 1648214..1649374 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1649785..1651953 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1651950..1652843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1652852..1656229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1656233..1657528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1657887..1660445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1660449..1661759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1662104..1663387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1663320..1663517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1663732..1665015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1664948..1665145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1665905..1666642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1667196..1668320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1668963..1669247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1669338..1672049) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1672061..1672999) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1673323..1674642 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1674731..1675744) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1676154..1678478 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1678503..1679885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1680047..1680235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1680425..1681438) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1681528..1682322 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1682319..1682867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1682864..1683325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1683411..1684349 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1684370..1684876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1685029..1685508 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1685645..1686538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1686749..1687582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1687916..1689400 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1689485..1689976 product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1689973..1692678 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene mngB CDS 1692780..1693589 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1693601..1694497 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171138895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1694451..1694690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1694699..1694938) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1695490..1698960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1699042..1700580) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1700895..1701086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1701164..1701937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1702343..1703977 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1704195..1705022 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1705031..1705927 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 note possible pseudo, frameshifted CDS 1706018..1707007 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211039.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1707021..1708001 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1708117..1711563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1711783..1712784) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1713430..1714713 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1715049..1716389 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482935.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1716433..1717296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1717442..1717915 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1718284..1718940 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene ribB CDS complement(1719087..1721024) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1721418..1723034) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1723286..1723621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1724112..1725431 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1725451..1726635 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1726691..1727467 product phytochelatin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1727687..1728067 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1728091..1729371 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1729619..1731220 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1731452..1732234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 1732432..1732833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1732852..1733322 product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1733369..1733932) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1734093..1734524 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1734669..1735841 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1736377..1737888 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1737994..1738857) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1738856..1739065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1739299..1739973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1740202..1741344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1741371..1742858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1743916..1745100) product acyl-homoserine-lactone synthase OpaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene opaM CDS 1745701..1747563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1747698..1748090) product GspS/AspS pilotin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1748093..1748389) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1748515..1748928) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene yciA CDS complement(1748932..1749474) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481614.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1749685..1750953) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1751272..1752078) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene trpA CDS complement(1752078..1753268) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene trpB CDS complement(1753316..1754731) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003291.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene trpCF CDS complement(1754739..1755737) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene trpD CDS complement(1755794..1756372) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1756385..1757962) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1758365..1759234 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465084.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1759234..1759857 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 1760018..1760917 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene rluB CDS 1761159..1761539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1761607..1762782) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene pgl CDS 1763096..1763452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1763576..1766320) product M6 family metalloprotease PrtV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene prtV CDS complement(1766436..1766711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1767302..1769026) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene cydC CDS complement(1769019..1770809) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene cydD CDS complement(1770993..1771949) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene trxB CDS 1772593..1774545 product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1775126..1777363 product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1777436..1778263) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1778328..1778993) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1779062..1779385) product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1779504..1781192) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 1781531..1781911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460959.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1782002..1783105) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene purC CDS 1783507..1784016 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1785134..1786159) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1786215..1786883) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1786951..1787634) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1787770..1788450) product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 1788745..1791786 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1792606..1794507 product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1794561..1794719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 1794801..1795187 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1795276..1796004) product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1796173..1796493) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1796497..1797063) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene yeiP CDS 1797176..1797943 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1797956..1800334) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687840.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1800489..1800782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1801267..1801911 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene uvrY CDS 1801911..1803746 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene uvrC CDS 1803794..1804351 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene pgsA CDS complement(1804520..1805314) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1805327..1806124) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1806127..1807116) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1807118..1808005) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(1807992..1808954) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498495.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1808954..1810576) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1810888..1811901) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene pspF CDS 1812113..1812781 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene pspA CDS 1812806..1813036 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462365.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene pspB CDS 1813033..1813419 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene pspC CDS complement(1813490..1814689) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1814893..1816347) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene cls CDS 1816549..1816767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1816757..1818100 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1818206..1818895 product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1818909..1819898 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1819965..1820405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1820550..1820798 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1820814..1821050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1821693..1821971) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene rplY CDS complement(1822086..1823855) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1823942..1824637 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rsuA CDS 1824652..1825857 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1825858..1826511 product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1826526..1827974) product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1828313..1828984 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939696.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1828965..1831385 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1831772..1831984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 note possible pseudo, frameshifted CDS 1831981..1832922 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene nhaA note possible pseudo, frameshifted CDS 1833377..1836250 product pyridoxal phosphate-dependent class III aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1836267..1837511 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1837625..1838758 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483192.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene nspC CDS complement(1838830..1840440) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915500.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1840644..1841156) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1841528..1842769 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1843015..1843269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1843337..1843621) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene yfaE CDS complement(1843621..1844754) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene nrdB CDS complement(1844863..1847145) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457837.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene nrdA CDS complement(1847582..1848289) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1848416..1848553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1848561..1851170 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457842.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene gyrA CDS 1851839..1852435 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1852544..1853200 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1853232..1853927) product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057643027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 1854125..1854487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1854612..1854974) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1855498..1857381 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625988.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1857564..1858190 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene pncA CDS complement(1858401..1858793) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1858820..1859545) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167493951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1859772..1860965) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1861142..1861417 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene yccX CDS complement(1861440..1861769) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895407.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1861906..1862571) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1862836..1863594) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1863632..1864729) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1864731..1865918) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1865990..1867018) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1867482..1868432 product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1868539..1869021) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138886.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1869208..1870107 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1870164..1871528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1871622..1872467 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1872580..1873701) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene rsmF CDS 1874309..1874779 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1874885..1875511 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene proQ CDS 1875529..1877535 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458272.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene prc CDS 1877667..1878341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1878557..1881166 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene pepN CDS 1881257..1881478 product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1881694..1886535 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 1886553..1887590 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene pyrD CDS 1887762..1888298 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1888807..1890930 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene rlmKL CDS 1891002..1892939 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1892942..1894660 product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087036.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1894788..1894961 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene rmf CDS complement(1895152..1895670) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005390081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene fabA CDS complement(1895736..1897394) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001965088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1897554..1898003 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene matP CDS complement(1898495..1899232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1899435..1899968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1899988..1900446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1900559..1903999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1904142..1908911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1908914..1911427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1911492..1914734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1914864..1915265) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1915268..1916896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1916928..1917644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1917644..1917910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1917940..1918398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1918556..1919002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1919077..1920756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1921035..1921445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1921591..1921869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1921866..1922828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1922886..1923461) product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 1923630..1924589 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1924873..1925832 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1925970..1926758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1927037..1927447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1927595..1927873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1927870..1928832) product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1928890..1929465) product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1929634..1930593 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1930893..1932344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1932838..1933131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1933194..1933568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1933760..1936282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1936319..1936645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1936718..1937416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1937522..1938133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1938159..1939076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1939251..1940402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1940395..1940829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1940826..1941347) product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1941513..1942061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1942360..1944735) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1944844..1945962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1946091..1947512) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1947880..1949721 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1949947..1950894 product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263872.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1950979..1952160) product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene megL CDS complement(1952365..1953321) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1953391..1953843) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1954067..1954969 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1954989..1956698) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1956695..1957894) product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1958306..1959055 product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1959174..1960118 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene uspE CDS complement(1960323..1961216) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene ttcA CDS complement(1961322..1962155) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1962148..1962948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1963172..1963894) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056950.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene cobB CDS complement(1964016..1965236) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1965522..1966931) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1967171..1967752 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene mobA CDS 1967755..1968300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1968413..1969330) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453903.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene nagK CDS complement(1969494..1971455) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1971664..1972005) product DUF3802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453925.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1972288..1973163 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1973467..1974843 product sodium-coupled multidrug efflux MATE transporter VcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene vcmA CDS 1974866..1976026 product DUF3080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1976032..1976880) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1977247..1978539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1978536..1979174) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1979174..1979578) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1979575..1980114) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1980116..1981474) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1981476..1982225) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881338.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1982334..1983287) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1983520..1984254) product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1984270..1984428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1984961..1986349 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1986428..1987357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1987404..1988264) product type VI secretion system accessory protein VasW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene vasW CDS 1988703..1990190 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1990250..1991422) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1991644..1992063) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1992082..1993107) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene arsB CDS complement(1993111..1993839) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene arsH CDS complement(1993882..1994214) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1994397..1995740 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1995818..1997041) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837795.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1997290..1998213) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1998741..1998932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1999147..1999653) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1999655..2000053) product FosA family fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene fos CDS complement(2000119..2001021) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(2001148..2002512) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene eat CDS 2002801..2003805 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 2003946..2005010 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 2005120..2005899 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(2005957..2006436) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(2006544..2010383) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene hrpA CDS 2010828..2011190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647617.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 2011227..2011670 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 2011719..2012276 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(2012340..2013965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 2014451..2015857 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene rimO CDS complement(2015917..2016447) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 2016745..2017365 product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 2017365..2019212 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 2019215..2022013 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 2022378..2023703 product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(2023833..2024339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 2024541..2025731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2025813..2026331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(2026626..2028176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(2028456..2029172) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene queC CDS complement(2029183..2029851) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene queE CDS 2030096..2030902 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(2031099..2031782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(2032249..2032725) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(2032910..2033515) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(2033969..2034535) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene rimJ CDS complement(2034551..2036098) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001888682.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene tyrR CDS complement(2036210..2037253) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(2037250..2038644) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(2038818..2040332) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 2040473..2041873 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene pabB CDS 2041891..2042592 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 2042785..2044149 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(2044231..2044593) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102949761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene queD CDS 2045001..2046401 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene asnS CDS 2046711..2047901 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(2047987..2049045) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene uxuA CDS complement(2049153..2050124) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(2050145..2051503) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(2051522..2052034) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(2052800..2054689) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032474545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 2055021..2056259 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene sufS CDS complement(2056326..2057051) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(2057072..2057830) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(2057847..2059010) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001895735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2059000..2059842) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene ugpE CDS complement(2059876..2060757) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189753.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(2060829..2062124) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 2062393..2062845 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599452.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 2062880..2063092 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221701.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene nqrM CDS complement(2063203..2063865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(2063904..2064626) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(2064718..2065998) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(2066001..2067215) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2067212..2068513) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481611.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(2068506..2069639) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2069856..2072141) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene metE CDS 2072409..2073344 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571234.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene metR CDS complement(2073524..2074276) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706607.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2074269..2075216) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041213497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(2075301..2076110) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2076580..2077053 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(2077118..2077312) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(2077418..2078194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967009.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 2078368..2080602 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481673.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(2080644..2081738) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene serC CDS complement(2081976..2083253) product DUF945 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483545.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 2083509..2085431 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2085477..2085977 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 2086218..2086769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232641.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(2086858..2087487) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459593.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 2087901..2088743 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 2088906..2090543 product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene panP CDS 2090845..2091699 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 2091906..2092169 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 2092401..2094116 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(2094195..2095397) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 2095766..2096737 product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(2096703..2098076) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2098085..2098741) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073945.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 2099535..2100125 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 2100319..2101986 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464936.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 tRNA complement(2102051..2102127) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(2102149..2102225) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 2102501..2103559 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(2103575..2104261) product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(2104314..2105303) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046121557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 2105718..2105942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 2106200..2107141 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene metA CDS 2107286..2107843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2107930..2108160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2108395..2108970 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454856.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2109183..2109938) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene btuD CDS complement(2109922..2110920) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene btuC CDS complement(2111026..2112054) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 2112511..2113731 product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 2113952..2114401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 2114367..2114576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2114731..2116155 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene sbcB CDS 2116191..2116586 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2116586..2117272 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 2117522..2118415 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene cdd CDS 2118616..2119809 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene purT CDS complement(2119922..2120566) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2120682..2120972) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene ihfA CDS complement(2121382..2123769) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene pheT CDS complement(2123787..2124770) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene pheS tRNA complement(2125268..2125343) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(2125351..2125437) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(2125516..2125591) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(2125595..2125668) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 2126084..2126320 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 2126378..2127223 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832742.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2127250..2127828) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(2127931..2129739) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene aspS CDS 2129964..2130857 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 2131022..2131750 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene cmoA CDS 2131825..2132796 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene cmoB CDS 2132935..2133693 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 2133690..2135198 product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 2135195..2136199 product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2136426..2136584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2136816..2137769 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(2137880..2142337) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105766.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene mukB CDS complement(2142334..2143047) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene mukE CDS complement(2143025..2144368) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene mukF CDS complement(2144376..2145188) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene cmoM CDS 2145279..2146082 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene elyC CDS 2146249..2147262 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene purR CDS 2147642..2148232 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360588.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(2148305..2149771) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene glgA CDS complement(2149773..2150990) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene glgC CDS complement(2151317..2153944) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene topA CDS 2154281..2154529 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(2154594..2155874) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene aroA CDS complement(2156079..2156543) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 2156571..2157287 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene aat CDS 2157296..2157985 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2158065..2158283 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene infA CDS complement(2158352..2160616) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene clpA CDS complement(2160661..2160981) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene clpS CDS 2161441..2161662 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene cspD CDS complement(2161753..2163975) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2164310..2164999 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene rluE CDS complement(2165036..2165668) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene hisIE CDS complement(2165665..2166438) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene hisF CDS complement(2166420..2167157) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene hisA CDS complement(2167164..2167799) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene hisH CDS complement(2167799..2168872) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043567.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene hisB CDS complement(2168903..2169946) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene hisC CDS complement(2169949..2171241) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene hisD CDS complement(2171247..2172146) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene hisG CDS complement(2172489..2174051) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 2174719..2175120 product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2175184..2176527) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 2177023..2178180 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459992.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene mnmA CDS 2178198..2178815 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene hflD CDS 2178874..2180244 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene purB CDS complement(2180361..2181224) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene htpX CDS 2181350..2181526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2181537..2181707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(2181836..2182528) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene bioD CDS complement(2182525..2183337) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene bioC CDS complement(2183327..2184487) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene bioF CDS complement(2184500..2185552) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453785.