COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2846978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 70..1401 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1417..2517 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2477..3604 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 3871..6288 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene gyrB CDS 6596..7030 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7145..8410) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(8542..10623) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene glyS CDS complement(10626..11555) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene glyQ CDS complement(11917..12165) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005426051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene tusA CDS 12461..13402 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(13448..14431) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(14653..15816) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene fadA CDS complement(15836..18007) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene fadB CDS 18216..18833 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 18841..20298 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 20308..20850 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene hemG rRNA 21350..22900 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 23109..23185 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 23297..23372 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA 23711..26597 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 26720..26830 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 27081..27157 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 27235..27311 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 27450..27938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 note possible pseudo, frameshifted CDS 27958..28485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 note possible pseudo, frameshifted CDS 28564..29040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 note possible pseudo, frameshifted CDS complement(30051..31229) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(31226..32380) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(32380..33126) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(33132..34067) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene hemC CDS 34401..36923 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(36942..37256) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene cyaY CDS 37478..38731 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene lysA CDS 38741..39571 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene dapF CDS 39587..40288 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073966.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 40344..41189 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene xerC CDS 41189..41905 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene yigB CDS complement(41888..42349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(42481..43497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(43532..44353) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(44447..45424) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 45493..46110 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene rhtB CDS 46324..46572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 46618..47625 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 47661..48158 product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 48192..49421 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene arsJ CDS 49485..50498 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(50507..50836) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 51158..51523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 51600..51833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(51908..52087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 52436..54163 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 54253..55806 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 55978..56955 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 56958..57896 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 58084..58512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(58956..60908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(61306..62664) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene gorA CDS complement(62712..63551) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954212.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 63669..65711 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene prlC CDS complement(65759..66220) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465258.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene asnC CDS 66313..67095 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 67183..67686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478648.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(67683..68108) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene uspA CDS 68322..68849 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene ftnA CDS 68927..69250 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene uspB CDS 69364..70551 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(71896..72546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(72543..73859) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 74957..76645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(76571..76909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 77411..78667 product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(78672..79550) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 79842..80624 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132703.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene ubiE CDS 80637..81242 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 81239..82873 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene ubiB CDS 82907..83164 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene tatA CDS 83168..83506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 83552..84295 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene tatC CDS complement(84351..85112) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 85245..86255 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene hemB CDS 86333..86779 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 87115..89916 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene polA CDS complement(90470..91123) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene yihA CDS 91334..91951 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 92898..93548 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 93535..94083 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene yihI CDS 94090..94578 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 94709..96082 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene hemN CDS complement(96130..97539) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene glnG CDS complement(97564..98619) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene glnL CDS complement(98841..100250) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene glnA CDS 100849..102678 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene typA CDS 103042..103956 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 103928..104362 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene dtd CDS 104405..105328 product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(105325..107238) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(107342..108970) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene pckA CDS complement(109446..110315) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene hslO CDS complement(110330..110716) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene hslR CDS 110900..111841 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene gspC CDS 111937..113952 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene gspD CDS 113952..115460 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene gspE CDS 115460..116677 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene gspF CDS 116706..117149 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene gspG CDS 117161..117760 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene gspH CDS 117747..118121 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene gspI CDS 118108..118749 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene gspJ CDS 118805..119788 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene gspK CDS 119757..121007 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene gspL CDS 121007..121507 product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 121507..122280 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 122405..122968 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene nudE CDS 122968..123786 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene cysQ CDS complement(123792..124556) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene bioH CDS 124912..125424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 125580..126170 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene nfuA CDS complement(126243..127475) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459014.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene envZ CDS complement(127647..128366) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene ompR CDS complement(128574..129080) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene greB CDS complement(129107..130921) product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 131231..133555 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(133638..135716) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene recG CDS 136099..136335 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene rpmB CDS 136349..136516 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene rpmG CDS 136741..137229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 note possible pseudo, frameshifted CDS 137249..137776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 note possible pseudo, frameshifted CDS 137818..138561 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene mutM CDS 138558..139562 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(139591..140067) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene coaD CDS complement(140071..141114) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 141207..141911 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(141885..143192) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene waaA CDS 143357..144331 product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 144336..145427 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 145417..146400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 146397..147512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 147493..148686 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 148766..149905 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 149955..150653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(150749..151702) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene lpxM CDS complement(151714..152655) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene rfaD CDS 152825..153964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 153978..155144 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(155270..156604) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene hslU CDS complement(156614..157138) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene hslV CDS complement(157289..157843) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884022.