COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2528163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 28..1401 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1417..2517 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2517..3611 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 3814..6231 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene gyrB CDS 6365..7243 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 7465..7902 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7948..9204) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(9326..11392) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene glyS CDS complement(11395..12318) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458688.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene glyQ CDS complement(12496..13980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(14189..14437) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005426051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene tusA CDS 14700..15641 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(15684..16667) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(16880..18043) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene fadA CDS complement(18063..20234) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene fadB CDS 20428..21045 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 21052..22509 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 22532..23062 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene hemG rRNA 23572..25115 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 25223..25300 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 25389..25464 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA 25806..28703 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 28842..28952 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 29046..29122 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 29200..29276 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 29216..29995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(30273..31451) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(31451..32587) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(32589..33320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(33324..34259) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene hemC CDS 34591..37116 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(37113..37427) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene cyaY CDS 37649..38902 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene lysA CDS 38912..39742 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene dapF CDS 39752..40465 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084657.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 40446..41366 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene xerC CDS 41367..42083 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene yigB CDS complement(42075..42641) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(42652..43653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(43687..44514) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(44650..45627) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 45700..46170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 46209..47216 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 47284..47781 product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 47863..49086 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene arsJ CDS 49205..50218 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(50215..50556) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 50886..51251 product DUF4145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 51346..51576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 52129..53868 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 53924..55483 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 55646..56623 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 56626..57564 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 57843..58703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 58870..59217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(59383..60738) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene gorA CDS complement(60785..61621) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 61729..63771 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene prlC CDS complement(63807..64268) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene asnC CDS 64385..65179 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 65242..65772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(65813..66235) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene uspA CDS 66439..66966 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene ftnA CDS 67043..67366 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene uspB CDS 67473..68660 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(68752..69078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 69567..70397 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 70763..72025 product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(72028..72906) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 73098..73877 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456853.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene ubiE CDS 73889..74494 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 74491..76125 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene ubiB CDS 76156..76404 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene tatA CDS 76408..76779 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene tatB CDS 76835..77584 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene tatC CDS complement(77614..78375) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 78509..79522 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene hemB CDS 79973..82756 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene polA CDS complement(83109..83753) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene yihA CDS complement(83941..84090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 84089..84580 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 85106..85756 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 85743..86300 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene yihI CDS 86307..86795 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 86914..88287 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene hemN CDS complement(88341..89753) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene glnG CDS complement(89777..90832) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene glnL CDS complement(91089..92498) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene glnA CDS 92996..94825 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene typA CDS 94970..95896 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 95868..96302 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene dtd CDS 96335..97258 product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(97262..99163) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(99276..100904) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene pckA CDS complement(101225..102094) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene hslO CDS complement(102109..102495) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene hslR CDS 102773..103678 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene gspC CDS 103763..105793 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene gspD CDS 105793..107301 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene gspE CDS 107301..108518 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene gspF CDS 108538..108981 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene gspG CDS 109085..109615 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene gspH CDS 109620..109958 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene gspI CDS 109945..110586 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene gspJ CDS 110588..111598 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene gspK CDS 111567..112817 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene gspL CDS 112817..113317 product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 113319..114089 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 114274..114828 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene nudE CDS 114830..115657 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene cysQ CDS complement(115599..116417) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene bioH CDS 116980..117210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 117312..117902 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene nfuA CDS complement(117955..119361) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459014.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene envZ CDS complement(119371..120090) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene ompR CDS complement(120308..120808) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene greB CDS complement(120874..122775) product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 122984..125299 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(125350..127428) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene recG CDS 127750..127986 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene rpmB CDS 128000..128167 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene rpmG CDS 128266..129087 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene mutM CDS 129084..130088 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(130112..130588) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene coaD CDS complement(130589..131707) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(131711..132484) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(132477..133529) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 133622..134332 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(134322..135008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 135764..136513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(136519..137214) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902370.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(137264..138340) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(138337..139539) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(139532..140566) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene waaF CDS complement(140566..141444) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene lpxM CDS complement(141557..142498) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rfaD CDS 142645..143784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 143789..144955 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(145014..146345) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene hslU CDS complement(146360..146884) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene hslV CDS complement(147009..147551) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene ftsN CDS complement(147616..148620) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene cytR CDS complement(148808..151009) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene priA CDS 151252..151470 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene rpmE CDS 151640..152905 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(152955..153272) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005432736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene metJ CDS 153454..154623 product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 154620..157025 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 157186..158076 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene metF CDS complement(158138..158668) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(159035..161665) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene ppc CDS complement(161829..162992) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene argE CDS 163120..164139 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene argC CDS 164163..164945 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene argB CDS 165006..166214 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 166257..168131 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene argH CDS complement(168242..168970) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 169091..169984 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene oxyR CDS complement(170021..172705) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 172877..173659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 173659..174210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 174188..174751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 174741..175829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 176045..176563 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene aroK CDS 176585..177694 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene aroB CDS 177736..179154 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 179221..180045 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 180134..180808 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rpe CDS 180801..181487 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 181586..182611 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene trpS CDS 182694..183278 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262695.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 183505..184716 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 184740..185759 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000962042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene astA CDS 185782..187248 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene astD CDS 187264..188055 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(188129..188761) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene crp CDS complement(188976..189845) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(189868..190089) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(190103..191086) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(191076..191546) product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(191552..193471) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 193600..194205 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene kefG CDS 194192..195988 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene kefB CDS 195990..196184 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 196249..196785 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene slyD CDS 196854..197795 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(197811..198053) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 198327..199121 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene fkpA CDS 199342..200052 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 200056..200448 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene tusD CDS 200445..200801 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene tusC CDS 200802..201074 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene tusB CDS 201242..201616 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rpsL CDS 201714..202184 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene rpsG CDS 202323..204416 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene fusA CDS 204563..205747 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene tuf CDS 206209..206520 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene rpsJ CDS 206535..207164 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rplC CDS 207181..207783 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rplD CDS 207780..208082 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene rplW CDS 208099..208923 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene rplB CDS 208944..209222 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene rpsS CDS 209233..209565 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene rplV CDS 209585..210283 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rpsC CDS 210295..210705 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene rplP CDS 210705..210896 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rpmC CDS 210896..211150 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene rpsQ CDS 211315..211686 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rplN CDS 211698..212015 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene rplX CDS 212041..212580 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rplE CDS 212598..212903 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene rpsN CDS 212933..213325 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene rpsH CDS 213336..213869 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene rplF CDS 213879..214232 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435088.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rplR CDS 214247..214747 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene rpsE CDS 214751..214927 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene rpmD CDS 214933..215367 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene rplO CDS 215388..216722 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene secY CDS 217021..217377 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene rpsM CDS 217396..217785 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene rpsK CDS 217817..218437 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene rpsD CDS 218461..219453 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rpoA CDS 219480..219860 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rplQ CDS complement(220033..220521) product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(220637..221905) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(222060..222680) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 222926..223531 product LysM-like peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(223532..223990) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 224088..224927 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene cobA CDS complement(224946..225443) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(225454..226713) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(226713..227420) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(227482..228138) product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(228249..228803) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(228856..229494) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884809.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene msrA CDS 229719..231350 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 231350..235174 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 235195..235539 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 235577..236089 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(236120..237136) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene fbp CDS 237450..238775 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene mpl CDS 238781..239407 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 239661..242567 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene rapA CDS 242583..243317 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene rluA CDS 243423..244379 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(244409..244846) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(244922..247495) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(247697..248665) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(249073..249543) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005430583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene argR CDS 249822..250757 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene mdh CDS 250874..251062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(251108..252079) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene ispB CDS 252348..252659 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene rplU CDS 252679..252936 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene rpmA CDS 253138..254316 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene cgtA CDS 254419..255486 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 255607..256323 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 256320..256796 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 256808..257293 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459612.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene folA CDS complement(257301..258113) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480531.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene apaH CDS complement(258126..258506) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene apaG CDS complement(258529..259335) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene rsmA CDS complement(259332..260315) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene pdxA CDS complement(260308..261624) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene surA CDS complement(261669..264146) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene lptD CDS 264296..265138 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene djlA CDS complement(265243..266022) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(266097..266699) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene leuD CDS complement(266709..268112) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene leuC CDS complement(268123..269214) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene leuB CDS complement(269271..270821) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene leuA CDS 271277..272584 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 272581..275688 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 275862..276413 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 276415..277473 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 277810..278790 product LysR family transcriptional regulator CalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene calR CDS 279021..280862 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 281208..282929 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 282931..283425 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene ilvN CDS complement(283809..285221) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene pykF CDS 285676..286647 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 286801..287721 product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(287750..289102) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 289372..290232 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene focA CDS 290425..291324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 291381..291722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 291707..292414 product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene bfmR CDS 292429..293733 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144045444.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 tRNA complement(292732..292827) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(293786..294241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(294257..295036) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464165.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 tRNA complement(295290..295365) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(295517..297358) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene rpoD CDS complement(297458..299224) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene dnaG CDS complement(299311..299754) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(299780..299995) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rpsU CDS 300218..301237 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene tsaD CDS complement(301284..301889) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene plsY CDS 302021..302386 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene folB CDS 302383..302877 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene folK CDS 302890..303693 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(303716..304960) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114766199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 305112..306740 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 306740..307567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(307659..308267) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(308464..309726) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479165.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(309768..310445) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 310712..312229 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 312312..315140 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene glnE CDS 315223..316650 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene hldE CDS complement(316730..318052) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene tolC CDS 318269..318898 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene nudF CDS 318886..319323 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 319460..320182 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868845.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene cpdA CDS 320263..320850 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene yqiA CDS 321096..322976 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457157.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene parE CDS 322979..325222 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene parC CDS complement(325362..326444) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene degS CDS complement(326547..327917) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(328075..328512) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene zapG CDS 328632..329741 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187998.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene zapE CDS 329963..330391 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene rplM CDS 330407..330799 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rpsI CDS 331092..331697 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene petA CDS 331697..332959 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 332959..333696 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 333780..334415 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene sspA CDS 334415..334897 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene sspB CDS complement(334951..335766) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(335788..336375) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(336378..336746) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(336730..338556) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 338688..339482 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rsmI CDS 340124..341074 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rsmH CDS 341071..341568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 341565..343340 product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 343343..344830 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene murE CDS 344827..346188 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene murF CDS 346185..347267 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene mraY CDS 347271..348596 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151655400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene murD CDS 348609..349925 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene ftsW CDS 349912..350973 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene murG CDS 350988..352448 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene murC CDS 352573..353340 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 353350..354615 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene ftsA CDS 354644..355852 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene ftsZ CDS 355943..356860 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene lpxC CDS complement(356923..357375) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 357636..360359 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene secA CDS 360436..360840 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene mutT CDS 361041..361850 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene dapB CDS 362304..363461 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene carA CDS 363478..366708 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene carB CDS 366944..367726 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(367674..368522) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923496.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(368606..369223) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(369220..369912) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene mtnN CDS complement(370076..370438) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(370736..372205) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(372208..376749) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene gltB CDS 377259..378206 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 378294..380672 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene arcB CDS 380719..381177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(381246..381962) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene arcA CDS complement(382395..382883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 383274..385733 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene thrA CDS 385736..386698 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene thrB CDS 386695..387978 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene thrC CDS complement(388134..388511) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene grcA CDS 388833..389693 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene nfo CDS 389940..390611 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene ung CDS 390706..391245 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(391315..391503) product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 391965..393404 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 393540..394313 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene yaaA CDS 394300..394872 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(394947..396167) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene srmB CDS complement(396214..396921) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(396937..397455) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene fldB CDS 397580..398473 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene xerD CDS 398497..399243 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487646.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene dsbC CDS 399310..401049 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene recJ CDS 401415..402251 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene prfB note possible pseudo, frameshifted CDS 402291..403808 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene lysS CDS complement(403856..404299) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598452.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 404532..405584 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene queA CDS 405778..406914 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene tgt CDS 407053..407388 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene yajC CDS 407411..409264 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene secD CDS 409279..410226 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene secF CDS 410304..410735 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene fkpB CDS 410804..411754 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene ispH CDS complement(411843..413330) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 413547..413894 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(413981..415507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(415773..416672) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene murQ CDS complement(416681..417790) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 417912..418898 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene nagZ CDS complement(418914..419648) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene btsR CDS complement(419645..421315) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 421539..422609 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 422625..423755 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene tyrA CDS complement(423812..425479) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene ettA CDS 425714..427636 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene sltY CDS 427670..427957 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene trpR CDS complement(427994..428512) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene yjjX CDS complement(428513..429691) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene pheA CDS complement(429815..430150) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene raiA CDS complement(430409..431854) product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(431945..432688) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 432810..433784 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rluD CDS 433784..434509 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene pgeF CDS 434611..437193 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene clpB rRNA 437737..439285 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 439414..439489 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 439492..439567 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 439605..439680 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 439716..439791 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 rRNA 440228..443114 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 443254..443364 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA 443458..443534 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(444484..445164) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(445274..446140) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(446143..446595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(446669..446923) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(446927..448285) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene yegQ CDS complement(448416..449324) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene rdgC CDS 449510..450199 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene phoB CDS 450235..451545 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene phoR CDS 451545..452495 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 452591..454771 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 454781..456457 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene pstA CDS 456447..457265 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene pstB CDS 457281..457979 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene phoU CDS complement(457972..458718) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(458797..459405) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 459603..460520 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 460609..460920 product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(460927..461604) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mutH CDS 462207..462725 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene rppH CDS 462731..464983 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene ptsP CDS 464983..465774 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 465796..466620 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene lgt CDS 466621..467472 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 467554..468546 product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(468595..469743) product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 470084..470974 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene nhaR CDS complement(471029..471289) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene rpsT CDS 471666..473225 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261243.