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene bioB CDS 2185657..2186946 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene bioA CDS 2187191..2187613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2187686..2188111) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2188994..2191150 product Svx/AvrXca family virulence/avirulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2191547..2192545 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene ilvE CDS complement(2192727..2194709) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2195070..2195978) product DUF4434 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2195903..2197189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2197220..2198860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2198902..2201103) product cyclic di-3',5'-guanylate-activated glycosyltransferase NrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene nrfB CDS complement(2201090..2202178) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067557116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene wecB CDS 2202936..2205803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2205880..2207775) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2208479..2208886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2209212..2210591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 2210767..2211621 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene yghU CDS complement(2211667..2211897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2211984..2212784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2212860..2213651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2213907..2215214) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(2215757..2217301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 2217733..2218671 product Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2218755..2219702 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2219753..2220850 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 2220847..2221656 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2222253..2222795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2222798..2223997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2224726..2225631) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2225744..2226826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2226717..2226917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2226993..2228912 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2229209..2229604) product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2229726..2230610) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2230747..2232171 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 2232412..2233680 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2233745..2234365) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2234464..2235090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 note possible pseudo, internal stop codon CDS complement(2235402..2239247) product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388592.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(2239364..2240011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(2240012..2240188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(2240330..2240701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2240682..2241233) product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2241363..2242013 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2241974..2242960) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2243841..2246516 product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113974941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2246533..2249361 product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2249349..2250035 product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2250025..2250573 product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964114.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 2250590..2251561 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2251594..2254317 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 2254402..2255268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2255289..2255639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2255918..2256778 product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2256968..2257657 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2257668..2258282 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(2258309..2258692) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236185.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(2258892..2259791) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2259899..2260081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2260108..2260521 product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2260526..2260972 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2260969..2261757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2261882..2262493) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2262625..2263218 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2263220..2263669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009368.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(2263866..2264306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2264464..2265369) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184138029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2265454..2265633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2266105..2266998 product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2267290..2267778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(2268621..2268791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(2268869..2269171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(2269723..2270853) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2270867..2272234) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene hydA CDS complement(2272249..2273511) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2273534..2274811) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene preA CDS complement(2275025..2276347) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2276510..2277439 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 2277645..2279150 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2279334..2280215 product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2280286..2280945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2281549..2281926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 2281904..2282323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2283425..2284414 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 2284595..2285638 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2285741..2285947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2286367..2287143 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2287140..2288822) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene leuA CDS 2288876..2289076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2289001..2289309) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141642.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2289299..2289673) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2289883..2291454) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 2291646..2291948 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2292083..2293003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(2293223..2294152) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2294221..2295042) product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2295054..2296112) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813710.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2296121..2297002) product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene gsiD CDS complement(2297012..2297932) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene gsiC CDS complement(2297966..2299507) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene gsiB CDS complement(2299563..2301392) product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene gsiA CDS complement(2301410..2302381) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene ycjG CDS complement(2302385..2303395) product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 2303747..2304640 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2304819..2305184) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314179.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2306214..2306549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2306546..2308009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2308105..2308317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2308834..2309262 product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2309324..2310574) product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208729.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2310602..2311894) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705409.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2311891..2313492) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(2313489..2314718) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(2314721..2315737) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2315784..2316605) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2316685..2317413) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2317400..2318050) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(2318062..2318730) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(2318746..2319537) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(2320026..2321567) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2321709..2324066) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2324184..2326115) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973925.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2326112..2326960) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973926.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2326966..2327889) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2327936..2329465) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(2329523..2331358) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973929.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2331580..2332482 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 tRNA complement(2332846..2332922) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 2333197..2334057 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420192.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene folD CDS complement(2334923..2335897) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735487.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2335907..2336197) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2336451..2337113 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042146.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene minC CDS 2337144..2337956 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458081.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene minD CDS 2337963..2338229 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene minE CDS complement(2338377..2339588) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene rnd CDS complement(2339596..2341296) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene fadD CDS complement(2341432..2342352) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2342454..2342771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2342833..2343534) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene tsaB CDS complement(2343594..2345702) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2345861..2346061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2346446..2347279 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412706.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene purU CDS 2347460..2349325 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461788.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene sppA CDS 2349445..2350458 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene ansA CDS complement(2350541..2350846) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2350948..2351796 product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2351879..2352283) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene msrB CDS 2352686..2353681 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene gap CDS 2353857..2354747 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2354844..2355692 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene rlmA CDS 2355831..2356187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068121.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(2356269..2357849) product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2357998..2358612) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2358792..2360858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2361413..2361892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2361954..2362457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2362771..2363253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2363327..2364211) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 2364322..2365281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2365417..2366652 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2366871..2367371) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369282.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2367485..2368378 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2368491..2369090) product sarcosine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267519.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2369090..2372008) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2372005..2372316) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267521.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2372344..2373591) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2373596..2374495) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene folD CDS complement(2374507..2375367) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407853.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene purU CDS 2375541..2376296 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2376354..2377826) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2377847..2379478) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2379600..2381090) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2381102..2382136) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2382133..2383041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 note possible pseudo, internal stop codon CDS complement(2383045..2383884) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2383856..2384455) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967417.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2384610..2385287 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973665.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2385268..2385648 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2385679..2385969 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2386072..2387427) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2387805..2389133) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2389149..2389832) product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2389852..2390751) product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2390804..2392138) product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene glnT CDS 2392346..2393059 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2393149..2393592) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2393682..2394083) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265884.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2394177..2394833 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2394964..2395212 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460076.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2395386..2395850) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2395917..2397650) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057937.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2397816..2398115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2398553..2399902 product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2399892..2401007 product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(2401094..2408242) product tandem-95 repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2408477..2409019) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2409035..2409550) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2409562..2410101) product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070580.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2410159..2410455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2410508..2411032) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173398.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2411324..2411653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2412622..2415288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2415327..2417585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(2417867..2419741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2419874..2423128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2423128..2423604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2423597..2424313) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194798.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(2424313..2425014) product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(2425011..2425352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2425352..2427100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2427345..2427785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2427785..2428720) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2429174..2429551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2429722..2430426 product transcriptional regulator AlpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085982.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene alpR CDS complement(2430465..2430902) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499744.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2430938..2431126) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2431404..2431739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2432009..2432503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 2432790..2433290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 note possible pseudo, frameshifted CDS 2433452..2434345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 note possible pseudo, frameshifted CDS 2435215..2436072 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2436272..2436700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2436681..2436932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2436947..2437249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2437451..2437855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 note possible pseudo, internal stop codon CDS 2437783..2437950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 note possible pseudo, internal stop codon CDS 2438005..2438439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 note possible pseudo, internal stop codon CDS 2438570..2438983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2439171..2439839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2439908..2440132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2440157..2440801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 2440922..2441581 product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2441517..2444600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2444854..2445456) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene recR CDS complement(2445472..2445804) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(2445888..2448215) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene dnaX CDS complement(2448228..2448773) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene apt CDS complement(2448969..2449355) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460100.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2449483..2450598) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2451002..2451877 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2451904..2452452) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2452605..2454725) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene fadJ CDS complement(2454718..2456028) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene fadI CDS 2456973..2458247 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2458310..2458795) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2459133..2459492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2459715..2461529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(2461777..2462172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 note possible pseudo, frameshifted CDS complement(2462553..2462828) product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2462851..2463486) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285450.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2463812..2464165 product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2464179..2465054) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2465041..2466162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2466162..2467274) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(2467271..2472781) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031828.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2473733..2474749) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2474770..2474976) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2474979..2475452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(2475442..2478294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2478518..2478955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2479045..2479266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(2479277..2479810) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2479812..2480987) product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2481243..2481812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2481830..2483260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2483303..2483854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2483872..2485251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2485329..2485517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2485531..2486724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2486721..2488787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2488799..2489281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2489417..2490577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2490577..2491422) product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2491419..2491751) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038106.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2491768..2491992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2491955..2492557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2492535..2493077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2493161..2493397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2493367..2493570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2493554..2493955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2493973..2494530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2494454..2494675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2494782..2495468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(2495700..2495915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(2495905..2496627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2496630..2497433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2497588..2497866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 2497969..2498706 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2499488..2500087 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene cobO CDS complement(2500259..2502202) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2502377..2503528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2503584..2508356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2508388..2509596) product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2509962..2510603) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461598.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene udk CDS 2511116..2511781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 2512464..2514425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2514679..2515059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2515709..2516521 product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 2516746..2517744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2518877..2519311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2519304..2520956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2522066..2524330) product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene tdc CDS 2524705..2525406 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 2525537..2525983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 2525983..2526465 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(2526564..2527628) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene apbC CDS 2527972..2530029 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482411.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene metG CDS 2530423..2531229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2531259..2532014) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481824.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene udp CDS complement(2532306..2532728) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(2532935..2533393) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene moaE CDS complement(2533395..2533640) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654167.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene moaD CDS complement(2533637..2534116) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene moaC CDS complement(2534121..2534633) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene moaB CDS complement(2534737..2535723) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene moaA CDS 2536169..2537068 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2537196..2537555) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2537558..2538916) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001888250.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2539314..2541344) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene uvrB CDS 2541607..2542725 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466249.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(2542795..2543928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 2544411..2544740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 2544819..2545397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 2545750..2546202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2546275..2546616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 tRNA 2547332..2547407 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 2547589..2548170 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene rsxA CDS 2548170..2548757 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene rsxB CDS 2548766..2551156 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949723.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene rsxC CDS 2551156..2552202 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863730.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rsxD CDS 2552214..2552849 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rsxG CDS 2552846..2553559 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2553682..2554317 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene nth CDS complement(2554446..2555009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2555023..2556273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2556270..2557178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2557175..2558392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 2558888..2559433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 2559686..2560405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2560449..2561225) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(2561583..2563010) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(2563007..2563729) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 2563920..2564375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2564487..2565104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(2565229..2565648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2566001..2567326) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(2567497..2569776) product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 2570438..2572357 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033929385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2572591..2572818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2572932..2574494) product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 2575503..2576885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2577001..2578422) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 2578935..2580296 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 2580277..2581611 product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2581840..2583459) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2584124..2584819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2584953..2585780) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531095.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(2585788..2586894) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191832.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2586931..2587710) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316181.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2587715..2588599) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2588684..2589697) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(2589713..2590723) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2591324..2592253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 2592577..2592810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 2593245..2594618 product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861390.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 2594942..2596093 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene yiaY CDS 2596169..2597395 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2597421..2599598 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene pta CDS complement(2599694..2600155) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405367.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(2600155..2600577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2600844..2601620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(2602017..2603153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2603197..2603781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 2604004..2605056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(2605168..2606586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(2607001..2608635) product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(2608632..2608988) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463392.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(2609122..2611107) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene fhuB CDS complement(2611104..2612165) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2612156..2612971) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487053.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(2613248..2614102) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904003.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2614422..2616416) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2616670..2618310) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586206.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(2618674..2620317) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586206.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2620572..2621537) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154857.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene citG CDS complement(2621515..2622123) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene citX CDS complement(2622120..2623658) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026596.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene citF CDS complement(2623672..2624547) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164137.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene citE CDS complement(2624544..2624840) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene citD CDS complement(2624916..2625998) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene citC CDS 2626245..2627588 product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003394.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2627662..2627910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 2627949..2629769 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189425.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene oadA CDS 2629784..2631085 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(2631224..2631436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 2631377..2632870 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703393.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2632910..2633587 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2633884..2634162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2634780..2636732 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2636917..2637747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2638693..2639838 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373195.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(2639909..2640394) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705530.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(2640597..2641211) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478593.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2641602..2642372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2642373..2642834 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 2642844..2643725 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(2643727..2644728) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(2644916..2645596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2645785..2645982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2646523..2646744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2646842..2647432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 2647776..2649287 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene norR CDS complement(2649304..2650170) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 2650275..2651435 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2651642..2653522 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262211.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2653666..2653884) product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2653909..2654289) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2654503..2656164 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene hcp CDS 2656468..2657301 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2657609..2658253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2658504..2659142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 2659274..2659648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458016.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2659706..2661091 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478601.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2661134..2662351) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020239.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2662568..2663263 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(2663458..2664075) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2664345..2665070) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2665188..2666093 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2666189..2666911) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142807.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(2666937..2668868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2669253..2670149) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2670311..2670829 product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 2670848..2671957 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(2671991..2672377) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2672605..2673261 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460838.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene ompW CDS 2673537..2674862 product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2675071..2675436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2675749..2676438) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2676431..2678173) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 2678601..2679590 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 2679724..2680203 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 2680203..2681723 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464542.