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(157911..158915) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene cytR CDS complement(159107..161308) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene priA CDS 161607..161825 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene rpmE CDS 162020..163285 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(163380..163697) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005432736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene metJ CDS 163883..165046 product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 165049..167457 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465137.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 167644..168531 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene metF CDS complement(168654..169184) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(169564..172194) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ppc CDS complement(172360..173538) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene argE CDS 173672..174688 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene argC CDS 174710..175492 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene argB CDS 175564..176778 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 176832..178706 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene argH CDS 178948..179295 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(179361..180812) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(180953..181681) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 181819..182703 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene oxyR CDS complement(182801..183214) product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(183269..184033) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(184046..185011) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(185018..186376) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(186379..186894) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(187396..190095) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 190228..191079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 191076..191612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 191621..192175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 192177..193313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 193464..193982 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene aroK CDS 194018..195121 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene aroB CDS 195144..196556 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 196624..197445 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 197549..198220 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rpe CDS 198222..198905 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 199038..200060 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene trpS CDS 200175..200765 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 201040..202248 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 202272..203291 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene astA CDS 203315..204778 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene astD CDS 204797..205588 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(205717..206349) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene crp CDS complement(206575..207444) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(207511..207732) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(207742..208731) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(208728..209192) product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(209189..211108) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 211228..211824 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene kefG CDS 211811..213622 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene kefB CDS 213612..213809 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 213896..214447 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene slyD CDS complement(214586..214828) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 215230..216045 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene fkpA CDS 216207..216932 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 216933..217325 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene tusD CDS 217322..217678 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene tusC CDS 217681..217956 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene tusB CDS 218153..218527 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene rpsL CDS 218643..219113 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rpsG CDS 219252..221345 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261077.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene fusA CDS 221493..222677 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene tuf CDS 223102..223413 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene rpsJ CDS 223428..224057 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rplC CDS 224074..224676 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene rplD CDS 224673..224975 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene rplW CDS 224991..225815 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene rplB CDS 225835..226113 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rpsS CDS 226124..226456 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene rplV CDS 226473..227171 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene rpsC CDS 227183..227593 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene rplP CDS 227593..227784 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene rpmC CDS 227784..228038 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene rpsQ CDS 228203..228574 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene rplN CDS 228586..228903 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene rplX CDS 228927..229466 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rplE CDS 229484..229789 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene rpsN CDS 229819..230211 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455656.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rpsH CDS 230222..230755 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene rplF CDS 230765..231118 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene rplR CDS 231133..231633 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene rpsE CDS 231639..231815 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene rpmD CDS 231821..232255 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rplO CDS 232276..233610 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene secY CDS 233911..234267 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene rpsM CDS 234286..234675 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene rpsK CDS 234707..235327 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene rpsD CDS 235352..236344 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene rpoA CDS 236371..236751 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene rplQ CDS complement(237030..237527) product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(237666..238934) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(239081..239701) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 239978..240562 product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(240577..241035) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 241220..242053 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene cobA CDS complement(242109..242600) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(242611..243870) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(243867..244586) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(244652..245401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(245560..246123) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(246186..246821) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene msrA CDS 246959..248683 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 248683..252522 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 252544..252888 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 252936..253451 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(253448..254464) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene fbp CDS 254684..256048 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene mpl CDS 256039..256668 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(256743..258119) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 258417..261323 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene rapA CDS 261337..262074 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261089.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene rluA CDS 262084..263052 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(263198..263635) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(263708..266281) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(266526..267494) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(267928..268398) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005430583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene argR CDS 268696..269631 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene mdh CDS complement(269804..270775) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene ispB CDS 271046..271357 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene rplU CDS 271377..271634 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene rpmA CDS 271994..273160 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene cgtA CDS 273227..274315 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706870.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 274437..275204 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 275201..275677 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 275691..276173 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459612.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene folA CDS 276203..277147 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 277229..277813 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(277844..278647) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(278661..279041) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene apaG CDS complement(279072..279875) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene rsmA CDS complement(279872..280858) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459624.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene pdxA CDS complement(280848..282161) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene surA CDS complement(282210..284669) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene lptD CDS 284818..285672 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene djlA CDS 285702..286244 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(286241..287020) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(287235..287837) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene leuD CDS complement(287849..289255) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene leuC CDS complement(289315..290406) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene leuB CDS complement(290474..292024) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene leuA CDS 292431..293093 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 293097..294422 product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 294419..297529 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 297666..298223 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 298225..299283 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 299652..300617 product LysR family transcriptional regulator CalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene calR CDS 300840..302681 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 302866..303051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 303131..304852 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 304854..305348 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene ilvN CDS complement(305957..307369) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene pykF CDS 308050..308967 product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162797566.