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene murJ CDS 473369..474247 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ribF CDS 474304..477144 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene ileS CDS 477146..477646 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene lspA CDS 477755..478144 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene secG tRNA 478160..478243 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 478293..478369 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 478658..479113 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene rimP CDS 479137..480624 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene nusA CDS 480644..483355 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene infB CDS 483428..483859 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene rbfA CDS 483859..484806 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene truB CDS 484951..485220 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rpsO CDS 485516..487642 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene pnp CDS 487752..488633 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene nlpI CDS complement(488672..489544) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(489559..490584) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456088.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 490743..491273 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 491263..491766 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 491775..492179 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456107.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 492172..492618 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene rimI CDS 492816..494477 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene hcp CDS 494553..495527 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 495667..497256 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene prfC CDS 497328..498161 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(498158..498853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(498938..501340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 501633..502412 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 502601..503857 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 504052..504222 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 504424..505197 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456105.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene deoC CDS 505348..506685 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene deoA CDS 506696..507916 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 507946..508662 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene deoD CDS complement(508717..509283) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481596.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 509389..510285 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene serB CDS 510292..511671 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene radA CDS 511827..513911 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene fusA CDS 514218..515294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(515243..516952) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(517030..517719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 517871..518053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 518178..518351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 518584..519084 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 519100..520443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 520440..521171 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene cpaB CDS 521338..522648 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 522660..522899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 523056..524273 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 524287..525723 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 525738..526703 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 526706..527650 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 527666..528694 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 529137..529826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 note possible pseudo, frameshifted CDS 529823..530443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 note possible pseudo, frameshifted CDS complement(530574..531605) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456577.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene dapD CDS complement(531782..532423) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(532491..532793) product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(532845..533777) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 533884..534849 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 534925..538329 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene recC CDS 538554..542114 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene recB CDS 542115..544220 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene recD CDS complement(544203..545438) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene argA CDS 545693..546790 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene mltA CDS 546854..547660 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene tcdA CDS 547664..548101 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene csdE CDS complement(548172..549371) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095477927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene csdA CDS complement(549364..549969) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(549959..550846) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene panE CDS complement(550966..551775) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 552078..552650 product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 552673..554010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 554116..554649 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 554646..555317 product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(555383..556753) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(556819..557364) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(557361..557936) product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(557968..559107) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456632.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 559352..559651 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 559942..561288 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 561292..562533 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 562523..563290 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 563290..563922 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 563930..564526 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene nqrE CDS 564550..565773 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene nqrF CDS 565855..566886 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 566899..567132 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene nqrM CDS complement(567197..568441) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105062851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 568568..569665 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene dinB CDS 569754..570464 product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(570560..570751) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(570754..570957) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(571010..572725) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(572810..573508) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene tsaA CDS 573859..575448 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 575793..577295 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(577388..578197) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(578217..578900) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(578884..579918) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene metN CDS 580097..580651 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene gmhB CDS complement(580731..581333) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 581643..582893 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(582943..583482) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(583524..583823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 583911..585104 product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(585373..586320) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene lipA CDS complement(586331..586996) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene lipB CDS complement(587152..587421) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene ybeD CDS complement(587590..588768) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(588889..589668) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(589668..590789) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rodA CDS complement(590786..592681) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493014.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene mrdA CDS complement(592688..593158) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rlmH CDS complement(593162..593479) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rsfS CDS complement(593540..594574) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene holA CDS complement(594577..595314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(595424..597997) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene leuS CDS 598125..598595 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(598724..599983) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene lnt CDS complement(600270..601166) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene corC CDS complement(601223..601687) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene ybeY CDS complement(601688..602794) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(602949..604334) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene miaB CDS 604592..605749 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(605808..606836) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 tRNA complement(607002..607086) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(607139..607215) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(607229..607313) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(607395..607469) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(607504..607588) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(607670..607744) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(607779..607863) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(607945..608019) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(608054..608138) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(608220..608294) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(608329..608413) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(608466..608542) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(608623..608697) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(608732..608816) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(608870..608946) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(609368..610459) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418193.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene ychF CDS complement(610470..611060) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene pth CDS complement(611182..612126) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(612153..613022) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ispE CDS complement(613012..613647) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene lolB CDS 613778..615034 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene hemA CDS 615050..616138 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418202.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene prfA CDS 616138..616995 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene prmC CDS 616997..617380 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 617384..618193 product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 618218..619069 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene kdsA CDS 619189..620838 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809002.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene ushA CDS 620849..621325 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene ybaK CDS complement(621379..622350) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162891890.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene rluF CDS complement(622361..622945) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene smrA tRNA 623312..623388 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(623522..623944) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(623998..624459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 624667..627318 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 628333..629454 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene chiP CDS 629519..630142 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 630246..630617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(630755..631666) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 631827..633254 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene gltX CDS 633417..635099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 635156..638743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 638764..639804 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(639780..641201) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 641684..642985 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene tig CDS 643092..643715 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene clpP CDS 643782..645059 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460618.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene clpX CDS 645340..647688 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene lon CDS 647886..648158 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 648342..650198 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene ppiD CDS 650327..650638 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021449594.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(650635..651174) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rrtA CDS 651275..651802 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(651799..653133) product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(653134..653721) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene yfbR CDS complement(653766..654980) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 655231..656535 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 656532..658244 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene menD CDS 658246..658680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 note possible pseudo, internal stop codon CDS 658792..659019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 659031..660026 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene menC CDS 660019..661416 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene menE CDS 661509..661703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(661698..662618) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 662865..663740 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(663897..666029) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene pta CDS complement(666125..667321) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 667636..668088 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene yfbV CDS 668405..669370 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 669475..670392 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 670389..671183 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 671736..672995 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene tnpB CDS 673002..674144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(674251..675210) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene dusC CDS 675356..675955 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(676017..676535) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene dsbB CDS complement(676699..678294) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene nhaB CDS 678845..679684 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene fadR CDS 679939..680220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 680362..681720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 682156..682821 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 682824..683666 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 683686..684561 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 684570..685220 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 685226..686173 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(686227..686709) product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(686919..690020) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(690071..691486) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(691483..692157) product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene imuA CDS complement(692225..694558) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(694563..695489) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(695548..696951) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 697587..698261 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(698272..698436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(698590..699798) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(700038..700361) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 701152..702195 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 702271..702888 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 703182..707384 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene fdhF CDS complement(707452..708153) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(708280..709074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 709895..711493 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(711605..714676) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(714737..715900) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 716113..716664 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene sigZ CDS 717000..718724 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 718717..720573 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 720601..722082 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(722163..723377) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene gltS CDS complement(723892..725223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(725226..725762) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(726135..726917) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene kdgR CDS 727177..727938 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene kduD CDS 728015..728650 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 728902..730323 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene uxaC CDS 730336..732342 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(732459..732869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(732914..733165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(733950..735458) product DUF3360 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(736170..736322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 736459..737496 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(737808..738275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(738238..739251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(739286..740335) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705155.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 741087..742124 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 742446..743042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(743602..745929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 746512..751224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 751407..751706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 751703..752047 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene tnpB CDS 752111..753664 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 753936..755414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 755828..757891 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(758491..759663) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001895735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(759653..760441) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene ugpE CDS complement(760510..761391) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(761464..762756) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045558.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(764686..766041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 767278..768270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 768267..769748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479534.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(769755..770987) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 tRNA complement(771072..771162) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(771341..773137) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(773162..773377) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123168.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 773462..774463 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene yejK CDS 774648..775763 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene asd CDS complement(775822..776706) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(776844..777491) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 778058..780760 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene adhE CDS complement(780866..781543) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(781748..782332) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene sodB CDS 782654..782986 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418555.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(783074..784399) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(784424..785074) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene rnt CDS complement(785197..785613) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene gloA CDS complement(785719..785928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(786094..786453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 786883..788313 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(788452..789315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 789588..791216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 791337..791849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 792103..792612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(792693..793328) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene nth CDS complement(793351..794088) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(794088..794717) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene rsxG CDS complement(794718..795767) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rsxD CDS complement(795767..798253) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rsxC CDS complement(798259..798840) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rsxB CDS complement(798840..799421) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rsxA CDS 799877..800971 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 tRNA complement(801750..801825) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 802313..804358 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene uvrB CDS 804371..805768 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001888250.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 805761..806090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(806082..806969) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 807323..808255 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene moaA CDS 808329..808841 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene moaB CDS 808848..809327 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene moaC CDS 809324..809569 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461535.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene moaD CDS 809572..810024 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene moaE CDS 810537..812168 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 812292..813212 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene oppB CDS 813228..814130 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene oppC CDS 814151..815119 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482402.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 815121..816122 product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene oppF tRNA complement(817170..817254) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(817310..817394) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 818029..818979 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 818979..822092 product vibriobactin export RND transporter permease subunit VexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262151.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene vexH CDS complement(822124..822606) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(822608..823390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(823393..823950) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 824097..824411 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(824468..825532) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 825577..826122 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262148.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(826172..827605) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene putP CDS complement(827819..828676) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene tesB CDS 828841..829335 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(829410..829712) product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481834.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 829772..830506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(830933..832030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 831918..832457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(832629..832967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 833375..833668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 833665..834075 product type II toxin-antitoxin system mRNA interferase toxin YafO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene yafO CDS 834276..835634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 836128..836982 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 837153..837827 product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 837935..838867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(838994..840451) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 840661..840849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 840876..842117 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(842136..842813) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(844502..845065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(845190..846122) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(846299..846697) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene tsaA CDS complement(846711..847598) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 847704..848288 product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene kstR CDS complement(848324..849145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(849296..850534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(850667..851335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(851410..852783) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(852997..854007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 854451..855257 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 855414..855674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 855771..856769 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 857159..858451 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(859069..859692) product type B-5 chloramphenicol O-acetyltransferase CatB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene catB CDS complement(859785..860255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(860330..860800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(861239..862252) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 862518..863024 product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(863104..865401) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene pflB CDS 865648..866310 product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078927652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 866414..867139 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 867247..867465 product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(867528..868064) product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 868481..869575 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459939.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 869614..872061 product trimethylamine-N-oxide reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459941.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(872148..873347) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene manA CDS complement(873419..875314) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 875583..876431 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(876423..877205) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(877221..877523) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 877913..879307 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 879420..880172 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 880319..904054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 904185..906023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 906028..908169 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 908162..910159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 910188..910919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 911250..911891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 912095..913312 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 913440..913577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(913606..914976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(914987..915577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(915588..916106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(916377..918641) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene metE CDS 918828..919712 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481610.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene metR CDS complement(919814..920926) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(921213..922103) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 922307..923737 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(923874..924827) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(924957..926012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(926002..927123) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 927338..927754 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 927928..928698 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene udp CDS complement(928759..929925) product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 930077..930586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 930586..931986 product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930348.