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 2681997..2682491 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2682528..2683211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 2683211..2683684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 2683697..2684173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 2684481..2684822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 2684788..2685276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2685516..2686100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 2686100..2686903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 2687259..2688812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 2688876..2689346 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 2689502..2689945 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2690087..2690281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2690284..2690949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2690959..2692752 product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 2692780..2693079 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 2693146..2693592 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2693596..2697684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2697687..2698628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 2698631..2701063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 2701060..2705871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 2705884..2708535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(2708645..2710807) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213681071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(2710874..2712031) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 2712258..2713667 product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2714119..2714496 product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 2714496..2715254 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 2715625..2716578 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2716813..2717982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(2718035..2718478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2718509..2719957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(2720150..2720428) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(2720425..2720745) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(2720995..2722812) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2723104..2724624 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464448.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(2724960..2725433) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2725681..2728707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2728787..2729866) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2730194..2730937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 2731123..2732004 product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066014.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene hcaR CDS complement(2732001..2733782) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2733782..2734048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 2734343..2735092 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2735232..2735819) product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 2735934..2736815 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141422.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(2737691..2738092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(2738106..2738651) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 2738756..2739595 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2739899..2741896 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(2742003..2743181) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2743617..2744309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478188.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2744748..2745485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2745604..2746239) product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073651.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 2746654..2748543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 2748787..2749176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 2749437..2750252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163851494.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 2750543..2751139 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(2751554..2755462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2755455..2756264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2756261..2758414) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 2758980..2759807 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(2759869..2761257) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454041.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(2761244..2761714) product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(2761715..2762737) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(2762737..2763642) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rimK CDS 2763954..2765141 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705184.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(2765260..2766147) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479133.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 2766270..2767415 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479145.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 2767485..2768288 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 2768440..2768826 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455908.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2768910..2770550) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945835.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2770801..2771676) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2771885..2772682 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125007115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2772988..2773218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 2773193..2773522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2773688..2777854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 2777871..2778914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2778925..2780211 product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396845.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2780208..2781614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(2781709..2783169) product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 2783541..2786123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 2786372..2787331 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 2787791..2789362 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(2789510..2790229) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(2790237..2792162) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2792226..2793503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2793506..2794204) product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene cprR CDS 2794497..2795939 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2796290..2797135) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2797230..2797787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 2797880..2798737 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(2798784..2799986) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2800664..2800876 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 2801256..2801471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2801732..2802442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2802842..2803834) product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 2803967..2804299 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371948.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 2804444..2805319 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene tesB CDS complement(2805506..2805964) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2806196..2807056) product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 2807226..2807816 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 2807838..2809718 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 2809719..2809934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2809924..2811474) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene menE CDS complement(2811462..2812448) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482548.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene menC CDS complement(2812583..2813449) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482536.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene menB CDS complement(2813466..2814305) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950604.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene menH CDS complement(2814289..2815992) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078087.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene menD CDS complement(2816033..2817490) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902260.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 2818591..2820384 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 2820477..2821415 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 2821428..2822492 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 2822506..2824206 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(2824386..2825357) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 2825507..2825977 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(2826039..2826392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(2826530..2827249) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754256.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 2828001..2828402 product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813157.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(2829266..2830267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(2830527..2831513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 2832250..2832450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(2832517..2832693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2833241..2834365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(2834461..2835606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(2835676..2836800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(2836929..2838086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(2838083..2841955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(2841957..2842508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(2842508..2843719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 2844233..2844433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(2844509..2845510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2845770..2846771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(2846776..2850366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114029.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(2850363..2851169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(2851169..2852440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 2852917..2853117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(2853196..2854320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(2854459..2855577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(2855719..2856837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(2856837..2860343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(2860340..2861215) product type VI secretion system accessory protein VasW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene vasW CDS complement(2861212..2863365) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 2863965..2865179 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 2865362..2866153 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 2866402..2867229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(2867408..2868847) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882878.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(2868844..2869668) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2869665..2870615) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(2870608..2872143) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746573.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2872500..2873084 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene yfbR CDS complement(2873175..2873783) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092435.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 2874018..2874347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(2874406..2874870) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(2874952..2876007) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394900.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene sohB CDS 2876087..2876839 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(2877005..2877985) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017256.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 2878025..2878234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(2878292..2879509) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281794.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2879915..2881360 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene pyk CDS complement(2881508..2882656) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711606.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2883411..2884871 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(2885367..2886797) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene ptsG CDS complement(2887250..2888017) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(2887990..2888970) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(2888992..2889621) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991933.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene tmk CDS complement(2889621..2890634) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene mltG CDS complement(2890628..2891434) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289970.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene pabC CDS complement(2891518..2892768) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene fabF CDS complement(2892856..2893089) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406112.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene acpP CDS complement(2893317..2894063) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene fabG CDS complement(2894075..2895004) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene fabD CDS complement(2895076..2896026) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(2896032..2897057) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180565.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene plsX CDS complement(2897067..2897237) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rpmF CDS complement(2897275..2897793) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene yceD CDS 2897948..2898529 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181921.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(2898532..2899485) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002871.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene rluC CDS 2900110..2903097 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461594.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene rne CDS 2903344..2904903 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(2905005..2907710) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461748.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene adhE CDS 2908304..2909158 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(2909261..2910370) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479551.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene asd CDS complement(2910580..2911515) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051797.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene yejK CDS 2911665..2911889 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 2911918..2913723 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228449.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 tRNA 2913774..2913850 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 2914016..2914106 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 2914600..2915316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 2915663..2916238 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(2916333..2917205) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 2917441..2918907 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2919434..2920108 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771069.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2920133..2921407 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058397906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 2921453..2923084 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 2923198..2924157 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401718.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 2924154..2924981 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 2924991..2926904 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103050.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 2926901..2927218 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2927191..2928618 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266228.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 2928678..2929781 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 2929781..2930956 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266226.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene argE CDS 2930949..2932418 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 2932688..2933983 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266223.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene gabT CDS 2934088..2934747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 2934800..2935306 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(2935368..2936357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(2937976..2938785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(2938782..2939786) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2939786..2940910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(2940922..2941272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(2941269..2942090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2942103..2942879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(2943208..2943378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 2943518..2945344 product hemagglutinin/proteinase HapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene hapA CDS complement(2945431..2946192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 2946563..2948164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(2948279..2948578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 2949379..2950125 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene exuR CDS complement(2950360..2951847) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(2951850..2953316) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174192.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(2953342..2954757) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene uxaC CDS complement(2955151..2956527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(2956724..2958763) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2959001..2961253) product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(2961338..2962072) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482845.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 2962938..2963726 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 2963729..2964634 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 2964653..2965804 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene ugpC CDS 2965827..2967116 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2967453..2969117 product pectate disaccharide-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210831.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2969119..2970606 product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 2971406..2972545 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 2972630..2973286 product hexitol phosphatase HxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203403.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene hxpA CDS complement(2973410..2974507) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005498311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2974504..2975430) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(2975430..2976308) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462020.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 2976928..2978559 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 2978657..2979577 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene oppB CDS 2979588..2980490 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene oppC CDS 2980506..2981477 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482402.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 2981465..2982460 product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene oppF CDS 2982602..2982910 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137910.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2982955..2983701) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2983871..2984854) product lipin/Ned1/Smp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966221.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 2985951..2987501 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032475107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(2987508..2989466) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2989542..2989880) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447541.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 2990270..2990854 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863548.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene sodB CDS 2991000..2991521 product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 2991684..2992352 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711500.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(2992366..2993121) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(2993435..2993797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2993944..2994438) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(2994477..2995598) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092964.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(2995600..2996379) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(2996389..2997522) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985860.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(2997550..2999835) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119661.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2999845..3000570) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(3000636..3001016) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211091957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene cheY CDS complement(3001050..3001784) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(3001777..3002664) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(3002678..3004156) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881782.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene flhF CDS complement(3004188..3006269) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881783.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene flhA CDS complement(3006422..3006901) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479576.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene sixA CDS 3007152..3009929 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(3009959..3010555) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478779.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 3010918..3012651 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene argS CDS complement(3012726..3013154) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097334.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(3013447..3015450) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(3015628..3016215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(3016336..3017616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(3018098..3020002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(3020561..3020902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(3020899..3023169) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene feoB CDS complement(3023166..3023396) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(3024132..3024899) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene znuA CDS 3025092..3025877 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455461.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene znuC CDS 3025870..3026661 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene znuB CDS complement(3026767..3027639) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418308.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene sucD CDS complement(3027639..3028805) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418307.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene sucC CDS complement(3028999..3030219) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151221.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene odhB CDS complement(3030246..3033053) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455464.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene sucA CDS complement(3033142..3033855) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455467.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(3033867..3035576) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene sdhA CDS complement(3035634..3035981) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455480.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene sdhD CDS complement(3035975..3036352) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene sdhC CDS 3036763..3038052 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(3038161..3038913) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061710.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 3038992..3039741 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(3039738..3040451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973335.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(3040747..3042393) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455478.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene pgm CDS complement(3042462..3043025) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848401.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene seqA CDS 3043250..3044026 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(3044089..3044256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 3044309..3044836 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179037.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene fldA CDS 3045208..3045660 product ferric iron uptake transcriptional regulator FcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene fcrX CDS complement(3045712..3046725) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(3046709..3047854) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697483.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(3048013..3049224) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene fabB CDS 3049352..3051361 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162806064.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene mnmC CDS complement(3051474..3051737) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479532.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(3051749..3052345) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(3052345..3053430) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479467.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene aroC CDS complement(3053583..3054515) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene prmB CDS 3054579..3055109 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene smrB CDS complement(3055376..3056542) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene manA CDS complement(3056820..3058721) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478109.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 3059194..3060066 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(3060039..3060824) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263542.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(3060825..3061133) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706152.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(3061184..3062281) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840982.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene flhB CDS complement(3062357..3063139) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456297.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene fliR CDS complement(3063154..3063423) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene fliQ CDS complement(3063434..3064267) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831828.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene fliP CDS complement(3064321..3064701) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228179.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene fliO CDS complement(3064705..3065118) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457660.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene fliN CDS complement(3065140..3066186) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene fliM CDS complement(3066195..3066692) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene fliL CDS complement(3066727..3068400) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625952.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(3068503..3068955) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367979.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene fliJ CDS complement(3068960..3070285) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene fliI CDS complement(3070279..3071079) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481084.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene fliH CDS complement(3071142..3072197) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030089.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene fliG CDS complement(3072190..3073932) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene fliF CDS complement(3073949..3074260) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234824.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene fliE CDS complement(3074347..3075762) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457658.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(3075767..3076822) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881834.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(3076962..3078428) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190986.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(3078641..3079051) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene fliS CDS complement(3079064..3079393) product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387035.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(3079371..3081380) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene fliD CDS complement(3081407..3081844) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405330.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene flaG CDS complement(3081913..3083043) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(3083347..3084492) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(3084862..3085992) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251948.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(3086109..3087011) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477170.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 3087353..3087664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(3087695..3087985) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494336.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 3088203..3088562 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 3088580..3089713 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132407.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene dapE CDS 3089718..3090395 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001961251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 3090398..3090610 product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457657.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(3090618..3091625) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene bamC CDS complement(3091684..3092574) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491214.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene dapA CDS 3092939..3093406 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene bcp CDS complement(3093524..3095395) product methyl-accepting chemotaxis protein Mlp24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212589.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene mlp24 CDS complement(3096651..3097721) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 3098277..3099575 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 3099620..3099970 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117768.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene arsC CDS 3099967..3100560 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene wrbA CDS complement(3100562..3101764) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481094.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 3101928..3103169 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786153.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(3103268..3103750) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481362.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene ybaK CDS complement(3104026..3105687) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481350.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene ushA CDS complement(3105959..3106810) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene kdsA CDS complement(3106835..3107644) product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(3107759..3108613) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene prmC CDS complement(3108634..3109722) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456867.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene prfA CDS complement(3109755..3111011) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene hemA CDS 3111179..3111790 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993150.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene lolB CDS 3111772..3112650 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene ispE CDS 3112680..3113624 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 3113767..3114357 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene pth CDS 3114368..3115459 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418193.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene ychF tRNA 3115731..3115807 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 3115827..3115911 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 3115951..3116025 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 3116107..3116183 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 3116203..3116289 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 3116311..3116385 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 3116458..3116542 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 3116580..3116654 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 3116730..3116814 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 3116825..3116901 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 3116926..3117012 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(3117625..3118761) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(3119237..3120376) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154827.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(3120750..3121943) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934642.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene flgL CDS complement(3121954..3123828) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135483.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene flgK CDS complement(3124015..3124962) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene flgJ CDS complement(3124975..3126123) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454020.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(3126127..3126912) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene flgH CDS complement(3126940..3127728) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene flgG CDS complement(3127749..3128498) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene flgF CDS complement(3128682..3129986) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462291.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene flgE CDS complement(3130016..3130723) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene flgD CDS complement(3130740..3131156) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene flgC CDS complement(3131162..3131557) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene flgB CDS complement(3131769..3132596) product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(3132607..3133539) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 3133623..3134366 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881906.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene flgA CDS 3134483..3134803 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907265.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene flgM CDS 3134844..3135269 product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene flgN CDS complement(3135377..3135808) product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene flgP CDS complement(3135818..3136435) product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759070.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 3136659..3137747 product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739493.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 3138052..3140652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(3140730..3142328) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(3142342..3143202) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 3143387..3144085 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 tRNA 3144205..3144280 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 3144409..3145392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 3145313..3145999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(3146112..3147191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 3148519..3149025 product Fe3+-citrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001895039.