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(308975..310264) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 310617..311624 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(311696..313492) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene edd CDS complement(313489..314010) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(314392..315594) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 315706..316638 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(316719..317930) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(317923..318822) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(318890..319879) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 320344..321666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 321981..322793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 322802..323230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 323230..323916 product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene bfmR CDS 323938..325239 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144045444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(325299..325754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(325777..326553) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464165.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 327028..327630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 tRNA complement(327828..327903) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(328056..329897) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rpoD CDS complement(329994..331757) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene dnaG CDS complement(331846..332289) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(332315..332530) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene rpsU CDS 332752..333768 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene tsaD CDS complement(333822..334415) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene plsY CDS 334588..334947 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361952.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene folB CDS 334944..335450 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465890.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene folK CDS 335450..336253 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(336294..337526) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 337708..339339 product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 339339..340256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(340298..340909) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(341066..342331) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479165.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(342376..343056) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 343244..344761 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 344880..347732 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene glnE CDS 347815..349245 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene hldE CDS complement(349500..350819) product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene vpoC CDS 351072..351710 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene nudF CDS 351689..352129 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 352176..352982 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene cpdA CDS 353065..353577 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene yqiA CDS 353911..355791 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457157.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene parE CDS 355794..358040 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene parC CDS complement(358160..359251) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490480.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene degS CDS complement(359352..360722) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(360833..361267) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene zapG CDS 361387..362499 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene zapE CDS 362762..363190 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene rplM CDS 363206..363598 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rpsI CDS 363912..364517 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420954.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene petA CDS 364517..365779 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 365779..366516 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 366601..367236 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene sspA CDS 367236..367727 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene sspB CDS complement(367949..368728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(368757..369347) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(369350..369718) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(369702..371528) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 371591..372454 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene rsmI CDS complement(372670..372951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 372982..373287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 373227..373589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 note possible pseudo, frameshifted CDS complement(373787..374590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(374654..375544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(375558..377327) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(377344..378177) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(378177..379463) product maltosaccharide ABC transporter permease MalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene malC CDS complement(379467..380633) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 381083..382120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 382149..383174 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene lpxD CDS 383196..383678 product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 383781..384920 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002353714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 385139..385318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 385732..386682 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene rsmH CDS 386679..387017 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene ftsL CDS 387014..388771 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 388843..390267 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene murE CDS 390264..391625 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 391622..392704 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene mraY CDS 392708..394036 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene murD CDS 394178..395338 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ftsW CDS 395358..396398 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene murG CDS 396428..397888 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene murC CDS 398014..398784 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 398786..400060 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene ftsA CDS 400090..401298 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene ftsZ CDS 401392..402309 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene lpxC CDS complement(402553..402780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(402835..403005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 note possible pseudo, frameshifted CDS 403289..406018 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene secA CDS 406094..406501 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene mutT CDS 406572..407381 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461189.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene dapB CDS 407836..408975 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene carA CDS 408992..412222 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene carB CDS 412613..413404 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(413442..414062) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(414062..414763) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene mtnN CDS complement(414840..415274) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(415676..417145) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(417148..421728) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene gltB CDS 422220..423164 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 423275..425644 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene arcB CDS 425695..426159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(426396..427112) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene arcA CDS complement(427505..428017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 428428..430887 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene thrA CDS 430890..431852 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene thrB CDS 431849..433129 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene thrC CDS 433439..433597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(433670..433942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(433947..434372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(434369..434833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(434849..435127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(435439..435735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(435787..436140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 436773..437288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 437615..437758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 437993..439465 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene ltrA CDS complement(439903..440280) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene grcA CDS 440599..441450 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene nfo CDS 441703..442383 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene ung CDS 442454..443011 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(443070..443258) product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 443687..445141 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 445274..446047 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene yaaA CDS 446063..446602 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(446740..447960) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene srmB CDS complement(448035..448760) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 449066..450370 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene brnQ CDS 450798..451742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 451848..452438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(452674..452967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 453069..453506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 453516..454118 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(454581..455054) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene fldB CDS 455235..456128 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene xerD CDS 456175..456915 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene dsbC CDS 456984..458723 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene recJ CDS 459037..459939 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene prfB note possible pseudo, frameshifted CDS 459952..461457 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene lysS CDS complement(461509..461952) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 462241..463443 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 463581..464633 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene queA CDS 464832..465965 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene tgt CDS 466107..466442 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene yajC CDS 466465..468318 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene secD CDS 468333..469280 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene secF CDS 469369..469803 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene fkpB CDS 470013..470957 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene ispH CDS complement(471039..472490) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 472708..473052 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883835.