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 931986..932375 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 932385..932975 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene lpoB CDS 933190..933729 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene ycfP CDS 934024..935313 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(935546..936511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(936796..937587) product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(937663..941118) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene mfd CDS 941359..942621 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene lolC CDS 942614..943306 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene lolD CDS 943303..944547 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene lolE CDS complement(944614..945138) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 945504..947390 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 947423..949171 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene msbA CDS 949291..950175 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053055813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene lpxK CDS 950165..950344 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 950347..951102 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene kdsB CDS complement(951160..951819) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 951967..952533 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(952616..953695) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene hypD CDS complement(953721..953969) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene hypC CDS complement(953971..954633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(954597..954839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 954813..955007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(955004..955339) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene hypA CDS complement(955343..956266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(956266..958629) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene hypF CDS complement(958632..958874) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(958890..960623) product NiFe hydrogenase assembly chaperone HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(960656..961180) product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(961177..961881) product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene cybH CDS complement(961895..963598) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene hyaB CDS complement(963598..964743) product nickel-dependent hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene hyaA CDS complement(964943..965959) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene hypE CDS complement(966109..966612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(966813..968339) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(968350..969621) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481863.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(969729..971663) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 971842..972609 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(972687..973187) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(973258..973992) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene pflA CDS 974264..975643 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene dbpA CDS complement(975697..976698) product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(976821..979097) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene pflB CDS complement(979411..980946) product DUF3360 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 981528..982298 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 982362..983135 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 983282..984022 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 984025..984708 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(984771..985577) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene xthA CDS complement(985655..985828) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene rsmS CDS complement(985828..986376) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(986386..987165) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261640.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(987184..989277) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene dinG CDS 989761..990810 product porin OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene ompT CDS 991130..992578 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene glgA CDS 992749..993570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(993620..994990) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene purB CDS complement(995130..995747) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene hflD CDS complement(995767..996891) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene mnmA CDS 997059..997322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(997522..998049) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262308.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 998494..1000725 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 1000913..1001221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(1001273..1002697) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene arcD CDS 1003034..1003831 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(1003902..1004123) product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene cspD CDS 1004486..1004806 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene clpS CDS 1004865..1007129 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene clpA CDS complement(1007239..1007457) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene infA CDS complement(1007559..1008257) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(1008265..1008963) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene aat CDS 1008976..1009431 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478951.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 1009565..1010848 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene aroA CDS complement(1010930..1011694) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(1011923..1012174) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 1012443..1015070 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457230.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene topA CDS 1015245..1016546 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(1016611..1017027) product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 1017673..1019262 product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene tet(35) CDS 1019595..1020491 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene hisG CDS 1020495..1021787 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene hisD CDS 1021799..1022848 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene hisC CDS 1022873..1023946 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261648.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene hisB CDS 1023958..1024572 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene hisH CDS 1024572..1025309 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene hisA CDS 1025291..1026064 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene hisF CDS 1026061..1026708 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene hisIE CDS complement(1026770..1027264) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(1027313..1028059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(1028195..1028908) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene lpxH CDS complement(1028993..1029484) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 1029626..1031005 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene cysS CDS 1031080..1031658 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 1031919..1032302 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 1032552..1032833 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 1032946..1033296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1033409..1034359) product RIO1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1034461..1035426) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(1035430..1036935) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(1036968..1037723) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1037895..1038869) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene cmoB CDS 1039200..1040105 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1040215..1040583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1040619..1041410) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1041407..1042402) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(1042403..1043290) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene sapC CDS complement(1043277..1044239) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1044240..1045808) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene sapA CDS complement(1045969..1046955) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187701.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene pspF CDS 1047151..1047819 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene pspA CDS 1047828..1048058 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene pspB CDS 1048055..1048438 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene pspC CDS 1048639..1049673 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1049670..1050755 product efflux RND transporter periplasmic adaptor subunit VmeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478901.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene vmeH CDS 1050752..1053850 product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene vmeI CDS 1053850..1054443 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1054590..1055033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1055242..1056003 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1056150..1056527 product ribosome recycling factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1056607..1057368 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1057438..1058643) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1058711..1060165) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene cls CDS 1060388..1061059 product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1061065..1062006 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1062128..1063321 product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1063383..1063790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1063795..1064091) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1064094..1064495) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene yciA CDS complement(1064495..1065043) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1065190..1065807 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1065926..1066171 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1066227..1067261) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 1067474..1068367 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1068442..1069248) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene trpA CDS complement(1069248..1070438) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene trpB CDS complement(1070491..1071882) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene trpCF CDS complement(1071885..1072883) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene trpD CDS complement(1072899..1073495) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1073488..1075065) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1075563..1076330 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1076334..1076954 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1077058..1077957 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene rluB CDS 1078086..1078484 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1078521..1079219 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rsuA CDS 1079216..1079557 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1079607..1080293) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1080290..1080604) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 1080792..1081676 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1081730..1082050) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465080.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1082106..1084469) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1084894..1085538 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene uvrY CDS 1085598..1087364 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene uvrC CDS 1087441..1087992 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene pgsA tRNA 1088286..1088359 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 1088392..1088467 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 1088548..1088634 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 1088676..1088751 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1088832..1088918 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1088959..1089034 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1089083..1089156 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(1089202..1089990) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480237.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1090170..1091906) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene fruA CDS complement(1091964..1092911) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene pfkB CDS complement(1092921..1094051) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene fruB CDS 1094347..1095327 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene cra CDS 1095792..1098689 product pyridoxal phosphate-dependent class III aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1098700..1099947 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1100015..1101148 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene nspC CDS complement(1101188..1101703) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1101970..1103172 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1103234..1103497) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1103887..1105086 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1105101..1105946 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene yghU CDS complement(1106062..1106919) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1107162..1108811) product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene panP CDS complement(1109026..1109550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826868.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1109664..1110611) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1110824..1111441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1111500..1112603) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1112715..1113089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1113231..1113422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1113573..1114268) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1114441..1117467 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1117611..1118591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1118745..1118984) product DUF3622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1119162..1119554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1119773..1120480) product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1120789..1122717 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene thrS CDS 1122883..1123272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1123378..1123572 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419080.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene rpmI CDS 1123614..1123967 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rplT CDS complement(1124049..1124978) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1125025..1125507) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1125745..1126581 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1126619..1126864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1127222..1127692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1127980..1128978 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1129339..1130400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1130834..1131919) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1132323..1133306 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene pheS CDS 1133324..1135711 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene pheT CDS 1136187..1136486 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene ihfA CDS complement(1136549..1137724) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene purT CDS complement(1137857..1138747) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene cdd CDS complement(1138846..1139523) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1139520..1139885) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1139889..1141301) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene sbcB CDS complement(1141360..1143129) product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1143126..1143713) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene mobA CDS complement(1143691..1144407) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1144415..1145113) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1145156..1145974) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1146288..1147691 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1147682..1149652 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645087.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1149642..1150472) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1150696..1151142 product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1151171..1151665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1151919..1153580 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1153630..1154205 product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1154273..1154488 product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1154500..1157355 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 1157368..1157976 product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene fdh3B CDS 1157991..1159058 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1159051..1159482 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1159500..1159772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1159810..1161069 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene tnpB CDS complement(1161094..1161768) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1161819..1162838 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1162903..1164081) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1164624..1165883 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene glgC CDS complement(1165910..1167190) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1167268..1168362) product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1168442..1169407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1169626..1170069) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1170525..1170713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1170764..1171123 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1171217..1172509 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1172554..1172745 product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1172930..1174216 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1174226..1175236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1175426..1176958 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene rmuC CDS 1176940..1177440 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168289.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1177680..1179053) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1179589..1180284 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1180400..1181272) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1181304..1182947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1183106..1183816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1184021..1184203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1184331..1184906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1185035..1186279 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene sbcD CDS 1186276..1189968 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1190089..1190889) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1190993..1193017) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1193021..1193974) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 tRNA complement(1194125..1194201) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(1194385..1195116) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1195255..1195911) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene hxpB CDS 1196060..1196911 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1196937..1198307) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1198392..1199003 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1199000..1199203) product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1199235..1200107) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1200185..1200664) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1200664..1201449) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1201633..1202262 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453853.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1202363..1203271 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene nagK CDS 1203471..1203818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1203974..1204234) product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1204245..1205123) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1205125..1207467) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1207685..1208398 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene cobB CDS complement(1208384..1209481) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene potD CDS 1209739..1210572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1210607..1211236 product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1211270..1212193) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene ttcA CDS complement(1212314..1213258) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene uspE CDS complement(1213442..1214194) product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1214337..1215041) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1215089..1217530) product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1217538..1218017) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1218106..1219086) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene ccoP CDS complement(1219086..1219259) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1219270..1219890) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene ccoO CDS complement(1219902..1221329) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene ccoN CDS 1221525..1221761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1222023..1223216) product 2-nitroimidazole transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene nimT CDS complement(1223476..1223775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1223788..1224237) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene matP CDS 1224426..1226069 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1226136..1226666 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene fabA CDS complement(1226851..1227024) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene rmf CDS complement(1227214..1229118) product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1229125..1230990) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(1231022..1231258) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1231242..1233377) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene rlmKL CDS complement(1233845..1234387) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1234550..1235560) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene pyrD CDS complement(1235607..1240454) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1240677..1243280) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene pepN CDS complement(1243415..1244068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1244256..1246259) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene prc CDS complement(1246278..1246904) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene proQ CDS complement(1247006..1247479) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1247636..1248886 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480794.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1248883..1251525 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1251636..1253063 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene rsmF CDS complement(1253208..1254044) product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1254132..1254995) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1255240..1256292 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1256303..1256785 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1256832..1257773) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1258212..1259240 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1259316..1260518 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1260521..1261618 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1261635..1262384 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1262640..1263302 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1263396..1263725 product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1263720..1264001) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene yccX CDS 1264114..1265301 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1265339..1269793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1270053..1271360 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1271363..1271959 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1272076..1272429 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1272443..1273252 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1273245..1273649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1273693..1274325) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1274393..1275094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1275804..1277189 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477800.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1277254..1278021) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1278018..1279058) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1279058..1279960) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1280102..1280629 product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1280607..1281242) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1281322..1282803 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991030.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1282913..1283341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1283577..1284731) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene tnpB CDS 1284973..1285269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1285378..1285869) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1285952..1289857) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene hrpA CDS complement(1290024..1291391) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1291511..1292248) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1292338..1292784 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1292805..1293335) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108807.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1293488..1294120 product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1294120..1295964 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1296017..1298797 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1298929..1300056 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene msrB CDS 1300213..1301199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1301261..1301791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1301800..1302480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1302485..1302808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1302830..1303558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1304108..1304698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1304832..1305386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1305452..1305925) product DUF2947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1305927..1306529) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1306526..1307113) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene rimJ CDS complement(1307113..1308654) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene tyrR CDS complement(1308736..1309785) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1309789..1311156) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1311229..1311414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1311552..1313072) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1313223..1314563 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene pabB CDS 1314593..1315180 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1315302..1316702 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene asnS CDS 1316893..1318083 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1318195..1318824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1318995..1320866 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1320869..1321573 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1321570..1323141) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1323241..1324536) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1324533..1325048) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1325078..1326160) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1326405..1327076 product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057643027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1327073..1327726) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1327791..1328339) product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457820.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1328476..1330053) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1330316..1330912) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1331042..1333657) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457842.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene gyrA CDS 1333969..1334679 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146463.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1335098..1337377 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene nrdA CDS 1337443..1338576 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene nrdB CDS 1338579..1338860 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene yfaE CDS complement(1338912..1339223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1339449..1340681) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1340840..1341730 product DUF3943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450944.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1341790..1344087) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1344087..1344734) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1345169..1346353) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene nhaA CDS complement(1346699..1347745) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1347809..1350262) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1350243..1350914) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1351075..1352529 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1352498..1353199) product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1353183..1354388) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1354401..1355099) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rsuA CDS 1355171..1356919 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1357142..1357420 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene rplY CDS complement(1357574..1358341) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1358619..1358867) product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1359019..1359285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 note possible pseudo, internal stop codon, frameshifted CDS complement(1359348..1359581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 note possible pseudo, internal stop codon, frameshifted CDS complement(1359688..1360170) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480144.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1360157..1360588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1360663..1361106) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1361309..1362481) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene iadA CDS complement(1362491..1363345) product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524243.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene gsiD CDS complement(1363351..1364268) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene gsiC CDS complement(1364275..1365780) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene gsiB CDS complement(1365794..1367632) product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene gsiA CDS complement(1367797..1367964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1368243..1368713 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1368968..1370656 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1370793..1371449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1372401..1373357 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene trxB CDS 1373437..1375218 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene cydD CDS 1375211..1376938 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene cydC CDS 1377089..1377544 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1377618..1378607) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1378725..1379645 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1379673..1380755) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene serC CDS complement(1380892..1382154) product DUF945 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1382409..1384310 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489098.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1384325..1384822 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031962.