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(3149229..3150656) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene gltX CDS 3150915..3153674 product copper-translocating P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216364821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene copA tRNA complement(3153768..3153844) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 3154476..3155060 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene smrA CDS complement(3155141..3155767) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene upp CDS 3156415..3157455 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene purM CDS 3157460..3158104 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene purN CDS complement(3158264..3159085) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(3159129..3159704) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene lpcA CDS 3159898..3162324 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene fadE CDS complement(3162369..3163619) product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944348.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(3163633..3164382) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene dnaQ CDS 3164439..3164906 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484436.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene rnhA CDS complement(3164917..3165648) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 3165692..3166450 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene gloB CDS 3166697..3168100 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(3168108..3169004) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456741.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(3169087..3169425) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420517.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene glnB CDS complement(3169583..3170902) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene tilS CDS complement(3171033..3171989) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene accA CDS complement(3172033..3175512) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480973.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene dnaE CDS complement(3175590..3176225) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene rnhB CDS complement(3176215..3177378) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene lpxB CDS complement(3177500..3178288) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581103.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene lpxA CDS complement(3178290..3178748) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene fabZ CDS complement(3178835..3179866) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210023.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene lpxD CDS complement(3179870..3180379) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(3180403..3182817) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene bamA CDS complement(3182872..3184230) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129778.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene rseP CDS complement(3184227..3185432) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456710.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene ispC CDS complement(3185489..3186307) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(3186348..3187100) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene uppS CDS complement(3187190..3187747) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene frr CDS complement(3187781..3188515) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210548.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene pyrH CDS complement(3188671..3189513) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene tsf CDS complement(3189644..3190372) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene rpsB CDS 3190701..3191543 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023305.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene map CDS 3191624..3194245 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene glnD CDS 3194371..3194754 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456756.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 3195072..3196424 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene yegD CDS complement(3196460..3196957) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482983.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene pgpA CDS complement(3196954..3197931) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973101.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene thiL CDS complement(3198044..3198511) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501296.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene nusB CDS complement(3198511..3198981) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene ribE CDS complement(3199105..3200214) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene ribBA CDS complement(3200264..3200935) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483039.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(3200939..3202039) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131994.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene ribD CDS complement(3202051..3202500) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene nrdR CDS complement(3202608..3203858) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(3203873..3205009) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483011.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene proB CDS complement(3205120..3205509) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455997.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene crl CDS complement(3205605..3206849) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287570.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene frsA CDS complement(3207172..3207672) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037415.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene gpt CDS complement(3207665..3208957) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 3209787..3211283 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(3211345..3212706) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456537.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(3212932..3214026) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153985.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene dinB CDS complement(3214014..3215087) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(3215230..3215463) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091359.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene nqrM CDS complement(3215479..3216525) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(3216627..3217850) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene nqrF CDS complement(3217886..3218482) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene nqrE CDS complement(3218490..3219125) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(3219125..3219910) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456526.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(3219897..3221144) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(3221150..3222490) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(3222910..3223221) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene bolA CDS 3223406..3224545 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456632.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 3224710..3225279 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737547.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 3225280..3225861 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456634.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 3225872..3227236 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 3227310..3228212 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene panE CDS 3228209..3228826 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482283.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(3228815..3229264) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626035.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene csdE CDS complement(3229280..3230089) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene tcdA CDS complement(3230216..3231325) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene mltA CDS 3231576..3232913 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene argA CDS 3233204..3233383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(3233403..3235496) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482289.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene recD CDS complement(3235493..3239107) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene recB CDS complement(3239369..3242815) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene recC CDS complement(3242745..3243041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 3243075..3243887 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146407.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 3243961..3244260 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482297.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 3244496..3245524 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312987.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene dapD CDS 3245688..3246695 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 3246959..3248113 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 3248172..3249881 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(3249878..3250093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 3250193..3251122 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(3251280..3253367) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456593.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene fusA CDS complement(3253558..3254826) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene radA CDS 3255072..3257417 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(3257490..3258440) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481549.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene serB CDS 3258542..3259150 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349089.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(3259189..3259893) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456104.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene deoD CDS complement(3259932..3260711) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456105.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene deoC CDS complement(3260820..3262064) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 3262673..3263671 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 3263876..3265444 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704226.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 3265441..3266550 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307647.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 3266553..3267518 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704225.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3267609..3268406) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625948.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3268437..3269216) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene yaaA CDS complement(3269427..3270863) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882045.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 3271586..3271765 product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343854.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3271843..3272394) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979815.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(3272472..3273164) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004496.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene ung CDS complement(3273460..3274374) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene nfo CDS 3274638..3275015 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459053.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene grcA CDS complement(3275154..3276437) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene thrC CDS complement(3276434..3277405) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene thrB CDS complement(3277409..3279868) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene thrA CDS complement(3280184..3280669) product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(3280686..3281096) product DUF3293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589998.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 3281409..3281804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 note possible pseudo, internal stop codon CDS 3281973..3282125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 note possible pseudo, internal stop codon CDS complement(3282310..3284652) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene arcB CDS complement(3284780..3285730) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 3286297..3290829 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene gltB CDS 3290829..3292298 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 3292610..3297073 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene gltB CDS 3297090..3298502 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 3298657..3299355 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene mtnN CDS 3299370..3300317 product cobalamin biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 3300317..3301138 product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene btuF CDS 3301214..3301825 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461192.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(3301978..3302763) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423593.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(3302772..3303797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(3303952..3307170) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene carB CDS complement(3307186..3308325) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene carA CDS complement(3308807..3309616) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461189.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene dapB CDS complement(3309738..3310136) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461225.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene mutT CDS complement(3310219..3312927) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461206.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene secA CDS complement(3313477..3314394) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461213.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene lpxC CDS complement(3314491..3315708) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene ftsZ CDS complement(3315739..3317001) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169466.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene ftsA CDS complement(3316982..3317773) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608980.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(3317954..3319417) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152804.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene murC CDS complement(3319431..3320471) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458193.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene murG CDS complement(3320479..3321633) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480004.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene ftsW CDS complement(3321691..3323010) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625947.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene murD CDS complement(3323046..3324128) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene mraY CDS complement(3324125..3325486) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(3325483..3326979) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene murE CDS complement(3326992..3328710) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458172.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(3328707..3328862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(3329036..3329986) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458168.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene rsmH CDS complement(3330633..3331508) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene rsmI CDS 3331723..3333381 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015481.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 3333368..3333742 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001893625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 3333746..3334336 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458175.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3334340..3334927 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(3335054..3335584) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479701.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene hpt CDS 3335881..3336501 product transcriptional regulator OpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479697.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene opaR CDS complement(3336584..3338011) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene lpdA CDS complement(3338255..3340117) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene aceF CDS complement(3340136..3342796) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462566.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene aceE CDS complement(3342848..3343615) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009602124.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene pdhR CDS complement(3344056..3345801) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene recJ CDS complement(3345891..3346562) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene dsbC CDS complement(3346653..3347561) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene xerD CDS 3347737..3348255 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690112.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene fldB CDS complement(3348345..3349637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 3349978..3351642 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923309.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(3351996..3352394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 3352590..3353705 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 3353900..3355807 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 3356255..3358168 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 3358468..3360372 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796741.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(3360451..3360825) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(3361047..3364025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(3364463..3365221) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214790.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(3365296..3367008) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191535.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene alsS CDS complement(3367091..3367876) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene budA CDS 3367978..3368868 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002023111.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 3369251..3370999 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 3371192..3372091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 3372169..3373014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3373011..3374567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 3374564..3375202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 3375195..3377306 product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(3377405..3377845) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028935.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(3377998..3378204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 3378300..3379157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(3379188..3380135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(3381414..3381872) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(3382009..3383004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(3383683..3384870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(3385455..3386033) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(3386030..3387676) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene pqiB CDS complement(3387666..3389000) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(3389451..3389984) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261496.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene fldA CDS complement(3390124..3390387) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(3390384..3391079) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(3391072..3391698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(3391702..3392697) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene rsxD CDS complement(3392690..3394468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(3394487..3395020) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene rsxB CDS complement(3395034..3395609) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene rsxA CDS 3396083..3397612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 3397619..3399211 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 3399396..3400760 product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene nifB CDS 3400741..3400998 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 3400998..3401591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 3401840..3402142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(3402438..3402734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(3402991..3403401) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(3403582..3403839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 3403932..3404852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(3404996..3405502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3405448..3405861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3406042..3406215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(3406395..3407501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 3407767..3407910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 3408266..3408673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 3408856..3409368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 3409491..3409937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 3410388..3410594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 3410803..3411228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 3411716..3412192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 3412428..3412874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(3412952..3413434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(3413434..3413904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(3414018..3414482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(3414513..3414941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(3415153..3416007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(3416004..3416486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 3416680..3416988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(3417035..3418210) product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene nifV CDS complement(3418319..3419557) product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene nifS CDS complement(3419547..3420449) product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene nifU CDS complement(3420829..3421119) product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943431.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene fdxB CDS complement(3421129..3421617) product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene nifX CDS complement(3421614..3422981) product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338301.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene nifN CDS complement(3422995..3424449) product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene nifE CDS complement(3424721..3425656) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479770.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(3425653..3426357) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065610322.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene pxpB CDS complement(3426354..3427085) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455327.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(3427281..3428165) product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(3428613..3429053) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(3429066..3429251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 3429460..3429744 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 3429741..3430019 product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 3430247..3430444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 note possible pseudo, frameshifted CDS complement(3430529..3431413) product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170130.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3431813..3432304) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 3432486..3433124 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 3433344..3433604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(3433601..3433924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(3434296..3434790) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814182.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(3434899..3435426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(3435931..3436386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(3436405..3437358) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116248.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 3437583..3438704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3438714..3438893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3438886..3439284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 3439284..3439754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 3439759..3440418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 3440667..3441470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 3441479..3441751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 3441761..3441913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 3441910..3442101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 3442104..3442811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 3442813..3443421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 3443418..3443945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 3443938..3444111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 3444137..3444547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 3444639..3444860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 3444860..3445009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 3445183..3445695 product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025673165.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 3445698..3446357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 3446354..3446749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 tRNA complement(3446847..3446923) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(3446946..3447022) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 rRNA complement(3447088..3447198) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(3447322..3450208) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(3450544..3450619) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(3450630..3450705) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(3450716..3450791) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(3450811..3450886) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 rRNA complement(3450954..3452491) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 rRNA complement(3452819..3452929) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA complement(3453055..3455941) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA complement(3456241..3456317) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 rRNA complement(3456378..3457915) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS complement(3458465..3459241) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(3459234..3460967) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455813.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene cysI CDS complement(3460967..3462790) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(3462896..3463135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455817.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(3463221..3464141) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312133.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(3464141..3465157) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(3465141..3466148) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(3466229..3467074) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707089.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(3467077..3468057) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262869.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(3468057..3469652) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(3469874..3470866) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107027.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene dppF CDS complement(3470863..3471831) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209562.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene dppD CDS complement(3471841..3472743) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene dppC CDS complement(3472754..3473764) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525885.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(3473882..3475477) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(3475930..3476127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(3476366..3477346) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477377.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene dusA CDS complement(3477790..3477939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(3478007..3478267) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768134.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(3478264..3479967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 3480615..3481127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 3481167..3481787 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215270200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(3481934..3482392) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460647.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(3482437..3482658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3482895..3483839) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3483990..3485411) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(3485411..3486919) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167411.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(3486921..3487865) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209439.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(3487858..3488688) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(3488843..3489922) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815639.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(3489922..3491439) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(3491445..3492029) product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(3492096..3493031) product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025379354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS 3493306..3494079 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 3494347..3494682 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074395.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 3494679..3494963 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007436.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene nadS CDS 3495002..3495655 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(3495707..3497197) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947330.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(3497373..3498392) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(3498382..3499374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 3499716..3501794 product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265693.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(3501926..3502279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 3502477..3502809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 3502806..3503663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 3503660..3503971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 3503958..3504293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 3504295..3506355 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 3506852..3507805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262457.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(3507829..3508704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(3508996..3510210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(3510200..3510889) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(3510889..3512124) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(3512114..3513346) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(3513348..3514094) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(3514231..3517539) product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 3517980..3518300 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454817.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 3518333..3519172 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 3519174..3521270 product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483457.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 3521270..3521956 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 3522054..3524309 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263834.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 3524451..3525992 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483461.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 3525970..3526998 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 3527119..3528321 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483478.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 3528323..3529543 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263838.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 3529540..3530991 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483422.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 3531022..3532422 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 3532496..3533206 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 3533217..3534341 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483463.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 3534338..3535765 product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483455.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(3535811..3536176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(3536196..3536810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(3536855..3537349) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209806.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 3537681..3538778 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 3538775..3539962 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 3539968..3540609 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 3540914..3541453 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245564.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene zur CDS 3541443..3541904 product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381269.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(3541989..3543644) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916643.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene pgi CDS 3543964..3544383 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3544435..3545847) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 3546059..3546787 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(3546885..3547334) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene rplI CDS complement(3547368..3547595) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090471.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene rpsR CDS complement(3547683..3548078) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421140.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene rpsF CDS complement(3548310..3548786) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395745.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene bfr CDS complement(3548873..3549085) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884452.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3549242..3550426) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene tuf CDS complement(3550539..3552635) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene fusA CDS complement(3552710..3553180) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138050.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene rpsG CDS complement(3553287..3553661) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene rpsL CDS complement(3553811..3554086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(3554097..3554453) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458285.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene tusC CDS complement(3554450..3554845) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene tusD CDS complement(3554842..3555564) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438378.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(3555731..3556537) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene fkpA CDS 3556681..3557661 product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458292.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 3557666..3557893 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261071.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(3557904..3558092) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262721.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(3558168..3559145) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228766.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene hflC CDS complement(3559148..3560338) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460667.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene hflK CDS complement(3560385..3561674) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene hflX CDS complement(3561707..3561970) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438329.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene hfq CDS complement(3562171..3563103) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480058.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 gene miaA CDS complement(3563100..3565073) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155485.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene mutL CDS complement(3565078..3566799) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(3566796..3567257) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene tsaE CDS 3567493..3568611 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene queG CDS 3568839..3569219 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906480.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 tRNA complement(3570060..3570135) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(3570149..3570225) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(3570265..3570340) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(3570354..3570430) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(3570470..3570545) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS complement(3570671..3571216) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene orn CDS 3571371..3572432 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene rsgA CDS 3572516..3573373 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene asd CDS 3573490..3574791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 3574784..3575140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 3575401..3576738 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 3576840..3577721 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 3577882..3579411 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884428.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene gpmM CDS 3579549..3580688 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456946.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(3580718..3581686) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(3581817..3582452) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(3582566..3583642) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene hemE CDS complement(3583778..3584554) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene nudC CDS 3584727..3585215 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(3585291..3589493) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456484.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 gene rpoC CDS complement(3589566..3593597) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456486.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene rpoB CDS complement(3593851..3594222) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene rplL CDS complement(3594280..3594774) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene rplJ CDS complement(3595050..3595754) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene rplA CDS complement(3595759..3596187) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489784.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene rplK CDS complement(3596316..3596864) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287510.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene nusG CDS complement(3596877..3597260) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646629.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene secE CDS complement(3597476..3598660) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene tuf tRNA complement(3598760..3598835) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(3598849..3598923) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(3598961..3599045) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA complement(3599082..3599157) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 CDS 3599424..3600284 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075698.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene coaA CDS complement(3600327..3601304) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658158.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene birA CDS complement(3601301..3602350) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593527.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene murB CDS 3602409..3602849 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626026.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 3603078..3604418 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561723.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene pssA CDS complement(3604483..3605196) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene fre CDS complement(3605297..3606763) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene ubiD CDS complement(3606907..3607884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480957.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(3608012..3609241) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene rho CDS complement(3609477..3609803) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene trxA CDS 3609911..3611233 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458582.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene rhlB CDS 3611242..3612735 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene gppA CDS complement(3612772..3616248) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(3616398..3617588) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494988.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 3617858..3619684 product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112968.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 3619690..3620358 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104320.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 3620532..3622496 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287249.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene acs CDS 3622852..3623340 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478606.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene aroQ CDS 3623401..3623865 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene accB CDS 3623880..3625223 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene accC CDS 3625361..3625642 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340020.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 3625635..3627095 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene panF CDS 3627360..3628244 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene prmA CDS 3628390..3629361 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene dusB CDS 3629382..3629678 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene fis CDS complement(3630489..3630689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(3631064..3632464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(3632451..3632978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(3633072..3634631) product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090628599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(3634628..3634894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(3634887..3635129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(3635213..3636130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 3636619..3637425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 3637475..3637975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 note possible pseudo, frameshifted CDS 3638137..3639030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 note possible pseudo, frameshifted CDS complement(3639364..3640596) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193822371.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(3640922..3641407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3641411..3642361) product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 3642680..3643462 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 3643517..3644392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(3644442..3645344) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(3645350..3646078) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 3646865..3647278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(3647366..3649063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(3649285..3649839) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529441.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 3649959..3651065 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 3651080..3652285 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 3652298..3652738 product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 3652937..3653527 product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104914.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 3653793..3654713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(3654774..3655256) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 3655549..3657603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 3657827..3659419 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene purH CDS 3659492..3660787 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene purD CDS complement(3660852..3661550) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813300.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(3661598..3661870) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044507.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene hupA CDS complement(3662102..3662695) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 3662747..3663355 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941132.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 3663443..3664498 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050971.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene wecA CDS 3664586..3665461 product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase WbbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene wbbL CDS complement(3665573..3667114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(3667346..3670477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(3670485..3671237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(3671224..3672534) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(3672701..3674761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(3675021..3677123) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene gspD CDS complement(3677192..3677692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(3677689..3678330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3678330..3679445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(3679479..3680456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3680443..3681150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(3681143..3681556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(3681543..3681959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(3681959..3682390) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene gspG CDS complement(3682407..3683588) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(3683591..3685255) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(3685286..3686071) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(3686124..3686657) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene rfbC CDS complement(3686659..3687537) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene rfbA CDS complement(3687534..3688466) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023610.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene rfbD CDS complement(3688467..3689549) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697846.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene rfbB CDS complement(3689664..3690632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3690859..3691800 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466230.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene rfaD CDS 3691888..3693054 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene ugd CDS 3693126..3694175 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064632.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(3694232..3695020) product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(3695017..3696255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(3696316..3697368) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene waaF CDS complement(3697459..3698610) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 3698847..3700112 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466242.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene waaA CDS 3700097..3701128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073584690.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(3701203..3702402) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261009.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(3702419..3703189) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(3703190..3703879) product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261007.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(3703930..3704907) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077753831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(3704911..3705972) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459658.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(3705983..3706639) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(3706626..3707702) product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459663.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene neuB CDS complement(3707710..3708888) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene neuC CDS complement(3708925..3710079) product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459668.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(3710094..3711281) product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 3711456..3712226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(3712211..3712918) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(3712926..3713312) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459671.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 3713520..3714305 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042983.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(3714274..3715308) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 3715496..3715990 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene coaD CDS complement(3716011..3716820) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462495.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene mutM CDS complement(3716826..3717320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462494.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(3717484..3717651) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene rpmG CDS complement(3717665..3717901) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene rpmB CDS complement(3718179..3718853) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene radC CDS complement(3718991..3720670) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162797424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 3720866..3722068 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190972.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene coaBC CDS 3722196..3722786 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene slmA CDS 3722893..3723765 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076197.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 3723788..3724774 product lipid A biosynthesis myristoyltransferase LpxN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283385.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene lpxN CDS complement(3724863..3725504) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene pyrE CDS complement(3725591..3726307) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene rph CDS 3726450..3727316 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(3727483..3728796) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851832.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 3729084..3730229 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(3730464..3731207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 3731343..3732179 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(3732251..3733105) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560561.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene qorB CDS 3733269..3733664 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267585.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(3733808..3734272) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(3734528..3735619) product M35 family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818083.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(3736047..3737132) product M35 family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818083.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(3737437..3737877) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423792.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 3737983..3738567 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029627583.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(3738646..3739971) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(3740331..3742217) product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640442.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(3742650..3743540) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817235.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 3743729..3745045 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 3745189..3746721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(3747109..3749466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(3749482..3751338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 3751573..3751767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(3751911..3752120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(3752124..3752411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 3752964..3755276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 3755273..3756085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 3756082..3758172 product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 3758165..3758944 product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733292.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 3758949..3759734 product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733292.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 3759820..3760509 product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733292.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 3760502..3761068 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644491.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 3761109..3761615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(3761768..3762445) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038458.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(3762570..3763982) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 3764093..3765046 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727136.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(3765250..3766155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(3766142..3767707) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(3767704..3768381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(3768726..3768860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 3768906..3769550 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097919.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(3769557..3770465) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194581.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 3770595..3771662 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 3771865..3772467 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723780.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 3772464..3773117 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703621.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(3773201..3773749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(3773772..3774059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961035.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(3774212..3775513) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(3775529..3777331) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189425.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene oadA CDS complement(3777328..3777597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(3777726..3778340) product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene ttdB CDS complement(3778352..3779251) product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703619.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene ttdA CDS complement(3779278..3780546) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 3780933..3781739 product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(3781756..3782241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(3782605..3783045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(3783288..3784469) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209588.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 3784752..3786203 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050158375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene xylB CDS 3786526..3787530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 3787523..3791434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 3791447..3791896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(3791936..3792676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 note possible pseudo, frameshifted CDS complement(3792673..3793059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 note possible pseudo, frameshifted CDS 3793093..3793230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 3793223..3793813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 3794007..3795023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 3795020..3795613 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990418.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(3795616..3796338) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene yigB CDS complement(3796342..3797274) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459099.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene xerC CDS complement(3797276..3797965) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084657.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(3797977..3798807) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene dapF CDS complement(3798816..3800066) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene lysA CDS 3800291..3800605 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459084.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene cyaY CDS complement(3800607..3803156) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149662.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 3803494..3804438 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene hemC CDS 3804435..3805172 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217491.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 3805185..3806366 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 3806363..3807559 product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478975.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(3807675..3809051) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100647.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene hemN CDS complement(3809208..3809696) product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(3809712..3810263) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091428.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene yihI CDS complement(3810260..3810901) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 3811612..3812253 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene yihA CDS complement(3813027..3815840) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene polA CDS complement(3816384..3817424) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116550.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene hemB CDS 3817686..3818450 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(3818514..3819260) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459771.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene tatC CDS complement(3819330..3819686) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene tatB CDS complement(3819696..3819935) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene tatA CDS complement(3819999..3821633) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478626.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene ubiB CDS complement(3821630..3822259) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(3822288..3823055) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132703.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene ubiE CDS complement(3823269..3824771) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560136.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene rmuC CDS 3824952..3826799 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 3827690..3829915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 3830080..3830970 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478651.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 3831068..3831847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(3832693..3834651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(3835330..3837189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 3837734..3837940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(3837897..3840071) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene uvrD CDS 3840418..3842778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(3842863..3844905) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene prlC CDS 3845173..3846012 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262845.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 3846152..3847504 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190697.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene gorA CDS complement(3847584..3848558) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(3849535..3850953) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(3851019..3851405) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(3851417..3852682) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene ectB CDS complement(3852705..3853265) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477699.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene ectA CDS complement(3853562..3853987) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(3854078..3854527) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(3854783..3855709) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 tRNA complement(3856063..3856139) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(3856185..3856260) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(3856276..3856352) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(3856384..3856459) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(3856497..3856573) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS complement(3856745..3858673) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene rep CDS 3859046..3860152 product multidrug efflux RND transporter periplasmic adaptor subunit VexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759349.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene vexA CDS 3860164..3863235 product multidrug efflux RND transporter permease subunit VmeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478703.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene vmeD CDS 3863476..3863739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS 3863885..3864151 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455224.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(3864208..3865692) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene ilvC CDS 3865996..3866814 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022809.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene ilvY CDS 3867000..3867266 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005426051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene tusA CDS complement(3867310..3868326) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(3868346..3869305) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(3869307..3870275) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(3870285..3870602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 note possible pseudo, frameshifted CDS complement(3870617..3871765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 note possible pseudo, frameshifted CDS complement(3871789..3873015) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(3873026..3873538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(3873535..3873966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(3873968..3875173) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(3875203..3875469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(3875480..3876910) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(3876982..3877734) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene cpaB CDS complement(3877731..3879074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(3879090..3879599) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482299.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(3879834..3879995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(3880277..3880444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 3881160..3881492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 tRNA complement(3881540..3881616) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 rRNA complement(3881682..3881792) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA complement(3881916..3884802) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 tRNA complement(3885138..3885213) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA complement(3885224..3885299) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(3885310..3885385) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(3885405..3885480) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 rRNA complement(3885548..3887085) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 CDS 3887669..3888217 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(3888214..3888477) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461429.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(3888474..3889310) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene aroE CDS complement(3889389..3890303) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene hemF CDS complement(3890308..3890868) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 3891069..3891554 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene purE CDS 3891560..3892687 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461432.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(3892713..3893291) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087521.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(3893306..3893782) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(3893785..3894924) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654772.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene dprA CDS 3895144..3895665 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene def CDS 3895677..3896624 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481155.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene fmt CDS 3896673..3897959 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene rsmB CDS 3898002..3899378 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene trkA CDS 3899403..3900848 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 3901416..3901694 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461387.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 3901777..3902757 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 3902791..3903390 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(3903520..3904407) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481175.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(3904557..3906080) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521788.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 3906589..3908235 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145255.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene ilvG CDS 3908249..3908533 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190200.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene ilvM CDS 3908657..3910498 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene ilvD CDS 3910500..3912026 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481158.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene ilvA CDS 3912219..3912515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 3912717..3912965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 tRNA complement(3913443..3913533) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 rRNA complement(3913582..3913692) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 rRNA complement(3913818..3916704) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 tRNA complement(3916996..3917071) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 rRNA complement(3917138..3918675) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 CDS complement(3919115..3919627) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465051.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene hemG CDS complement(3919653..3921137) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(3921134..3921769) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465047.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(3921905..3923263) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456025.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene glmU CDS complement(3923422..3923844) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456027.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(3923863..3925266) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481178.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene atpD CDS complement(3925302..3926171) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene atpG CDS complement(3926218..3927759) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene atpA CDS complement(3927773..3928306) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene atpH CDS complement(3928321..3928791) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene atpF CDS complement(3928852..3929094) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene atpE CDS complement(3929143..3929925) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene atpB CDS complement(3929938..3930303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(3930432..3931343) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458443.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(3931369..3932142) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(3932158..3932790) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene rsmG CDS complement(3932791..3934686) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965608.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene mnmG sequence2 source 1..1347553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1446..3422 product DUF3346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093519.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 3802..4002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026548.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 4160..4369 product DUF3283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009502.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 4458..5177 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421967.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 5821..6762 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455699.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene cyoA CDS 6765..8789 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483356.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene cyoB CDS 8779..9381 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706742.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 9381..9695 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483339.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene cyoD CDS 9700..10575 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195157148.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene cyoE CDS 10971..13424 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805372.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 13711..15900 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778752.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene glgB CDS 16112..16621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 16741..18180 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 18445..18711 product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(18892..19851) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190395680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 20089..21477 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(21607..22311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 22532..23896 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(24121..25947) product multidrug efflux ABC transporter VcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475345.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene vcaM CDS complement(26220..28208) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene glgX CDS 28699..29901 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021273.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(30077..31297) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180737.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene sstT CDS complement(31667..32584) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS complement(32729..33460) product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088585.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 33742..34881 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(35034..36617) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478159.