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1384959..1385498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1385572..1385772) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1386731..1387420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1387498..1388673) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1388865..1389560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1389782..1392067 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1392136..1394577) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1394684..1396246) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1396385..1396951) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1397112..1398197 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1398194..1401271 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1401512..1402681 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene sstT CDS 1402956..1404335 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1404347..1404745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1404807..1405697 product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1406017..1407249 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene pepT CDS 1407628..1408068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1408216..1408737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1408910..1409320 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene arfB CDS complement(1409349..1409753) product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1409893..1412112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1412254..1414947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1415301..1415945) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1416492..1417013) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1417010..1417453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1417455..1418660) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1418808..1419560) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene phnE CDS complement(1419618..1420418) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene phnE CDS complement(1420415..1421215) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene phnC CDS complement(1421224..1422162) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene phnD CDS complement(1422342..1423340) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1423682..1425091 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene ptsG CDS 1425468..1426646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1426634..1427053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1427054..1428391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1428584..1431073) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1431073..1431486) product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1431634..1432956 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1433175..1434062 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1434155..1436050) product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1436127..1437050) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1437202..1438122) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1438235..1438882 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1439039..1439710) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene artM CDS complement(1439707..1440396) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene artQ CDS complement(1440398..1441132) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1441191..1441919) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene artP CDS complement(1442105..1442542) product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1443268..1444734 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene tnaA CDS 1444856..1446070 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1447596..1448921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1448972..1450003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1450003..1450464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1450757..1452457 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1452454..1454622) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene recQ CDS complement(1454706..1455071) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1455141..1455434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1455635..1457299 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene fadD CDS complement(1457412..1458290) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065641382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1458430..1458726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1459073..1460329 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1460608..1460796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1461175..1461525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 note possible pseudo, internal stop codon, frameshifted CDS complement(1461784..1463544) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1463875..1464402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1464399..1465430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1465476..1465838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1466529..1467857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 note possible pseudo, frameshifted CDS 1467857..1468759 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene secF CDS 1469027..1470118 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1470176..1470832 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1470878..1472269 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene mgtE CDS 1472306..1472956 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1473113..1473790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1473866..1474567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1474864..1475796 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1475914..1477569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1477919..1478959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1479389..1480510 product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1480623..1480976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1481925..1482395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1482593..1483867) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1484000..1485208) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 tRNA complement(1485521..1485608) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 1485859..1486428 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1486509..1487570) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene nadA CDS complement(1487680..1488486) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene ybgF CDS complement(1488503..1489060) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene pal CDS complement(1489096..1490442) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene tolB CDS complement(1490453..1491460) product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene tolA CDS complement(1491521..1491964) product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1491968..1492651) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene tolQ CDS complement(1492653..1493072) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483618.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene ybgC CDS complement(1493454..1494590) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene cydB CDS complement(1494606..1496195) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene cydA CDS complement(1496528..1497538) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene ruvB CDS complement(1497541..1498155) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene ruvA CDS complement(1498266..1498787) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene ruvC CDS complement(1498873..1500648) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene aspS CDS 1500944..1501672 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene cmoA CDS complement(1502488..1504956) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018812.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene torA CDS complement(1504976..1506160) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene torC CDS 1506824..1507057 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1507077..1507919 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832742.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1507982..1512436) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene mukB CDS complement(1512433..1513092) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene mukE CDS complement(1513100..1514449) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene mukF CDS complement(1514465..1515241) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene cmoM CDS complement(1515367..1515528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1515479..1516165 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene elyC CDS 1516230..1516877 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene torD CDS 1517047..1518060 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene purR CDS 1518219..1518893 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1518936..1519256 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1519241..1519969) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1520197..1520721) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1520718..1521266) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1521290..1521787) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1521793..1523028) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1523046..1523795) product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1523792..1525075) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1525087..1525809) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127634.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1525806..1526225) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1526388..1527263) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene htpX CDS complement(1527232..1527486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 1527544..1527705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1527786..1528463) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460040.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene bioD CDS complement(1528460..1529242) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene bioC CDS complement(1529239..1530402) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene bioF CDS complement(1530389..1531441) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene bioB CDS 1531531..1532835 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene bioA CDS complement(1532930..1533382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1533516..1534823) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene serS CDS complement(1534907..1536253) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1536269..1536871) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene lolA CDS complement(1536884..1539970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1540162..1540653) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene lrp CDS 1540811..1541935 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene ald CDS complement(1541932..1543161) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1543165..1544139) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene cysB CDS 1544329..1545093 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1545127..1546386) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054297574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene tnpB CDS 1546424..1546819 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034376438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene tnpA CDS complement(1546956..1547423) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1547423..1548163) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1548545..1549234) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene pyrF CDS complement(1549340..1550509) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene lapB CDS complement(1550518..1550820) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1551003..1551287) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene ihfB CDS complement(1551361..1553025) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene rpsA CDS complement(1553146..1553823) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene cmk CDS complement(1554221..1555279) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene sohB CDS 1555368..1556108 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1556146..1558110) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1558158..1558706) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1558772..1560769) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1561093..1562949 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461788.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene sppA CDS 1563087..1564112 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene ansA CDS complement(1564235..1564519) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1564565..1564975) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene msrB CDS 1565290..1566285 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene gap CDS 1566355..1567239 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1567329..1568150 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rlmA CDS 1568283..1569206 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1569362..1569640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1570686..1571606) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1572210..1572662) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1572817..1573068 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1573160..1573843 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene aqpZ CDS complement(1573900..1574499) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene recR CDS complement(1574513..1574842) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1574916..1576982) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460096.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene dnaX CDS complement(1577006..1577551) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene apt CDS complement(1577641..1578003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1578096..1579193) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1579368..1580255 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1580350..1581867) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene purF CDS complement(1581899..1582396) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1582454..1583041) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1583031..1584305) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene folC CDS complement(1584350..1585273) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene accD CDS complement(1585446..1586237) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene truA CDS complement(1586300..1587811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1587997..1589010) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1589007..1590140) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1590277..1591488) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene fabB CDS 1591607..1593619 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162806064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene mnmC CDS complement(1593687..1594217) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1594329..1594595) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479532.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1594599..1595195) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1595565..1596557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1596561..1597469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1597497..1599869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1600100..1601185) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene aroC CDS complement(1601312..1602244) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene prmB CDS 1602304..1602825 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene smrB CDS 1602888..1603400 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1603452..1603925) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene sixA CDS 1604145..1606922 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1606986..1608140 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1608392..1610500) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene fadJ CDS complement(1610500..1611807) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene fadI CDS 1612212..1612793 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479482.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1612786..1613505 product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1613814..1615109 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1615435..1616121) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1616224..1616973) product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1617033..1618277) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene ccmI CDS complement(1618277..1618738) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1618735..1619289) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1619289..1621247) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1621244..1621732) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene ccmE CDS complement(1621729..1621935) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ccmD CDS complement(1621938..1622687) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1622718..1623386) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene ccmB CDS complement(1623389..1624006) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene ccmA CDS complement(1624181..1625083) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1625355..1626695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1626787..1627416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1627426..1628907) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052678357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1628924..1629445) product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene tadF CDS complement(1629432..1629917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1629918..1630949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1630951..1631793) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012535186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1631793..1632704) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1632701..1633984) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261282.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1633981..1635255) product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1635255..1635719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1635716..1637050) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1637050..1637913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1637910..1638341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1638354..1638566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1638735..1638935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1639966..1640223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1640255..1641370) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065598140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1641617..1641775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1642182..1643708 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene glpK CDS 1643845..1644615 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1644788..1646347 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene glpD CDS complement(1646793..1647287) product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1647550..1648548 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 tRNA complement(1648801..1648876) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 1649044..1649631 product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262817.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1649771..1650862 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1650935..1652059) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1652108..1653475) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene dcuC CDS 1653823..1654419 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene cobO CDS complement(1654473..1656803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1656942..1657583) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461598.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene udk CDS complement(1657803..1658861) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene apbC CDS 1659031..1661082 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482411.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene metG CDS complement(1661156..1662370) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1662513..1663667) product DUF6363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1663959..1664546 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1665010..1666482 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1666727..1667149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1667352..1668782) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene ptsG CDS complement(1669220..1669990) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1670103..1671056) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105062878.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene holB CDS complement(1671057..1671692) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene tmk CDS complement(1671689..1672717) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene mltG CDS complement(1672710..1673516) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene pabC CDS complement(1673622..1674872) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene fabF CDS complement(1674972..1675205) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004737381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene acpP CDS complement(1675369..1676103) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420124.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene fabG CDS complement(1676125..1677048) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene fabD CDS complement(1677115..1678065) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1678071..1679096) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene plsX CDS complement(1679106..1679276) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene rpmF CDS complement(1679282..1679818) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene yceD CDS complement(1679874..1680068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1680037..1680633 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1680703..1681641) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene rluC CDS 1682231..1685206 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene rne CDS 1685499..1687058 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1687109..1688584) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1688735..1689721) product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1689741..1690433) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1690772..1691689) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1691795..1692847 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1692858..1693796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1693831..1694298) product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1694356..1695231) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196597804.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 1695363..1696277 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene rlmF CDS complement(1696274..1696705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1696793..1697212 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464169.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene soxR CDS 1697227..1697934 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1698021..1698617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1699068..1699643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1699949..1700353 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675091.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1700446..1700661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 tRNA complement(1700783..1700859) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1701060..1701917 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene folD CDS complement(1701995..1702993) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1702997..1703284) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1703465..1704124 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene minC CDS 1704139..1704951 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene minD CDS 1704955..1705218 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene minE CDS complement(1705297..1706418) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene rnd CDS complement(1706465..1708141) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455511.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene fadD CDS complement(1708286..1709119) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1709121..1709663) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784639.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1709687..1710445) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene tsaB CDS complement(1710432..1712360) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1712473..1713306 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412706.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene purU CDS complement(1713301..1713882) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1714060..1715793 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene argS CDS 1716206..1717573 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1718197..1719129 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1719138..1719566 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1719583..1719804) product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1719816..1722092) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455466.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene feoB CDS complement(1722092..1722319) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1722449..1723324) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene znuA CDS 1723441..1724232 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene znuC CDS 1724225..1725004 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene znuB CDS complement(1725103..1725975) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene sucD CDS complement(1725975..1727141) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene sucC CDS complement(1727302..1728513) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455502.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene odhB CDS complement(1728527..1731352) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene sucA CDS complement(1731492..1732202) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1732214..1733980) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene sdhA CDS complement(1733981..1734328) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene sdhD CDS complement(1734322..1734702) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene sdhC CDS 1735102..1736391 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1736434..1737192) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1737308..1738081 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1738843..1740489) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene pgm CDS complement(1740572..1741132) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene seqA CDS 1741219..1741995 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1742063..1742281 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1742328..1742855 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene fldA CDS complement(1742894..1743397) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943809.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1743554..1743997 product ferric iron uptake transcriptional regulator FcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene fcrX CDS 1744011..1744598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1744653..1746314) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene glnS CDS complement(1746465..1747952) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene nagE CDS 1748348..1749478 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene nagA CDS 1749487..1750707 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1750774..1752366 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1753014..1753616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1753785..1755449 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene asnB CDS complement(1755513..1755959) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene rfaH CDS complement(1756125..1757081) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478510.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene hemH CDS complement(1757162..1757806) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene adk CDS complement(1757966..1759867) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene htpG CDS 1760248..1761108 product transcriptional regulator ToxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene toxR CDS 1761105..1761626 product transmembrane regulator ToxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene toxS CDS complement(1761677..1762231) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene yfcE CDS 1762397..1763308 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 1763639..1764493 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1764643..1765566 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1765563..1766015 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1766067..1768109) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene ligA CDS complement(1768171..1769160) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene zipA CDS 1769337..1770101 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene cysZ CDS 1770236..1771204 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene cysK CDS 1771481..1771738 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1771864..1773588 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene ptsI CDS 1773629..1774138 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene crr CDS complement(1774201..1775100) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477170.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1775141..1775590) product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1775649..1775990 product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1775993..1776274) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1776466..1776816 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1776835..1777971 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene dapE CDS 1777976..1778674 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1778701..1778922 product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1779132..1780103) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1780439..1781488) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene bamC CDS complement(1781532..1782410) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481116.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene dapA CDS 1782667..1783206 product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1783216..1783683 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene bcp CDS complement(1783733..1784809) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1784816..1785037) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1785329..1786732 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667946.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1786751..1787101 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117768.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene arsC CDS 1787101..1787529 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457718.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1787620..1788831) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1788918..1789544) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene upp CDS 1789729..1790769 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene purM CDS 1790772..1791356 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene purN CDS 1791593..1792657 product GlyGly-anchored extracellular serine protease VesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233647.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene vesA CDS complement(1792663..1793508) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1793532..1794110) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene lpcA CDS 1794413..1796860 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene fadE CDS complement(1796937..1797656) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene dnaQ CDS 1797709..1798173 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484436.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene rnhA CDS complement(1798182..1798829) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1798942..1799700 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene gloB CDS 1799754..1801334 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1801338..1802192) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1802293..1802631) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene glnB CDS complement(1802706..1803014) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1803032..1804354) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene tilS CDS complement(1804414..1805373) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene accA CDS complement(1805420..1808899) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene dnaE CDS complement(1808917..1809531) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene rnhB CDS complement(1809532..1810674) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262425.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene lpxB CDS complement(1810746..1811537) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene lpxA CDS complement(1811540..1811992) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene fabZ CDS complement(1812160..1813182) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210023.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene lpxD CDS complement(1813189..1813698) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1813716..1816154) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene bamA CDS complement(1816197..1817552) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene rseP CDS complement(1817564..1818760) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene ispC CDS complement(1818779..1819624) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1819635..1820390) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene uppS CDS complement(1820483..1821040) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene frr CDS complement(1821079..1821807) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene pyrH CDS complement(1821995..1822837) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene tsf CDS complement(1822961..1823692) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene rpsB CDS 1824023..1824901 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456732.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene map CDS complement(1824963..1828082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 1828188..1830821 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene glnD CDS 1830917..1831300 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456756.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1831368..1832120) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene truC CDS complement(1832114..1832434) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160170.