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(36598..37311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 note possible pseudo, frameshifted CDS complement(37308..38084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 note possible pseudo, frameshifted CDS 38490..39440 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS 39430..40242 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478375.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 40239..41666 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241766.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene phrB CDS 41656..42558 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(42701..42970) product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038496.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 43334..44641 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499754.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(44747..46309) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249514.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(46833..48476) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478327.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 48824..49648 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 49742..50671 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150748.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene pstC CDS 50674..51537 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene pstA CDS 51590..52339 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene pstB CDS 52831..53130 product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608713.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 53368..54681 product peptidoglycan DD-metalloendopeptidase ShyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227341.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene shyA CDS complement(54858..56729) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169386.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 57004..57357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187740.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(57550..58524) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263347.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(58874..60823) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(61161..61907) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705786.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 62238..62843 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971537.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 62983..64350 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524734.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(64639..66165) product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479975.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 66322..66903 product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056770.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(67311..68228) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151687.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 68394..68672 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene ppiC CDS complement(68731..69279) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088091.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene speG CDS complement(69435..69683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018760.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 69833..70735 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(70813..71304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478146.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 71588..72340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 72392..72613 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(72649..73050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(73104..73619) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094384.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(73859..75520) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106518.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(75514..77460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(77453..78421) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135747.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(78429..78902) product DUF4381 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665196.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(78903..79820) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178614.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(79831..80787) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 81152..81355 product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462979.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 82049..83287 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793856.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene pepT CDS complement(83499..83708) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 84204..85211 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009679.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 85214..85654 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 85730..87202 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130880.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(87199..87771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 88247..89290 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(90083..91051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 91254..91475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(91529..92485) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(92781..93929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(94452..94652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(95107..95697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(96538..98028) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(98095..99366) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173608.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 99540..100343 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969797.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 100575..101648 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 101648..102571 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337461.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 102571..103386 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 103668..104693 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 104867..105637 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269161.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 105638..107002 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 107120..107293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 107435..109267 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 109276..111105 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 111327..111902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(111920..113161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(113223..114287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(114318..115382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587531.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(115406..116653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(117024..118136) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(118133..119215) product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(119226..119696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(119700..121763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(121917..122102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 122418..123137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(123082..124371) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528502.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(124343..125101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 125202..125456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(125735..126082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(126075..126332) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490667.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(126483..126995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 127532..127792 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 127792..128100 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 128207..128434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 128431..128769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(129448..129645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(130004..132424) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 133221..134414 product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 134488..135147 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene cbiC CDS 135147..136433 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649057.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 136430..137194 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092521.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene cobI CDS 137205..138842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 138839..139678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 139671..140498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 140495..141301 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870280.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene cobM CDS 141502..142875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 142865..143833 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene cbiB CDS 143936..144976 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene cobD CDS 145050..145616 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene cobU CDS 145613..146626 product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 146640..148061 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 148116..149411 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268582.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 149408..150061 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704328.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene gpmB CDS complement(150282..151088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(151277..152515) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414469.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 152629..153081 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426186.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene soxR CDS 153195..153977 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813026.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(154183..154380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 154972..155220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(155475..156578) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975069.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 156946..158019 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(158160..158795) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070529.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 158973..159689 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(160053..161012) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 161407..161526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 161748..162086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(162137..163144) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969387.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(163241..163888) product dual specificity protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969589.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(163885..164721) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975064.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(164950..166116) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975069.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(166116..167282) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969593.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(167285..169108) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 170122..170523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 170729..171019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 171189..171476 product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091022.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 171830..172027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 172422..173066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 173207..173977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 174447..174644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(174770..175663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 note possible pseudo, frameshifted CDS complement(175825..176325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 note possible pseudo, frameshifted CDS 176820..177077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 177092..177373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 177997..178497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 178537..179244 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263461.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(179321..179971) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477780.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(180093..180278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(180335..181501) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072292.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 note possible pseudo, frameshifted CDS 181629..182231 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029627583.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(182315..182809) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(182920..184932) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene nadE CDS 185133..186803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(186897..187412) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409241.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 187822..187965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 188422..188568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 189262..190224 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267800.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 190234..191247 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267801.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 191240..192256 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267802.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 192278..193123 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 193131..193901 product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267803.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(194031..196142) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(196470..196919) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261122.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(197227..197889) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112419.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 198087..199304 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 199444..200982 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044930.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 201071..201520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(201583..202275) product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482349.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(202268..202837) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352315.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(202917..203531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 203731..203904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(204022..206691) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478418.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene gcvP CDS complement(206998..207378) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene gcvH CDS 207626..208249 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287804.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 208374..209510 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene gcvT CDS 209721..210881 product GlyGly-anchored extracellular serine protease VesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233647.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene vesA CDS complement(210978..212738) product regulatory protein ScrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105816.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene scrG CDS complement(212973..213470) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 213804..214319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 214764..215960 product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072096.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(216288..217778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(217917..218780) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 219189..219764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021703980.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 219990..220301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(220369..221274) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(221480..222739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 223482..225242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 225528..225854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 225995..226654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 226750..227397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 227394..228077 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065838.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene modB CDS 228773..229855 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489161.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 229933..230559 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481843.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 230687..231883 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(231972..233957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 234447..235064 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 235363..236157 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(236243..237250) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene add CDS complement(237510..239510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(239618..240424) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 240732..241826 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215298.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 242013..242468 product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704994.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 242699..243649 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 243756..243971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 244195..244620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(244669..245508) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529691.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 245631..246506 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808761.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(246555..247955) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071116.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(247965..249905) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(249911..251104) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 251873..252292 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463700.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 gene rbsD CDS 252322..253827 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene rbsA CDS 253824..254804 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene rbsC CDS 254917..255795 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene rbsB CDS 256028..256945 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463705.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene rbsK CDS 256962..257975 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 258324..259994 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279763.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(260077..260937) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666622.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(260937..261842) product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211844.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene yfeC CDS complement(261839..262732) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(262729..263607) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 263977..264654 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462115.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 265346..266932 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941693.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 267191..269119 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490070.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene thrS CDS 269285..269674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 269774..269968 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462620.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene rpmI CDS 270007..270360 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene rplT CDS 270919..272043 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene ald CDS 272439..272969 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481267.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 273153..273755 product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477314.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 274018..275163 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 275395..275886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(275989..276708) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483391.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 note possible pseudo, frameshifted CDS 276970..277623 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(277729..278628) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931266.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 279003..280898 product L-tyrosine/L-tryptophan isonitrile synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883067.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 281335..281661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS 282044..285157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 285764..287047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(287262..287729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(288280..288636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(288683..289942) product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107018.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 290953..291375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 291385..291585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 291675..292217 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261942.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(292337..293371) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(293669..294592) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 294776..295765 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530761.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 295922..296692 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096479.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 296935..297447 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106219.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(297605..298522) product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(298516..299559) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818717.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 299950..302673 product bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 302710..306039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 306054..306569 product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 306566..307873 product PelD GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 307863..308870 product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS 308854..309027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 note possible pseudo, frameshifted CDS 309068..310387 product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene pelF note possible pseudo, frameshifted CDS 310375..311745 product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene pelG CDS 311705..311914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(311844..312677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 312993..313922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 314038..314331 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(314392..314775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 note possible pseudo, frameshifted CDS complement(314906..315658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 note possible pseudo, frameshifted CDS 315839..316297 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477070.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(316417..317457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490755.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(317454..317894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 318010..320679 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477185.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(320686..321150) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624159.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 321644..321865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 321905..322315 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479962.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 322302..323138 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747481.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(323109..323975) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 324432..325337 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896539.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(325374..326432) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210005.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 gene pyrC CDS 326658..328475 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094396.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(328496..329125) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480809.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 329302..330414 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(330491..331030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(331259..331564) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488152.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 332082..332543 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 332809..334725 product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479772.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(334937..335551) product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284008.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(335897..336646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(336758..338089) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706611.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(338113..339024) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706612.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(339310..340530) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 340820..341365 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(341383..341547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(341892..343340) product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene gnd CDS complement(343354..344070) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene pgl CDS complement(344067..345569) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626064.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene zwf CDS complement(346015..346893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 note possible pseudo, frameshifted CDS complement(346947..348881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 note possible pseudo, internal stop codon, frameshifted CDS complement(349206..350285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(350976..352160) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176010.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 352831..354498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(354604..355536) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926300.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 355749..356945 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092856.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 356978..358009 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692622.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene tdh CDS 358371..359315 product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 359481..359825 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(360043..360291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(360719..360901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 361311..361793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 361960..362265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(362491..362976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 363151..363996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 364071..364682 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257714.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 364776..365399 product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803562.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 365396..366949 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079865.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 366946..367614 product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145530.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 367637..368287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477695.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 368287..368943 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238038.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 368933..370369 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464467.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 370560..371357 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477831.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 372425..372859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 372995..374095 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(374192..376552) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007386.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(376732..377007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 377006..378256 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(378317..379369) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463529.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene aroG CDS 379785..381533 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088336.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(381625..382656) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711460.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 383338..383646 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417897.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 383659..384981 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 385054..385356 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 385402..386817 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(386888..388915) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712488.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 389160..389771 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(389885..391612) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206151.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(391907..393031) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263671.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(393240..394565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(394581..396032) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(396104..398536) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(398536..399270) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(399319..400584) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(401103..401651) product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946769.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(401808..402731) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762877.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 402997..404523 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267554.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 404596..405513 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617711.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 405528..406433 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762883.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 406607..407674 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762885.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 407658..408485 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762887.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 408567..409982 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267550.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 409975..411165 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 411370..412962 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915500.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(413149..414258) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 414426..414908 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486498.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 415123..415833 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809002.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 415965..416525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(416823..417335) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423733.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(417360..418367) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene proX CDS complement(418717..419721) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene proX CDS complement(419739..420821) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464578.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene proW CDS complement(420826..422013) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464644.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene proV CDS 422268..423158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464201.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 423261..423611 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422463.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(423862..425190) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460955.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(425575..426405) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480808.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene nadE CDS 426503..427030 product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717524.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 427247..428797 product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362852.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(428898..429335) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102967.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene trxC CDS 429591..429971 product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 430361..431026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 note possible pseudo, frameshifted CDS 431043..431306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 431541..433733 product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 434061..435806 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707759.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(435850..436095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 436350..437129 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 437213..437899 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 437896..438615 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569958.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 438624..439397 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293601.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene hisP CDS 439413..440405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 440646..441680 product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085950.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene aruF CDS 441711..442748 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169035.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene astA CDS 442745..444214 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079221.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene astD CDS 444247..445581 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212029.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene astB CDS 445601..446608 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212028.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene astE CDS complement(446656..446952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(447173..448057) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771225.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(448416..449555) product elastinolytic metalloprotease LasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895585.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene lasA CDS complement(449678..449893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS complement(450326..450988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(451167..451670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(451816..453519) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene betA CDS complement(453602..454336) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 454790..455563 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381525.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 455644..456759 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764877.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS complement(457096..457977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(458374..459135) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 459633..460187 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477071.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene betI CDS 460206..461666 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene betB CDS 461681..463381 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477133.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene betA CDS 463415..464347 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463665.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 464410..465252 product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene choW CDS 465255..466433 product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477289.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene choV CDS 467398..468903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(468969..470849) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 471025..472002 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096169.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 472137..473129 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene gap CDS 473404..474243 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(474276..475118) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(475525..476904) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 477251..478426 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(478612..479334) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263231.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(479331..481265) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(481284..482993) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(483103..484089) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene iolG CDS complement(484684..485574) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene iolE CDS complement(485660..487657) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene iolC CDS complement(487750..487998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(488067..489983) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098258.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene iolD CDS 490319..491143 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene iolB CDS 491526..492482 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704664.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(492556..493806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(493787..495046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(495043..497481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(497518..497994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(497895..498674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(498963..499625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(499699..501210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 501480..502832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 503078..503842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(503912..504820) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 505328..505873 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526238.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 506059..506355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 506530..507768 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459989.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(507785..508705) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263246.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 508872..510413 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(510516..511559) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129732.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 511719..512288 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261551.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(512339..512926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 513191..513358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 513411..514055 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454937.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(514168..515310) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(515659..517833) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682151.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 518096..518554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 518799..519035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393681.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 519292..519675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(519923..521530) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 521991..522440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 522976..525291 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114064.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 525402..525848 product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966593.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 526019..526984 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene dmeF CDS 526981..527400 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463375.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(527397..527609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(527542..528447) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298308.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 repeat_region 528655..528982 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctacacggcagtgaac CDS 529631..530125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 repeat_region 530162..530609 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatacggcagtgaac CDS complement(531655..532251) product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene cas6f CDS complement(532254..533267) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene csy3 CDS complement(533281..535641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 536175..538055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 538052..538414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(538493..541810) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene cas3f CDS complement(541813..542781) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene cas1f repeat_region 542872..543080 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttctaagctgcctatacggcagtgaac CDS 543962..544207 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142529.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 544204..544503 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 repeat_region 544503..544710 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatacggcagtgaac CDS 545912..546280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 546404..547285 product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170130.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 repeat_region 547324..547531 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatacggcagtaaac CDS complement(547888..548352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(548365..549510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 repeat_region 549850..550117 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatacggcagtaaac CDS complement(551485..552156) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477285.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 552260..553687 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477085.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(553758..555389) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073402.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 555915..556841 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(557016..557819) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(557821..558990) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(559109..560050) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 560539..561333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 561528..562718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 563042..563719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 563716..564099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(564109..564864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 565056..565973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 566112..567023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(567067..568026) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene fabK CDS 568479..568898 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS 568895..569620 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 569632..570933 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684174.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 570933..571670 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145047.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 571698..572945 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625998.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 572942..573478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 573450..574109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 574090..574725 product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460054.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS complement(575028..577019) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484954.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene rnb CDS 577535..579406 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154248.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(579540..583028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 583650..584426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 584776..585042 product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 585089..585355 product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 585400..585666 product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 585713..585979 product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 586086..586478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 586497..586811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 586949..587341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 587552..588391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(588458..589027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(589017..591575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(591806..592852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(592863..593960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 594190..594543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 594892..596049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 596233..596733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(596977..597885) product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170130.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(598028..599257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(599609..601786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(602134..602340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 602438..603058 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene ahpC CDS 603218..604786 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene ahpF CDS complement(605024..605845) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(606069..606287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(606321..606923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(606957..607493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(607558..608196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(608538..609668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 609929..610543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 610653..611501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS complement(611612..612853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 613097..613930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(614009..614545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(614614..615666) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 616080..617432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(617477..617692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(617734..617931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 618136..619137 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935709.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(619048..619356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 619816..620337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 620697..622442 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 gene ggt CDS complement(622742..623260) product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458957.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(623450..624097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(624094..627813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 628823..630040 product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048084.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene scfB CDS 630049..631245 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(631309..631869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 632446..633552 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819899.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 633690..634505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 634719..635288 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 635305..636279 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217028.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(636345..639128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 639629..640033 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene umuD CDS 640037..641293 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 641442..642506 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 642613..643110 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(643160..645373) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene katG CDS complement(645412..645579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(645753..647303) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777301.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(647335..647898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(648147..650504) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 651111..652661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 652725..653267 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477406.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(653280..654614) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(654745..655458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(655529..655954) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084988.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(655960..656649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(656634..657713) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(657718..658413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(658416..658823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(659088..662534) product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 662596..662853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 662850..664259 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706100.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene ascB CDS complement(664481..664939) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 665438..665782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 666066..667478 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 667475..668389 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 668478..669128 product prephenate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968341.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene bacA CDS 669122..669691 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206761.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 669779..670738 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947905.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(670902..671780) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420773.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 671969..673528 product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(673619..674458) product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262684.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(674560..675930) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029398.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(676265..678973) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480178.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene malT CDS 679507..681963 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805372.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 682189..684363 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene malQ CDS complement(684604..685563) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(685934..687226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(687497..688633) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene malK CDS 689431..690624 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786217.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene malE CDS 690872..692446 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895488.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene malF CDS 692460..693350 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463109.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene malG CDS 693563..694009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 694259..695032 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180349589.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 695246..695695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 695835..696341 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047180.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 696356..696862 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705267.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(697029..698948) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480536.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 699131..699862 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459933.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 699866..700507 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552566.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(700623..702140) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464136.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 702436..703365 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186333.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 703409..703738 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(703765..704046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(704050..704307) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693946.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 704535..704726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 705021..705365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 705362..707665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(707771..708340) product PhnA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102406.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 708538..708972 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626096.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 709051..710751 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 710764..711651 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950819.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(711732..714428) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349829.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 714601..715242 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717554.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 715318..716322 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169444.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(716306..717271) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263422.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 717372..717746 product DUF3319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257351.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 717748..718059 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 gene yciH CDS complement(718232..718942) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230025.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 719320..721467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 721694..725875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 725914..726510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 726612..726806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 726803..728446 product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 728443..729699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 729696..744386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 744387..746333 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061273.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene asnB CDS 746499..753938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 754163..756070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 756201..756686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40800 note possible pseudo, frameshifted CDS 756646..757026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 note possible pseudo, frameshifted CDS complement(757077..757586) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118400.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(757588..757872) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054775.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(758141..758401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 758625..758939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 758936..759541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 760109..760396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 760389..760760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 760777..761283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 761398..762054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105875.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 762304..763131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 763141..763431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 763440..763601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 763598..763810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 763789..764340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 764343..765056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 765060..765668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 765665..766192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 766185..766349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 766342..766860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939016.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 766961..767182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 767182..767340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 767333..767485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(767525..768718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(768846..769229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 769538..769915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 769905..770408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(770455..771276) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene queF CDS complement(771294..772148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(772141..772740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 773112..773363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS complement(774112..775263) product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822678.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(775325..776212) product DUF2861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(776216..776872) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815044.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(776847..778292) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960565.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(778471..779847) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461042.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene pntB CDS complement(779859..781394) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461001.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(781875..782153) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(782154..782531) product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177156.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(782537..782689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 782638..782808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 783122..784177 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098952.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(784653..785957) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262120.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 786492..787922 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224052.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene aspA CDS 788006..789067 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479812.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene ansB CDS complement(789138..790064) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262119.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS 790634..791809 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 791951..793756 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene frdA CDS 793758..794489 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 794499..794882 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381491.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene frdC CDS 794895..795257 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884009.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 gene frdD CDS complement(795497..795730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 796485..797483 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456547.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(797593..798651) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263236.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene galM CDS complement(798664..799830) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene galK CDS complement(799930..800988) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292387.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(801061..802083) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene galE CDS complement(802627..803625) product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(804046..805317) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215759.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(805522..807597) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(807610..808200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 note possible pseudo, frameshifted CDS complement(808214..808831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 note possible pseudo, frameshifted CDS complement(808850..809695) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097215.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(809702..811006) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209900.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(811071..812309) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097217.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 812579..813685 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209902.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 813792..814802 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976341.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 tRNA complement(815031..815105) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 CDS 815372..815554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025950.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 815949..817418 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224052.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene aspA CDS complement(817538..818617) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 gene modC CDS complement(818614..819294) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene modB CDS complement(819348..820091) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene modA CDS complement(820352..822061) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870878.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS complement(822439..823977) product multidrug efflux MFS transporter permease subunit VceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene vceB CDS complement(823990..825192) product multidrug efflux MFS transporter adaptor subunit VceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625982.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene vceA CDS complement(825249..826607) product multidrug efflux MFS transporter outer membrane subunit VceC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene vceC CDS 826803..827399 product TetR family multidrug efflux transcriptional regulator VceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264144.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene vceR CDS 827499..828809 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104657.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene guaD CDS 828854..829708 product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932141.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene modD CDS 830364..831527 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035887.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 831685..832335 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482741.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene elbB CDS 832589..833635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 834040..835092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(835205..836719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 836958..837143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(837304..837960) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene folE CDS 838122..839360 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 gene moeA CDS 839391..840173 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262175.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene moeB CDS 840232..841062 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene sseA CDS complement(841069..842058) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463541.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 842428..843378 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066347.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene tal CDS 843487..845484 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 gene tkt CDS complement(845591..846025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(846362..846559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 846464..846940 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461979.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(847098..849749) product carbohydrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031383.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS 850256..851905 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113692.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(851840..852460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(852679..853299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(853633..855738) product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene pbpC CDS complement(855788..860476) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098285.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(860678..862498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(862890..864206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(864790..866523) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132206.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 866776..868431 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549956.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(868618..869523) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270755.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 869729..870628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(870702..871271) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477055.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(871268..871807) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477057.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 872158..872787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454376.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 873173..874537 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706779.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(874630..875553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(876009..877598) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000856.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(877595..878644) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811019.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(878649..879740) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(879748..881565) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001914695.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(881722..882414) product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200476.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 gene phnR CDS complement(882515..883195) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374109.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 gene yjjG CDS 883325..884242 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 884381..885043 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(885140..886438) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065016884.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 887114..887896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(888101..889084) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171125.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 gene cra CDS 889415..890551 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478424.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene fruB CDS 890563..891516 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163391.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 gene pfkB CDS 891534..893267 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684711.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene fruA CDS 893290..893505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(893638..894429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS complement(894442..895638) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460937.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(895922..896740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(897474..897944) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106209.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene nrdG CDS complement(897984..900104) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802773.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene nrdD CDS complement(900516..903704) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(903706..904710) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(904773..905222) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057552266.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(905234..905650) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658156.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS complement(905731..906096) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114934.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 906221..906409 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 906524..908227 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(908346..909236) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS complement(909289..909906) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619460.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS complement(909907..910701) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(910701..911732) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887084.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene cobT CDS complement(911928..912479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 913407..914468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS 914731..915345 product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019923.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(915443..916774) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene efeB CDS complement(916776..917657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(917768..918592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(918684..919502) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497947.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(919714..922245) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489189.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(922238..923008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 923871..924779 product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974231.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(925065..925259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(925363..925716) product DUF3024 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636799.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 926002..926838 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620565.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(926888..928300) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene clcA CDS 928763..929755 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(929874..930818) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene ylqF CDS complement(931124..932914) product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477137.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene phaC CDS complement(932977..933324) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005398278.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(933366..934574) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(934595..935335) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477336.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(935779..936435) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477076.