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1832513..1833556 product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1833557..1833853 product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1833914..1834198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1834195..1834641 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1834665..1835447) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1835450..1835995) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene syd CDS 1836139..1836993 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene queF CDS 1837089..1839272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1839444..1840802 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586703.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene ppnN CDS 1840916..1841686 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene xni CDS complement(1841777..1842862) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155650284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene rlmM CDS complement(1842887..1843798) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105705.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1844134..1845582) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene thiI CDS 1845850..1846104 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene xseB CDS 1846091..1846984 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene ispA CDS 1846999..1848873 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene dxs CDS complement(1848950..1849453) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene pgpA CDS complement(1849457..1850428) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene thiL CDS complement(1850498..1850968) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene nusB CDS complement(1850968..1851438) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ribE CDS complement(1851567..1852676) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene ribBA CDS complement(1852705..1853358) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1853382..1854467) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene ribD CDS complement(1854471..1854920) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene nrdR CDS complement(1855222..1856472) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366574.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1856485..1857588) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene proB CDS complement(1857704..1858087) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene crl CDS complement(1858191..1859429) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene frsA CDS complement(1859519..1859983) product oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene tet(34) CDS complement(1860014..1861309) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1862302..1863774 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1863835..1864371) product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1864570..1868463) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene purL CDS 1868773..1870257 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene mltF CDS 1870424..1870594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1870591..1871127) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene tadA CDS complement(1871114..1872004) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1872159..1873283 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1873346..1874191 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene fghA CDS complement(1874242..1875801) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1875914..1876090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1876050..1876436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1876426..1877238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1877228..1877686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1877760..1878233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1878391..1879548) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene dnaJ CDS complement(1879798..1881714) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene dnaK CDS complement(1882043..1882681) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene grpE CDS 1882842..1883729 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455932.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene nadK CDS 1883822..1885495 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene recN CDS 1885655..1886014 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene bamE CDS complement(1886063..1886350) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1886358..1886801) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1886904..1887389 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene smpB tmRNA 1887457..1887823 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 1887989..1889191 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1889300..1890418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1890456..1891790) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1891790..1893904) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1894140..1894334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1894563..1895132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1895450..1896436) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1896955..1897203 product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene hipB CDS 1897203..1898522 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1899008..1899442 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1899920..1900681 product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1900917..1901261 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1901436..1902530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1902760..1904256) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1904265..1904711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1904776..1905702) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1905726..1906253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1906486..1907538) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene arsB CDS complement(1907591..1907926) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1908205..1909134 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1909164..1910633) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene focA CDS complement(1910870..1911490) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1911483..1912157) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462377.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1912123..1913826) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1913839..1914987) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1914934..1915110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1915118..1915360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1915409..1915930) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479918.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1916096..1917673) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460250.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene guaA CDS complement(1917820..1919283) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417956.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene guaB CDS 1919492..1920832 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene xseA CDS complement(1920910..1921134) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1921505..1922992) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene der CDS complement(1923152..1924315) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene bamB CDS complement(1924327..1924941) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424767.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1924954..1926222) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene hisS CDS complement(1926266..1927387) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene ispG CDS complement(1927390..1928244) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene rodZ CDS complement(1928287..1928949) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene pilW CDS complement(1929007..1930137) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1930299..1930727) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene ndk CDS complement(1930819..1932102) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460223.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene pepB CDS complement(1932329..1932523) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene iscX CDS complement(1932541..1932879) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene fdx CDS complement(1932894..1934744) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene hscA CDS complement(1934766..1935281) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460241.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene hscB CDS complement(1935345..1935668) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene iscA CDS complement(1935714..1936097) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene iscU CDS complement(1936131..1937345) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1937373..1937870) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene iscR CDS complement(1937985..1938713) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene trmJ CDS 1938906..1939709 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene suhB CDS complement(1939798..1941135) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene glmM CDS complement(1941150..1941980) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene folP CDS complement(1942043..1943896) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene ftsH CDS complement(1944077..1944706) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rlmE CDS 1944845..1945141 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene yhbY CDS complement(1945189..1945662) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene greA CDS 1946166..1947239 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1947313..1949211) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1949441..1950814 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene dacB CDS complement(1950836..1951681) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1952068..1953255) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146472.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene tyrS CDS 1953379..1954674 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490383.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1954716..1957808) product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene vmeK CDS complement(1957821..1958912) product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene vmeJ CDS complement(1959015..1959356) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene erpA CDS 1959553..1960836 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene hemL CDS 1960929..1962014 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 1962030..1963049 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene rsmC CDS 1963219..1966548 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1966992..1967171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1967170..1968843 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1969058..1969960 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540337.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1969963..1970991 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 1970995..1971981 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1972001..1972996 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1973056..1974753 product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1974750..1975619 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1975621..1977510 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060994152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1977558..1978583) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1978583..1980208) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1980370..1981383) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1981635..1982864) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1982890..1983228) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene glnK CDS complement(1983432..1983800) product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1983892..1986480) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032551753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene acnB CDS complement(1986696..1988996) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1989063..1991432) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene mrcB CDS complement(1991447..1993927) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene hrpB CDS 1993985..1994701 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene sfsA CDS 1994844..1995290 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene dksA CDS 1995358..1996248 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene gluQRS CDS 1996317..1997669 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015297242.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene pcnB CDS 1997666..1998151 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene folK CDS 1998177..1998971 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454450.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene panB CDS 1998981..1999832 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene panC CDS complement(1999910..2000680) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(2000682..2001602) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271063.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2001839..2002483 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene can CDS complement(2002541..2003071) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene hpt CDS complement(2003209..2004639) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479684.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene lpdA CDS complement(2004840..2006708) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene aceF CDS complement(2006721..2009384) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene aceE CDS complement(2009430..2010203) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene pdhR CDS complement(2010463..2010999) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene ampD CDS 2011099..2011986 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene nadC CDS 2012218..2012622 product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262622.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 2012622..2014085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 2014078..2015292 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 2015341..2016219 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 2016219..2016830 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene coaE CDS 2016820..2017599 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene zapD CDS 2017609..2017803 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene yacG CDS complement(2017967..2018320) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462554.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene rplS CDS complement(2018360..2019106) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene trmD CDS complement(2019128..2019658) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene rimM CDS complement(2019687..2019935) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene rpsP CDS complement(2020186..2021577) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene ffh CDS 2021867..2022661 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 2022770..2024032 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2024090..2024605) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene luxS CDS complement(2024620..2026215) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene gshA CDS complement(2026328..2029195) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(2029208..2029660) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(2029780..2030910) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(2030923..2032698) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene oadA CDS complement(2032719..2032982) product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106067.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 tRNA complement(2033264..2033340) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(2033396..2033472) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(2033528..2033604) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(2033660..2033736) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(2033792..2033868) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(2033951..2034043) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(2034086..2034162) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(2034194..2034286) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(2034458..2034655) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene csrA CDS complement(2034733..2036004) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(2036055..2038646) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene alaS CDS complement(2038952..2039437) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene recX CDS complement(2039516..2040544) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene recA CDS complement(2040659..2041144) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene pncC CDS 2041402..2042316 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 2042641..2045232 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene mutS CDS complement(2045294..2046277) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393877.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene rpoS CDS complement(2046326..2047069) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597567.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(2047149..2047775) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(2047779..2048513) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene surE CDS complement(2048510..2049538) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene truD CDS complement(2049547..2050026) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene ispF CDS complement(2050023..2050724) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene ispD CDS complement(2050745..2051020) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene ftsB CDS complement(2051249..2052547) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene eno CDS complement(2052633..2054270) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2054410..2055222) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene mazG CDS complement(2055283..2057505) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene relA CDS complement(2057626..2058939) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090462.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene rlmD CDS complement(2059014..2059196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 2059270..2061858 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene barA CDS complement(2061890..2062270) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene acpS CDS complement(2062270..2063001) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene pdxJ CDS complement(2062998..2063735) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene recO CDS complement(2063771..2064757) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene era CDS complement(2064750..2065427) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene rnc CDS complement(2065437..2066333) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene lepB CDS complement(2066430..2068223) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene lepA CDS complement(2068363..2068842) product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(2068839..2069798) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734779.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene rseB CDS complement(2069795..2070397) product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(2070411..2070989) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene rpoE CDS 2071356..2073005 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene nadB CDS complement(2073078..2073338) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 2073406..2074401 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene ygfZ CDS 2074865..2075110 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2075140..2076342) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2076344..2077507) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene ubiH CDS complement(2077516..2078187) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 2078357..2078659 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 2078854..2079459 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 2079527..2080183 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene rpiA CDS 2080365..2081594 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene serA CDS complement(2081627..2082319) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(2082358..2083254) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 2083359..2083991 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2084043..2084903) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene mscS CDS complement(2085117..2086193) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene fbaA CDS complement(2086316..2087479) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(2087605..2088627) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene epd CDS 2088774..2090537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 2090540..2091478 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(2091512..2093506) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene tkt CDS 2093884..2095038 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene metK CDS 2095313..2096131 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2096240..2096734 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461721.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2096801..2097508 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene endA CDS 2097592..2098323 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene rsmE CDS 2098333..2099280 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene gshB CDS 2099368..2099928 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2099946..2100353 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091869.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene ruvX CDS complement(2100350..2101453) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(2101510..2102550) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2102575..2103270 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2103331..2105472) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(2105605..2106558) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2106842..2107669 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene proC CDS 2107694..2108263 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2108281..2108724 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 2108728..2109333 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2109330..2110508 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene hemW CDS complement(2110543..2111463) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene glsB CDS complement(2111545..2112576) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2112603..2113322) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene trmB CDS 2113474..2114529 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene mutY CDS 2114540..2114812 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 2115041..2116180 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene mltC tRNA 2116280..2116355 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 2116409..2116484 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 2116492..2116567 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 2116603..2116678 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 2116740..2116815 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 2116824..2116899 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 2117248..2117323 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 2117381..2117456 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 2117465..2117540 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS complement(2117773..2118276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 note possible pseudo, internal stop codon, frameshifted CDS 2118701..2120575 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2120668..2121816 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 2121866..2122402 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703790.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene mtlR CDS complement(2122459..2123259) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene nagB CDS 2123547..2124320 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 2124369..2126201 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene glmS CDS complement(2126381..2127601) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2127926..2128255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072044.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2128411..2129673) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2130219..2130923) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2131201..2132214 product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2132319..2132783 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 2132793..2134076 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 2134111..2134896 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 tRNA complement(2135122..2135206) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 2135379..2135870 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2135913..2136983) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene lptG CDS complement(2136985..2138085) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene lptF CDS 2138305..2139813 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene pepA CDS complement(2139743..2139907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2139906..2140349 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 2140463..2143321 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 2143471..2143857 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2143906..2144325) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rraB CDS 2144567..2145571 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene argF CDS 2145787..2146716 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene pyrB CDS 2146725..2147195 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261195.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene pyrI CDS 2147232..2147621 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417516.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2147665..2148453) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455109.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2148597..2149865) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene murA CDS complement(2149876..2150130) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455111.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene ibaG CDS complement(2150132..2150446) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(2150448..2151089) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene mlaC CDS complement(2151089..2151571) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene mlaD CDS complement(2151575..2152357) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene mlaE CDS complement(2152347..2153153) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene mlaF CDS 2153349..2154314 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 2154327..2155298 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene kdsD CDS 2155302..2155859 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261184.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene kdsC CDS 2155856..2156419 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059348.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene lptC CDS 2156385..2156897 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene lptA CDS 2156904..2157629 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene lptB CDS 2157654..2159129 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 2159151..2159438 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261180.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene hpf CDS 2159441..2159908 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene ptsN CDS 2159901..2160767 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene rapZ CDS 2160767..2161039 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2161204..2162562 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene mgtE CDS complement(2162638..2163981) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene pmbA CDS 2164116..2164640 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene yjgA CDS complement(2164708..2166153) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene tldD CDS complement(2166177..2167001) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2167011..2170880) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2170893..2172362) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene rng CDS complement(2172380..2172955) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(2172959..2173444) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461823.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene mreD CDS complement(2173437..2174255) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene mreC CDS complement(2174416..2175459) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2175610..2178984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2178977..2179447) product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2179437..2180201) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2180201..2180803) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2180793..2181296) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2181431..2181913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2182034..2182516) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139685680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2182533..2183120) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2183359..2183778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2183810..2185030) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(2185038..2186765) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(2186755..2187957) product MSHA biogenesis protein MshN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2187936..2188781) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456312.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(2188781..2190409) product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene mshL CDS complement(2190425..2190748) product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481006.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(2190741..2191382) product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene gspM CDS complement(2191379..2192821) product MSHA biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2192865..2194865) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001924594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene csrD CDS complement(2195011..2195556) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2195848..2196483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2196588..2197460 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene galU CDS 2197575..2200406 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene uvrA CDS 2200419..2202182 product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2202229..2203341) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2203318..2203560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2203598..2204962 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene lysC CDS complement(2205016..2208684) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene metH CDS 2208859..2210142 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(2210184..2211125) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene metA tRNA complement(2211477..2211553) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 rRNA complement(2211647..2211757) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(2211897..2214783) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(2215110..2215185) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(2215251..2215326) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(2215329..2215404) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 rRNA complement(2215533..2217081) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 rRNA complement(2217483..2217593) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2217733..2220619) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(2220961..2221036) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(2221125..2221201) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 rRNA complement(2221304..2222852) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 rRNA complement(2223221..2223331) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA complement(2223471..2226357) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA complement(2226717..2226792) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 rRNA complement(2226870..2228418) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS complement(2228989..2229762) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2229755..2231470) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261117.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene cysI CDS complement(2231470..2233275) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2233377..2233607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(2233714..2234370) product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082171.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2234440..2234649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2234825..2235697) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene dusA CDS complement(2236027..2236830) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2237000..2238652) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene pgi CDS complement(2238838..2239938) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene alr CDS complement(2239947..2241347) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2241527..2242261 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2242319..2242771) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene rplI CDS complement(2242802..2243029) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene rpsR CDS complement(2243046..2243348) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467185.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene priB CDS complement(2243357..2243737) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381299.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene rpsF CDS complement(2244004..2244741) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene rlmB CDS complement(2244754..2247195) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene rnr CDS complement(2247289..2247714) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460673.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene nsrR CDS 2247822..2249006 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene hmpA CDS complement(2249058..2250374) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2250602..2250787 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480030.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(2250855..2251841) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene hflC CDS complement(2251844..2253046) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene hflK CDS complement(2253092..2254381) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene hflX CDS complement(2254431..2254691) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene hfq CDS complement(2255068..2256000) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene miaA CDS complement(2255993..2257909) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene mutL CDS complement(2257906..2259579) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2259576..2260040) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene tsaE CDS 2260217..2261347 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061012950.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene queG tRNA complement(2261825..2261900) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(2261950..2262026) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(2262085..2262160) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(2262210..2262286) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(2262345..2262420) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(2262470..2262546) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(2262604..2262679) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 CDS complement(2262791..2263336) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene orn CDS 2263474..2264532 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene rsgA CDS 2264598..2265461 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene asd CDS complement(2265521..2266171) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2266401..2267192 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261062.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2267288..2267791 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene rraA CDS 2267935..2269350 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 2269370..2270092 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2270287..2271045 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(2271050..2271925) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene epmA CDS 2271990..2272112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2272244..2274031 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene frdA CDS 2274031..2274768 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2274769..2275152 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene frdC CDS 2275163..2275525 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene frdD CDS complement(2275595..2276161) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456976.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene efp CDS 2276195..2277217 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene epmB CDS complement(2277228..2277806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2277972..2279564) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2279653..2281092) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2281191..2284841) product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene pulA CDS complement(2285201..2286847) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene groL CDS complement(2286898..2287188) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2287173..2287382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2287427..2288761 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2288769..2289590) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806519.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene cysE CDS complement(2289619..2290656) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene gpsA CDS complement(2290846..2291319) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene secB CDS complement(2291421..2291891) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2292285..2293823 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene gpmM CDS 2293887..2295038 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(2295090..2295335) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007388.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene zapB CDS 2295670..2296677 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene glpX CDS complement(2296760..2297185) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2297258..2297608) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133286.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 2297862..2298632 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene tpiA CDS complement(2298757..2299719) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene pfkA CDS complement(2299941..2300858) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene fieF CDS complement(2301131..2301685) product CpxP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761521.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 2301882..2302565 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940152.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 2302562..2303932 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene cpxA CDS 2303990..2304466 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478594.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene trmL CDS complement(2304527..2305009) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene fxsA CDS 2305360..2306793 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene aspA CDS 2306877..2308184 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2308315..2310078 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2310228..2310863 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 2311083..2311346 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2311358..2313085 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 2313497..2314456 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2314541..2315029 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2315031..2316335 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2316581..2317063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2317060..2320512) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2320582..2321769) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478595.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2321938..2323758 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2323762..2324397 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2324551..2326500 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene acs CDS 2326855..2327304 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene aroQ CDS 2327364..2327822 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene accB CDS 2327838..2329181 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene accC CDS 2329380..2330270 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene prmA CDS 2330507..2331367 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene dusB CDS 2331413..2331709 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene fis CDS complement(2333008..2335350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2335456..2335821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2335832..2336044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2336136..2336633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2336657..2337859) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085257.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2338110..2338349) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(2338687..2339838) product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2339835..2340263) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene zntR CDS complement(2340367..2340540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2340611..2342203 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene purH CDS 2342359..2343648 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene purD CDS complement(2343709..2344404) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2344445..2344717) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene hupA CDS 2344974..2346026 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2346086..2346676) product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 2346766..2347692 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(2347762..2348439) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993369.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene pyrE CDS complement(2348510..2349226) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene rph CDS 2349373..2350239 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(2350397..2351143) product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2351525..2352781 product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene dcm CDS complement(2353041..2353340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2353395..2353670) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705368.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2354090..2354995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2355158..2355364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(2355617..2355871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(2355868..2356050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2356205..2356456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2356453..2362752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 2363030..2363653 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene gmk CDS 2363715..2363987 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379346.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene rpoZ CDS 2364010..2366142 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene spoT CDS 2366168..2366854 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene trmH CDS complement(2366859..2367563) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene radC CDS 2367706..2368917 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene coaBC CDS 2368914..2369369 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164750.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene dut CDS 2369402..2369992 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478760.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene slmA CDS 2370008..2370955 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2371006..2372073) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene hemE CDS complement(2372177..2372974) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884422.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene nudC CDS 2373147..2373632 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2373792..2377991) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene rpoC CDS complement(2378077..2382105) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene rpoB CDS 2382104..2382328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2382336..2382704) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene rplL CDS complement(2382762..2383256) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene rplJ CDS complement(2383520..2384227) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene rplA CDS complement(2384232..2384660) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene rplK CDS complement(2384804..2385352) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene nusG CDS complement(2385365..2385742) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene secE CDS complement(2385999..2387183) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene tuf tRNA complement(2387282..2387357) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(2387371..2387445) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(2387481..2387565) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(2387598..2387673) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 CDS 2387924..2388787 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene coaA CDS complement(2388796..2389755) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene birA CDS complement(2389756..2390802) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593527.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene murB CDS 2390882..2391304 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 2391409..2392749 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene pssA tRNA complement(2392953..2393029) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(2393107..2393183) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 rRNA complement(2393277..2393387) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA complement(2393497..2396383) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 tRNA complement(2396725..2396800) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(2396889..2396965) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 rRNA complement(2397068..2398616) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 rRNA complement(2399017..2399127) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 rRNA complement(2399237..2402123) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA complement(2402508..2404056) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 CDS 2404710..2405159 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480876.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2405131..2405919) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene murI CDS 2406067..2407173 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene trmA CDS complement(2407215..2407580) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2407596..2408210) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene fabR CDS 2408387..2409787 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529898.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene sthA CDS complement(2409784..2411148) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480864.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene dinF CDS complement(2411218..2411835) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480871.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene lexA CDS complement(2411956..2412312) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2412560..2414983 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460370.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene plsB CDS complement(2415032..2415886) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene ubiA CDS complement(2415873..2416424) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2416508..2417341) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene glpG CDS complement(2417341..2417661) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene glpE CDS complement(2418015..2418875) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene rpoH CDS complement(2419042..2419974) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481956.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene ftsX CDS complement(2419964..2420638) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617864.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene ftsE CDS complement(2420662..2421876) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene ftsY CDS 2422185..2422619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2422616..2422882 product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421383.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 tRNA complement(2422972..2423048) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(2423100..2423175) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA complement(2423222..2423298) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA complement(2423440..2423515) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA complement(2423547..2423623) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 CDS 2423917..2424327 product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2424381..2426396) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene rep CDS 2426567..2427136 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2427156..2428256 product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene vmeC CDS 2428267..2431326 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 2431443..2431700 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2431798..2433282) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421503.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene ilvC CDS 2433493..2434308 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene ilvY rRNA complement(2434428..2434538) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 tRNA complement(2434586..2434661) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 rRNA complement(2434720..2434830) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA complement(2434940..2437826) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 tRNA complement(2438153..2438228) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA complement(2438294..2438369) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 tRNA complement(2438372..2438447) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 rRNA complement(2438576..2440124) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 CDS complement(2440696..2441406) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene fre CDS complement(2441422..2441688) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222789.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(2441688..2443565) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene ubiD CDS complement(2443638..2444603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2444716..2446278) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene rho CDS complement(2446448..2446774) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene trxA CDS 2446880..2448181 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene rhlB CDS 2448189..2449673 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480964.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene gppA CDS 2449732..2450700 product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463759.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(2450737..2451408) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2451579..2451875) product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458579.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2451868..2453691) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene recQ CDS 2454128..2454724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2454721..2455380 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2455592..2457214 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene ggt CDS complement(2457990..2460161) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene uvrD CDS 2460429..2460689 product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 2460757..2461611 product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2461608..2462363 product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458569.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 2462369..2462824 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2462831..2463112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2463365..2465155 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260919.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2465220..2466332) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene thiH CDS complement(2466329..2467111) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2467117..2467326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2467319..2468083) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene thiF CDS complement(2468077..2469216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2469445..2469828) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene crcB tRNA complement(2470042..2470132) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 rRNA complement(2470217..2470327) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00260 rRNA complement(2470467..2473353) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00270 tRNA complement(2473723..2473798) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 rRNA complement(2473889..2475437) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00280 CDS 2475979..2476527 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057644910.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2476520..2476783) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2476780..2477619) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene aroE CDS complement(2477685..2478590) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene hemF CDS complement(2478592..2479149) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 2479335..2479820 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene purE CDS 2479824..2480939 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2480980..2481519) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2481523..2481996) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2481999..2483111) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene dprA CDS 2483220..2483729 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene def CDS 2483748..2484704 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene fmt CDS 2484760..2486049 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene rsmB CDS 2486076..2487452 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene trkA CDS 2487465..2488910 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2488949..2489431) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 2490134..2490592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2490573..2491394) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461450.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 2491879..2492145 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 2492308..2493717 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481163.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene ccoG CDS 2493853..2494839 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 2494901..2495503 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732279.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2495546..2497072) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521788.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 2497494..2499140 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene ilvG CDS 2499152..2499436 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene ilvM CDS 2499449..2500393 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2500403..2502244 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene ilvD CDS 2502249..2503781 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene ilvA CDS complement(2503838..2504530) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene punR CDS 2504850..2506028 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481162.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene punC CDS complement(2506082..2506858) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 2506950..2507693 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(2507741..2509105) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene glmU CDS complement(2509238..2509660) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2509679..2511082) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262899.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene atpD CDS complement(2511118..2511984) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene atpG CDS complement(2512029..2513570) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene atpA CDS complement(2513584..2514117) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene atpH CDS complement(2514132..2514602) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene atpF CDS complement(2514653..2514910) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450922.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene atpE CDS complement(2514961..2515764) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene atpB CDS complement(2515773..2516162) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2516306..2517196) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458443.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2517222..2517995) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2517998..2518639) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene rsmG CDS complement(2518639..2520537) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene mnmG CDS complement(2520990..2521424) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene mioC CDS complement(2521434..2522795) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458483.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene mnmE CDS complement(2522921..2524546) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene yidC CDS complement(2524785..2525132) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rnpA CDS complement(2525145..2525279) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene rpmH CDS complement(2525525..2526262) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481188.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2526259..2526930) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2527068..2527826) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 sequence2 source 1..989994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(859..1350) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 1628..1825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 1961..2167 product DUF3283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009502.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 2228..2944 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 3109..3984 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266186.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 4376..5323 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 5227..5643 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422780.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(6547..8898) product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032475098.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 9051..10454 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865460.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 10447..11439 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 11443..12567 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 12564..13685 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(13775..15874) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(16271..16561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(16823..17383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039513.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(17619..18917) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 19132..19794 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 19791..21158 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479004.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 21305..22240 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 22522..23154 product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479838.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene grxB CDS 23370..24395 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095498.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(25088..25300) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 25703..25999 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921421.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(26127..27311) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(27415..28374) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 28503..29417 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261726.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 29622..30830 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261727.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(30920..31396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 31715..32404 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 32404..33792 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(33846..36035) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene katG CDS 36816..36995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(37052..37369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(37484..38248) product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(38552..39094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(39671..40102) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262749.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 40519..41202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(41251..42609) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(42676..43665) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 43976..44461 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482882.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 44721..45695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(45783..46763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(46989..47480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(47722..48855) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(48858..49280) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065598186.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 49389..49700 product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262930.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(49738..50841) product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262454.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(50957..51442) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352302.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(52363..53373) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707753.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene argF CDS complement(53452..54366) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene arcC CDS complement(54420..55640) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene arcA CDS complement(57203..58648) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707752.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(58765..58977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 59485..59883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 59886..60653 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene atpB CDS 60702..60938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 60987..61457 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene atpF CDS 61470..62021 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281808.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene atpH CDS 62031..63572 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene atpA CDS 63620..64480 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene atpG CDS 64511..65896 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene atpD CDS 65911..66357 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421584.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(66625..66888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(67067..67429) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 tRNA 67661..67735 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 CDS complement(67836..68501) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 68723..69274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 69421..71169 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(71619..72122) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 72171..72755 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482872.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(73504..74748) product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(75062..75937) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(76050..76340) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263074.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 76526..77218 product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene phnR CDS 77659..102099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(102681..103973) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(103975..106035) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073844.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(106032..107495) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 108047..108643 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454856.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(109424..110368) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(110612..111982) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 112173..112556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 112998..113285 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(114281..115234) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(115224..115844) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene cysC CDS complement(115845..117575) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(117587..119002) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene cysN CDS complement(119377..119547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(120066..120974) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene cysD CDS 121632..122915 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 123238..123465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 123503..123928 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 124019..126247 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(126342..126557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 126843..127895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 note possible pseudo, internal stop codon CDS 129713..130996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 130997..132025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 132077..133078 product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 134404..135105 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 135215..135481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 135493..136242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 136986..137204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 137798..138664 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920788.