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 936838..938052 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154339.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene glgC CDS 938330..938785 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(938793..940859) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001917927.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 gene helD CDS 941173..943299 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882559.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene yccS CDS 943514..943732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS 943816..944112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 944450..944974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914961.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(945121..947721) product LuxQ periplasmic sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026306.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS complement(947737..948825) product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(949071..949361) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429067.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(949392..950045) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(950120..950350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS 950648..950965 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089529.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS 951320..952108 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480237.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 tRNA complement(952146..952219) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(952255..952341) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 CDS complement(952573..953484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(953753..954562) product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(955056..956501) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106399.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene viaA CDS complement(956514..958175) product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941295.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 958585..959106 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034744.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS 959301..960047 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570597.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS complement(960128..961570) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175437.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS 962109..963785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS complement(964247..966715) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645916.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS complement(966712..967395) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS 967394..967996 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197502.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene tesA CDS 968143..969339 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547707.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(969477..970787) product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261835.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 971145..973259 product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene ovoA CDS 973313..975106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 975343..975837 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354621.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 975830..976717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 976717..977016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS 977230..977682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(977819..978718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 979134..979358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(979417..980811) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene xylE CDS 981109..982428 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene xylA CDS complement(982552..983619) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 983850..984434 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483453.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 984647..985423 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(985420..985758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 985995..986831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 987187..988080 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464903.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 988282..988647 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464927.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(988695..988928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 989037..989777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(989937..990875) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 990989..991471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 991475..992776 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 992844..993878 product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene dctP CDS 993930..995042 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS 995011..995310 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402017.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 995325..996800 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 996757..997116 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974541.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 997318..997584 product YrhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398584.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 997988..998236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS complement(998413..998784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS complement(998781..999326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 999309..999458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS 999483..999782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(999794..1000102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(1000110..1004993) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156019039.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(1005210..1005668) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706216.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(1005698..1006672) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 1006978..1007739 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 1007866..1008771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 1009121..1010722 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(1010971..1011732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(1011952..1012830) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(1012827..1013732) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(1013753..1014457) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277843.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 1015291..1016892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 1017094..1019208 product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477345.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS 1019231..1019722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 1019934..1020317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 1020421..1021212 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482900.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(1021561..1021881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(1021985..1022194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(1022287..1022595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(1022707..1022955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589868.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(1023126..1023779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(1023766..1024404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(1024524..1024982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(1025154..1025987) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870701.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(1025995..1026678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(1026678..1027577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(1027784..1029328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 note possible pseudo, frameshifted CDS complement(1029328..1029783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43320 note possible pseudo, frameshifted CDS complement(1029989..1030861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(1030864..1031919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS complement(1031925..1033991) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(1034183..1034701) product type VI secretion system effector Hcp-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142947.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene hcp-2 CDS complement(1035090..1038767) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(1038791..1040020) product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(1040246..1041163) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(1041322..1042464) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(1042497..1043768) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 1044314..1045285 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(1045574..1046614) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(1046749..1047357) product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(1048101..1048280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(1048249..1050411) product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(1050460..1051416) product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene arsS CDS 1051988..1052848 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(1052993..1055047) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074135.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS complement(1055228..1056076) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379797.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(1056092..1059406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(1059659..1061722) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279435.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS complement(1062221..1063306) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447980.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(1063285..1064322) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880579.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS complement(1064342..1065295) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711620.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene fepB CDS 1065673..1067034 product norspermidine-2,3-dihydroxybenzoate synthase VibH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880577.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene vibH CDS complement(1067087..1067851) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS complement(1068100..1068999) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038078.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS 1069148..1069765 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 1070090..1070920 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene thiD CDS 1071771..1074431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 1074846..1076642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(1076720..1077319) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(1077359..1077577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 1077571..1078197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(1078370..1078942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS complement(1079215..1081032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(1081133..1083724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(1083910..1084344) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461900.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(1084394..1085269) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(1085395..1086171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(1086209..1086676) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(1087041..1095176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(1095973..1096386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(1096463..1097332) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 1097437..1097754 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296337.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 1097772..1098260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(1098596..1098985) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 1099306..1099554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 1099574..1099837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(1099928..1100155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(1100198..1100488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(1100492..1105288) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156019039.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS complement(1105285..1106250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(1106247..1106816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 1107171..1107419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(1107654..1108136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 1108267..1108515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(1108744..1109217) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213869.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(1109304..1109804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(1109806..1110168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033414.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS complement(1110356..1110793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(1110806..1113277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(1113511..1113957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(1113962..1118833) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156019039.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS complement(1118830..1119795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(1119792..1120838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(1121173..1126248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS 1127349..1128305 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 1128667..1129467 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482307.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 1129771..1130679 product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974231.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(1130758..1131312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(1131488..1131703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(1131755..1132798) product IS630-like element ISEc33 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046092923.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS complement(1133019..1133759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 note possible pseudo, frameshifted CDS complement(1133756..1134142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 note possible pseudo, frameshifted CDS complement(1134576..1135127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(1135130..1137943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 1138108..1138986 product nucleotidyltransferase and HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974231.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(1139095..1139550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(1139627..1140421) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923261.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 1140491..1140898 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(1141067..1142764) product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS complement(1142822..1151071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(1151064..1164032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(1164053..1176943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 1178412..1180277 product toxin-coregulated pilus methyl-accepting chemotaxis protein TcpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261766.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 gene tcpI CDS complement(1180446..1180946) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(1181204..1181785) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929768.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(1181979..1182509) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417389.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 1182723..1184204 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 1184391..1184687 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581563.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(1184799..1185782) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073755.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS 1185898..1186845 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105599.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 1187043..1188491 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147723.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 gene nhaD CDS 1188636..1189280 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261691.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(1189361..1190602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(1190932..1191273) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605630.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(1191273..1191986) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(1192082..1192759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS 1193114..1194742 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS 1194893..1195399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 1195389..1195976 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816099.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(1196006..1196563) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463834.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 1197499..1197693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS 1198053..1198346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS 1198775..1200445 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059787.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(1200524..1201360) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(1201435..1202268) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464081.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 1202478..1204850 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479906.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 gene ppsA CDS complement(1204912..1205970) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 gene rsgA CDS 1206337..1206990 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225569.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(1207085..1207498) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene arfB CDS complement(1207614..1208825) product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899557.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(1208976..1209509) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020835216.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(1209586..1210344) product zinc-binding phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283673.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 gene ycdX CDS complement(1210712..1211230) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963691.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 1211864..1212640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 1212637..1215420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS complement(1215468..1217138) product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367870.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 gene hscC CDS 1217646..1218674 product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(1219245..1219691) product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859143.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(1219595..1220560) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664563.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 1221263..1223149 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 1223183..1224406 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 1224539..1225084 product MltR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818298.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(1225220..1225987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 1226321..1227001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(1227116..1228102) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817416.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS complement(1228185..1229492) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020883745.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 1229737..1230036 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174964.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 1230065..1231390 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366646.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS 1231436..1232815 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094820.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 1232831..1233148 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705380.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 1233452..1234081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(1234190..1235206) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 gene galE CDS 1235506..1236201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(1236523..1236879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261145.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS complement(1236930..1238033) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261146.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS complement(1238027..1239241) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(1239238..1240239) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261148.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS complement(1240205..1241614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417444.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(1241614..1242831) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261149.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(1242828..1244954) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261150.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(1244956..1245507) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261151.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS complement(1245520..1246773) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704488.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS complement(1246793..1248199) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261153.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 1248828..1250432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(1250494..1250772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 1251454..1253619 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267883.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(1253817..1254296) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462739.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(1254347..1254775) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081002.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(1255241..1255798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(1255948..1256670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(1256790..1261364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS complement(1261513..1262328) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(1262378..1263280) product vibriobactin biosynthesis bifunctional isochorismatase/aryl carrier protein VibB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997093.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 gene vibB CDS 1263721..1265091 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262007.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 1265270..1266658 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS complement(1266782..1267468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(1268208..1268450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 1268747..1269133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480056.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS complement(1269237..1269884) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 1270048..1270959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(1270943..1271587) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS 1272068..1273309 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455065.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(1273316..1274230) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(1274371..1275867) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010435770.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(1275867..1277096) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(1277942..1278376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS 1279086..1281137 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625994.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS complement(1281164..1289134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(1289653..1289814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 1290123..1290749 product phage repressor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102872.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(1290854..1292215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(1292611..1293330) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637371.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 1293657..1294964 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069589.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene pncB CDS complement(1295048..1295797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(1295826..1299395) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 gene tssM CDS complement(1299414..1300841) product TssA family type VI secretion system protein VasJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426093.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene vasJ CDS complement(1300850..1301530) product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033927781.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 gene vasI CDS complement(1301527..1303062) product sigma-54 dependent T6SS transcriptional regulator VasH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084793.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 gene vasH CDS complement(1303064..1305700) product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619136.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 gene tssH CDS complement(1305717..1306490) product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083409.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 gene icmH CDS complement(1306493..1307827) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458007.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 gene tssK CDS complement(1307833..1308324) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045311.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 gene tssJ CDS complement(1308327..1309838) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089704.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 gene tagH CDS complement(1309842..1310849) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 gene tssG CDS complement(1310813..1312585) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 gene tssF CDS complement(1312589..1313026) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221000.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 gene tssE CDS complement(1313026..1314498) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108140.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 gene tssC CDS complement(1314565..1315089) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031391.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 gene tssB CDS complement(1315345..1316613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS complement(1316606..1316890) product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526403.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS 1317862..1319871 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 1319980..1320993 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711460.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 1321251..1322261 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968342.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS complement(1322274..1323041) product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 gene fecE CDS complement(1323045..1324028) product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684856.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 gene fecD CDS complement(1324025..1325023) product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125178.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 gene fecC CDS complement(1325020..1325928) product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 gene fecB CDS complement(1326036..1328030) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(1328382..1328771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099817.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(1329700..1331013) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 gene putP CDS complement(1331254..1331952) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233685.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(1331970..1335095) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493426.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene putA CDS complement(1335457..1336254) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741188.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS 1336763..1337869 product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596058.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 1338029..1339870 product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882860.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(1339972..1340652) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 gene pdxH CDS 1340808..1341032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(1341123..1342817) product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265356.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS complement(1343127..1344920) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162813643.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(1345355..1346329) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985780.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(1346336..1347553) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817997.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 sequence3 source 1..85780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..780 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311061.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS 777..1949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 repeat_region 2082..2457 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcctaacggcctgtttcggccagtgtcttccgac repeat_region 3080..3319 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcctaacggcctgtctcggccagcgtcttccgac CDS complement(4533..5090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS 5846..5983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS 5976..6209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS 6324..7994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS complement(8472..9266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS 10035..10637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(10729..11340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(11545..11943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(11988..12392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(12385..13119) product StbB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264012.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 gene stbB CDS complement(13127..13606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS 13863..14237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 14231..17059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 17341..17643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(17961..19289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263396.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS complement(19309..21186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(21176..22516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(22519..24297) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480512.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(24300..25793) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(25866..28325) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS 29037..29912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS complement(29994..30833) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 gene menH CDS 31478..31666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS 31965..32357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 32413..32727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS 32730..33101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 33061..35385 product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263998.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS 35382..36053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS 36071..36322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 36442..37287 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042069.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(37338..38087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS 38243..38398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS 38395..39156 product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252745.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 39153..39941 product TrbG/VirB9 family P-type conjugative transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162050504.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS 39934..41160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS 41316..42374 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967686.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 gene virB11 CDS 42371..44155 product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108653168.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 44179..44730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082960809.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 44879..45232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS complement(45235..45885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 46122..46604 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263965.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 gene radC CDS 46664..47014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS 47108..47347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS complement(47756..48355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(48399..48740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(48807..49412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS complement(49601..50212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS complement(50252..50995) product type VI secretion system immunity protein TsiV2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904079.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 gene tsiV2 CDS complement(51013..54294) product type VI secretion system toxin VasX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070352.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 gene vasX CDS complement(54291..55157) product type VI secretion system accessory protein VasW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257973.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 gene vasW CDS complement(55157..57316) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 58089..58307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 58413..59675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 59795..60052 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS 60052..60330 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(60443..60628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(60984..61817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS 62285..62935 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074400.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS complement(63409..64371) product type III-B CRISPR module RAMP protein Cmr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880199.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 gene cmr6 CDS complement(64364..64843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS complement(64840..65715) product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 gene cmr4 CDS complement(65732..67006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS complement(67003..69318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS complement(69305..70840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS complement(70842..72656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS complement(72658..72975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS 73074..76085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS 76070..76363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46150 repeat_region 76371..76611 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcctaacggcctgtttcggccagtgtcttccgac CDS complement(77021..77335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS complement(77420..77632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(77870..78139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(78410..79855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(79858..81390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS complement(81403..82512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS complement(82509..85235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46220