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene galU CDS 139113..140210 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene wecA CDS 140524..140823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 140820..141164 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene tnpB CDS 141228..142781 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(142819..143085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 143596..145593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 146175..146708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 146708..147595 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 149201..149971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 149943..150644 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970287.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 151205..152239 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene wecA CDS 152776..153789 product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene pseB CDS 153798..154958 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene pseC CDS 154962..155651 product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene pseF CDS 155789..157156 product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene pseG CDS 157158..158207 product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene pseI CDS 158221..159483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 159477..160862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 160859..161938 product lipooligosaccharide biosynthesis family 4 glycosyltransferase LsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene lsgC CDS 161914..163074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(163449..164489) product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 164947..165240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 note possible pseudo, internal stop codon, frameshifted CDS complement(165391..166140) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031644.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(166140..167372) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289498.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(167769..170477) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene malT CDS 172342..174795 product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 174895..177078 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene malQ CDS 177319..179496 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene glgB CDS 179824..180204 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 180215..180727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 180811..181692 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(181657..182841) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(182982..183878) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(184051..184830) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461877.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 185159..185734 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 186386..187393 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 187564..188229 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263353.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene queE CDS complement(188254..188892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 189280..190653 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(190938..191969) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rsgA CDS complement(191966..192400) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(192400..193002) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(192999..193427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992651.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(193427..194302) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(195005..196126) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(196272..197708) product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene nhaD CDS 197904..198569 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479200.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 198566..200479 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 200571..201752 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(202453..203583) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(203583..203969) product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 204085..204975 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619521.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(204967..206439) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 206599..207576 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 207683..209005 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478177.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene phrB CDS 209058..209906 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(209994..210278) product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038496.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 210557..211885 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172527505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 212595..213416 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 213520..214431 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene pstC CDS 214436..215299 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene pstA CDS 215336..216085 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene pstB CDS 216231..216431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422950.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(216533..216691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 216743..217432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 217522..218091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 218174..218863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 218876..221302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 221380..222120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(222192..223316) product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene malK CDS 224062..225243 product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463104.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene malE CDS 225343..226917 product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895488.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene malF CDS 226930..227820 product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene malG CDS complement(227917..228159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017447309.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 228395..228958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 229090..230391 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 230405..230752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187740.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 230945..231079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(231131..231772) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(231899..232822) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(233050..234060) product IS110-like element ISNgo2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(234678..235214) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(235211..235933) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458388.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene nfsA CDS complement(236554..237504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(237631..238824) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263662.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(238925..239812) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263892.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 239977..240981 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974446.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 241063..243468 product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479868.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(243540..243839) product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(244079..244306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250488.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 244652..263098 product retention module-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489282.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 263256..265616 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007386.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 265798..266484 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(266546..267361) product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462121.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 267448..267795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(267799..269019) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454156.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene glgC CDS complement(269293..270321) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene pyrC CDS 270462..271295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(271389..272216) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene nadE CDS 272358..272879 product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 272923..273414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(273415..274023) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480809.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 274206..275333 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(275396..275695) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 275942..276220 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene ppiC CDS 276421..277419 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(277963..279165) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348936.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(279305..280042) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(280042..281697) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216141.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(281889..282098) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 282548..285799 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(285851..286849) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207527.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 287273..289351 product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(290156..291907) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(292239..292862) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(292917..293840) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(293870..294205) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 294512..296668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 296668..298809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(298927..300105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 300131..300301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(300387..301097) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 301560..302279 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 302438..304303 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 304307..305011 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(305076..305759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 305707..305856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(306140..306820) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(307153..308100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(308385..309809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(309901..310659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(311303..313225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(314043..314453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 315398..317179 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 317717..319444 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 319627..321435 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544192.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 321525..321725 product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480281.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(321766..322686) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192567381.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 322799..324100 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 324090..325217 product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 325217..326773 product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 327102..327857 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 328141..329343 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 329340..331307 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 331318..332745 product sensor histidine kinase efflux regulator BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene baeS CDS 332748..333437 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943739.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(333457..333804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(333999..334922) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481319.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 335064..336131 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422647.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(336375..337154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 337454..338275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263663.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 338361..339836 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261701.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 340119..340562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 340643..340996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 341086..341943 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454263.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(341957..342409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(342472..342999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(343072..344820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(344983..345294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(345396..346382) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 347249..348355 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070730.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 348626..348859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(349302..350714) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene nhaC CDS complement(350910..352472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(352855..353226) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261806.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 353482..353991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 353997..355028 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(355075..355866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(355968..356696) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 356948..357301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 357301..357744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 357748..358248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 358296..358700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 358702..359157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 359273..359944 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 360183..361001 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene thiD CDS 361001..361756 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263202.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 361749..362555 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 362574..363512 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 363542..364489 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 364498..365163 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene tenA CDS 365173..365964 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene thiM CDS 365966..366592 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263207.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene thiE CDS complement(366667..367842) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 367989..369116 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(369340..369957) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 370355..371629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(371626..373029) product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 373322..375484 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene glcB CDS 375518..377116 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 377347..378777 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454152.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 378830..379147 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419066.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene yqfB CDS 379453..380043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 380154..380765 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780723.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 380811..381221 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(381271..382245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(382922..384070) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(384962..386947) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489296.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene rnb CDS 387364..387501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 387816..389702 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483383.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 389981..391174 product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 391325..391555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(391507..392700) product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 392822..393565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 393718..395205 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119293.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 395358..395978 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(396029..396550) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(397627..398622) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene add CDS 398865..401420 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene nirB CDS 401435..401758 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460996.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene nirD CDS 401877..402686 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 402859..403620 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480270.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene cobA CDS 403750..404586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 404769..405767 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 406064..406762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 406853..407449 product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183228.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(407506..407688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479943.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(407941..408414) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461979.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(408423..409052) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482658.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(409103..410407) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(410499..411059) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 411138..411617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 411729..412436 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(412521..412949) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480229.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene trxC CDS 413043..414128 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(414193..415896) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 416054..416383 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460911.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 416393..416815 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 416819..417232 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057552266.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(417298..418227) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 418474..420594 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene nrdD CDS 420627..421103 product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene nrdG CDS 421242..422426 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494051.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 422488..423090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 423130..423876 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479390.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene modA CDS 423885..424577 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524683.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene modB CDS 424577..425668 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479305.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene modC CDS complement(425699..426133) product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 426245..427237 product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479405.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 427359..427994 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 428248..428526 product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 428666..430201 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 430213..431592 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272521.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene pntB CDS 431837..433234 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 433209..433874 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 433871..434752 product DUF2861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 434770..434922 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479401.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 435221..435406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(435807..436805) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 436829..437044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(437028..437552) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 437732..438181 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 438627..439508 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(439901..440596) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(440677..440988) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene yciH CDS 441535..442143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(442140..443132) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169444.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(443157..443726) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 443923..446286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 446369..446725 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467110.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(446758..446934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 446849..447682 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(447689..448591) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950819.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(448901..449914) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene galE CDS 450100..450756 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882609.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 450746..451444 product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 451441..452382 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(452670..455120) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645916.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(455123..455830) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 455928..456437 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197502.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene tesA CDS 456441..457643 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 457707..459668 product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 459718..461373 product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 461597..463228 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263560.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 463307..463606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 463603..463947 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene tnpB CDS 464011..465564 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(465670..467115) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene viaA CDS complement(467125..468789) product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106400.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 469118..469576 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463851.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 469609..470613 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene ltaE CDS complement(470682..471956) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479127.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(471998..472576) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(472576..473382) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 473521..474900 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 475002..475727 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(475802..476233) product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261792.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 476570..477964 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263049.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 478591..480399 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001914695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 480457..481545 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 481546..482562 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(482613..482852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 483066..484682 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 484732..486177 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(486155..486487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(486499..486912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(487010..488692) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(488769..488990) product DUF3389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455381.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(488987..489427) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455359.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 489530..490315 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 490410..490979 product PhnA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102406.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(491068..491772) product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 492155..493138 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 493372..494565 product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(494618..494809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(495072..496796) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132206.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 497012..498652 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 498925..499362 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(499433..500002) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(499999..500529) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 500722..501363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454376.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(501367..502113) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 502348..503574 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene gltS CDS complement(503649..505097) product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene gnd CDS complement(505131..505847) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene pgl CDS complement(505844..507346) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene zwf CDS complement(507651..508310) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(508621..508836) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 508914..509855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 509901..510368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(510370..510879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(511108..512688) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene ahpF CDS complement(512870..513745) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(513920..514540) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene ahpC CDS complement(514765..516786) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262939.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 516989..517789 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(517847..518326) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 518632..519675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(520049..521080) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692622.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene tdh CDS complement(521080..522276) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478319.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 522436..523341 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926300.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 523398..524792 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459314.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene ascB CDS 524981..525313 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(525376..526551) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(526548..527171) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263092.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(527180..527584) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236425.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(527595..528149) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(528149..529501) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172871.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(529505..530299) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(530611..531309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 531773..532645 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(532797..533390) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020574.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 533451..533987 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(534014..535759) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(535826..537295) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(537361..537705) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene nirD CDS complement(537775..540312) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene nirB CDS complement(540343..541155) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480270.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene cobA CDS 541580..544084 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(544121..545035) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263715.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(545051..545533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 545769..546089 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 546242..547012 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 547033..547617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(547651..548085) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(548115..548546) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(548725..549783) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422647.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 550094..551062 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 551077..552003 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922243.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 552006..552515 product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 552508..553533 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 553526..554509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 note possible pseudo, internal stop codon, frameshifted CDS 554500..555129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 555164..556450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 556540..556779 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 556907..558151 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene yjeH CDS complement(558168..558515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(558584..559189) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521511.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(559182..559709) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(559789..561030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(561027..561725) product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene cprR CDS 561942..562229 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043846.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(562261..562659) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 562999..563208 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 563316..563849 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(563898..564557) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(564557..565651) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263886.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(565873..566499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 566787..567665 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 567646..568023 product CBU_2076 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(568142..568996) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(569190..569990) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 570297..570677 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(570742..571521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 571908..572864 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 572876..573865 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478115.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 573975..574370 product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(574420..574599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 574628..575335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 575328..577271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 577307..578890 product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106518.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 580430..580693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 580840..581430 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 581434..583896 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(584099..584248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 584526..584825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(585161..586633) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108208.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene ltrA CDS 587330..588244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 588525..588962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 589088..590530 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 590594..591772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 592113..593246 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 593254..594906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433836.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 594903..596708 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491831.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 596701..597105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(597361..598164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(598240..599121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(599135..600904) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262518.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(600921..601754) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(601754..603040) product maltosaccharide ABC transporter permease MalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194993.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene malC CDS complement(603044..604210) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 604662..605699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 605728..606753 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene lpxD CDS 606775..607257 product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 607360..608499 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161697.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 608526..610484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 610656..611849 product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(611911..613791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074238.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(614912..615172) product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(615278..615997) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(616136..617365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 617703..618296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(618386..619732) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 619831..620781 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261930.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 repeat_region 621097..622984 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactgccgcacaggcagcttagaaa CDS 623350..624321 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene cas1f CDS 624318..627629 product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene cas3f CDS 627856..629139 product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene csy1 CDS 629139..630071 product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene csy2 CDS 630089..631075 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene csy3 CDS 631075..631632 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene cas6f repeat_region 631768..632516 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactgccgcacaggcagcttagaaaa CDS complement(632548..633147) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(633170..634174) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964925.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 634812..635348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(635744..636064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(636138..636509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(636525..638078) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(638142..638486) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene tnpB CDS complement(638483..638782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(638853..639443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 note possible pseudo, internal stop codon, frameshifted CDS complement(639470..639970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 note possible pseudo, frameshifted CDS 640080..640778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 640851..641759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(641763..642200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(642477..642917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(642969..646157) product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(646168..648153) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(648247..649011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(649026..652295) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(652304..652540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074351.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 652772..653557 product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 note possible pseudo, internal stop codon CDS 653603..653743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 note possible pseudo, internal stop codon CDS 653834..654013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(654181..655224) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463577.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(655489..656982) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(657082..657465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454342.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 657940..659172 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 659310..660344 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464923.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(660333..661238) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038155721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 661374..662093 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477212.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(662175..662654) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(662664..663737) product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 663875..664291 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483188.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(664302..664799) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483465.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(664810..665391) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(665469..666314) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483416.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(666314..666943) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene dmsB CDS complement(666943..669390) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 669920..671107 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 671275..672393 product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957917.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 672463..672726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 672875..673000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(673089..674288) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(674281..675180) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384671.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(675257..676246) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 676630..676974 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418869.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene yajD CDS complement(677193..677486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(677486..677779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(678037..681015) product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(681019..681984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(681977..682756) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707059.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 683266..684624 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 684902..685489 product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460258.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(685577..687370) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704294.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene edd CDS complement(687374..687895) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919108.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(688239..689240) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 690118..691476 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 691488..692444 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 692456..693220 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 693280..693693 product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705503.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(693814..694644) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132828.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 694833..695723 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462828.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(695747..696934) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479020.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(697016..698083) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105739.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 699097..699819 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460584.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 699816..700586 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460571.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 700611..700871 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457487.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 700884..701144 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460583.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 701145..701714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 701711..703105 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460589.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 703113..703481 product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460551.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 703474..705177 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460598.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 705146..706708 product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 706708..707160 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479006.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 707157..707765 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479021.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 707839..710112 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 710114..710722 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 710749..711930 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 711923..712387 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 712384..713109 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene fabG CDS 713106..714329 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460596.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(714414..715907) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065128.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene gsiB CDS 716349..717293 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene ylqF CDS 717396..717557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 717656..718483 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(718527..719504) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482750.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(719613..723665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(724179..728048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(728062..729030) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261419.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(729030..730019) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(730021..731889) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457989.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(731894..732937) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(732938..733942) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(733973..734857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 735966..736973 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463561.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(736989..737642) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene folE CDS 737818..739062 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene moeA CDS 739066..739815 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477078.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene moeB CDS 739963..740919 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene tal CDS 741054..741263 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(741326..741958) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477224.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(741948..743660) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593383.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene narQ CDS 744338..744643 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 744668..747154 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262391.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene napA CDS 747219..747683 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 747715..748287 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(748496..749689) product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 750045..750197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(750289..751461) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 751576..752130 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262302.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(752178..753986) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480797.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(754105..756249) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(756371..756952) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene hutZ CDS complement(756952..757470) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050752171.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene hutX CDS complement(757485..758825) product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261842.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene hutW CDS 759023..759727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 759738..760409 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479222.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 760406..760825 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 760825..761655 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705468.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 761658..762707 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 762707..763486 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261836.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(763483..764484) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(764557..764904) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462888.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(765038..765445) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 765717..765902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454225.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(766035..767255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(767615..768547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(768553..770007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(770018..770389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(770394..770540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(770537..770902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(770892..771128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(771211..771558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(771560..771727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(771724..772074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(772067..772342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(772966..773256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(773446..773619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(773636..773890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(773963..774337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(776566..777495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(777727..778008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(777950..778099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(778184..779818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(779905..780285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(780282..780662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(780655..780816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 780943..781512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 781632..782321 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 782610..783275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(783277..784116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(784325..785008) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene queC CDS complement(785071..786468) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene clcA CDS complement(787126..790218) product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(790228..791322) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481686.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene nrfD CDS complement(791319..792086) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 792243..794039 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 794049..794672 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 794796..795251 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 795333..795563 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454961.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(795655..797028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(797025..797399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(797492..798382) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene yhfZ CDS complement(798724..800787) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001917927.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene helD CDS 801043..803118 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454352.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene yccS CDS 803133..803780 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(803831..804442) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972734.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 804854..805849 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482880.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 805849..807369 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(807447..807761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(807801..808763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(808837..811362) product LuxQ periplasmic sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026306.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(811366..812469) product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(812466..812753) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463466.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(812766..813404) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 813622..813936 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 814071..814667 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 814720..815427 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261725.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(815416..816363) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263942.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(816480..819080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 819486..819926 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463920.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 819931..821289 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105924.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(821384..821770) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 822049..823818 product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 824187..824942 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(825005..825883) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441905.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(826069..829218) product multidrug efflux RND transporter permease subunit VmeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene vmeZ CDS complement(829224..830348) product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene vmeY CDS complement(830609..831451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(831571..832479) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(832487..833029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 833325..835385 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480125.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(835499..835957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454292.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(836102..836512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(836657..837781) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(837924..838700) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482849.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 838877..839443 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(839504..840850) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(841259..843136) product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene nadN CDS 843512..846190 product GlyGly-anchored extracellular endonuclease Xds inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426028.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene xds CDS complement(846248..847177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(847369..847848) product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713359.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(847855..848598) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(849029..849748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(849863..850699) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263715.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 850890..852272 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483366.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene yegD CDS complement(852352..854190) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 854506..855144 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435225.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(855242..855742) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263568.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(855812..856819) product GlyGly-anchored extracellular serine protease VesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene vesA CDS complement(857195..857767) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene yeiP CDS complement(857840..858901) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391081.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(858988..859416) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 859833..860573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 860727..861374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 861367..862092 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(862143..862751) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261691.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(862820..863938) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene gcvT CDS complement(864077..864712) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 864923..865303 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene gcvH CDS 865465..868332 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478418.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene gcvP CDS complement(868514..869497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(869857..870855) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(871063..872631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(873118..874428) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 874576..875475 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262061.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(875553..876542) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(876922..877752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(878175..878693) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(878833..880236) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882878.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(880211..881020) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(881017..882012) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161523.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(882012..883625) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746573.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(883686..883991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(884167..884958) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 885071..886042 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703850.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(886055..887218) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(887386..888231) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 888459..888773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(888892..889206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(889674..890672) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 890984..891169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(891229..891603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 note possible pseudo, frameshifted CDS complement(891647..892168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 note possible pseudo, frameshifted CDS complement(892288..893202) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263730.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 893364..894224 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 894295..895056 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(895200..896675) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114786309.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(896884..897324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(897646..898770) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 899084..900070 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(900169..900528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(900550..901032) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457113.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 901289..901615 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 901628..903043 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene ccoN CDS 903040..903648 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene ccoO CDS 903648..905804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(905985..906707) product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464873.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(906739..906927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(907037..907921) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 908075..909151 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene hisC CDS 909163..909936 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 910093..910572 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 910569..911204 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477263.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(911205..911804) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014843674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(911874..914690) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(914762..915928) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene lldD CDS complement(915988..917676) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 917817..918716 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(918837..919841) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(919851..920765) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463705.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene rbsK CDS complement(920892..921773) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene rbsB CDS complement(921864..922853) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene rbsC CDS complement(922850..924355) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene rbsA CDS complement(924380..924799) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463700.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene rbsD CDS complement(924973..925632) product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(925811..926149) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(926259..927800) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830660.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(927787..928692) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 929003..929557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 929490..930269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(930279..931175) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482743.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene cyoE CDS complement(931172..932233) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(932240..932797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(932787..933545) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106290.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 933514..933729 product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(933739..934614) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(934611..935222) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(935228..936889) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482647.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene ctaD CDS complement(936889..937947) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene coxB CDS 938410..940071 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(940897..941736) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(941738..942622) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 943119..944057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 944142..946211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(946315..946953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(947500..948321) product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244228.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(948449..949690) product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene lamB CDS 950158..952158 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene glgX CDS 952358..954148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 954207..956069 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 956381..957421 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169035.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene astA CDS 957442..958803 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263665.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene astB CDS complement(959796..960713) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263273.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene aroG CDS complement(960924..961808) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 961923..963065 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993857.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 963214..964407 product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(964421..965566) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261328.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene chrA CDS 965675..966604 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261329.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 966608..967699 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(967799..968587) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263654.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(968685..969773) product DUF6363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(970381..971085) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233685.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(971097..974264) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477456.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene putA CDS 974742..976586 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262804.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 976686..977570 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(978614..979249) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464858.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene pdxH CDS 979427..980893 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 980989..983106 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154355.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(983159..985126) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464868.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(985343..986317) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985780.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(986324..987544) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980