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(473280..474821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(475069..475971) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene murQ CDS complement(475980..477098) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 477193..478182 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene nagZ CDS complement(478156..478881) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene btsR CDS complement(478874..480559) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 480959..482059 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 482071..483201 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477896.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene tyrA CDS complement(483345..485012) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene ettA CDS 485228..487150 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene sltY CDS 487183..487479 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene trpR CDS complement(487515..488030) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene yjjX CDS complement(488044..489225) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene pheA CDS complement(489353..489706) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene raiA CDS complement(489952..491409) product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(491496..492245) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 492364..493338 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rluD CDS 493338..494060 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene pgeF CDS 494150..496726 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene clpB rRNA 497279..498844 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 498972..499047 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 499050..499125 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 499161..499236 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 499272..499347 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 rRNA 499821..502707 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 502867..502977 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA 503048..503124 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(503641..504492) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(504495..504950) product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(505111..505365) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(505369..506727) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene yegQ CDS complement(506868..507776) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rdgC CDS 507976..508647 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene phoB CDS 508684..509997 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene phoR CDS 509994..510947 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 511092..513284 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 513299..514981 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene pstA CDS 514971..515789 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene pstB CDS 515805..516518 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440349.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene phoU CDS complement(516671..517279) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 517563..518384 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 518509..518826 product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(518838..519509) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene mutH CDS 520124..520642 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rppH CDS 520655..522907 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ptsP CDS 522907..523704 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 523726..524553 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene lgt CDS 524550..525401 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 525514..526509 product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(526586..527734) product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 528080..528970 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene nhaR CDS 529166..529354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(529452..529712) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rpsT CDS 530014..531573 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene murJ CDS 531695..532624 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene ribF CDS 532733..535564 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ileS CDS 535557..536081 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene lspA CDS 536264..536599 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene secG tRNA 536616..536699 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 536752..536828 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 537116..537571 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rimP CDS 537595..539085 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene nusA CDS 539106..541793 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene infB CDS 541866..542297 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rbfA CDS 542297..543250 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene truB CDS 543442..543711 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene rpsO CDS 544289..546412 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene pnp CDS 546574..547443 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene nlpI CDS complement(547547..548425) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(548439..549452) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 549631..550182 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 550172..550675 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 550683..551084 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 551077..551520 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rimI CDS 551797..553431 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene hcp CDS 553501..554484 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263681.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 554615..556204 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene prfC CDS 556507..557292 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 557474..558718 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 558899..559069 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 559275..560051 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456105.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene deoC CDS 560131..561465 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene deoA CDS 561479..562699 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 562775..563494 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene deoD CDS complement(563631..564194) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481596.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 564303..565220 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene serB CDS 565220..566596 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene radA CDS 566786..568870 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene fusA CDS 568990..570261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(570178..570945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 570944..571129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(571235..572908) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 573132..573293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 573417..573590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 573669..574187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 574206..575528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 575525..576256 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene cpaB CDS 576265..577728 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 577745..577984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 578007..579263 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 579266..579694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 579691..580197 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 580230..581444 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 581459..582907 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 582919..583884 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 583887..584831 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 584847..585881 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 586514..586708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 587548..588618 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene galM CDS 588891..590198 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(590437..591468) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene dapD CDS complement(591756..592049) product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(592133..593038) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482339.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 593144..594109 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 594166..597615 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene recC CDS 597881..601465 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene recB CDS 601465..603630 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene recD CDS complement(603634..604953) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene argA CDS 605154..606245 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene mltA CDS 606346..607158 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene tcdA CDS 607171..607596 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene csdE CDS complement(607609..608826) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095477927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene csdA CDS complement(608819..609424) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(609414..610304) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene panE CDS complement(610420..611229) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 611518..612087 product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 612112..613485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 613530..614117 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 614114..614782 product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 616425..617492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 617527..620646 product GlyGly-anchored extracellular endonuclease Xds inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene xds CDS 620712..623315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(623576..624961) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(625042..625587) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(625584..626159) product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456550.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(626253..627257) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 627614..627916 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 628235..629611 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 629615..630856 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 630846..631613 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 631613..632245 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 632253..632849 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene nqrE CDS 632873..634099 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene nqrF CDS 634321..635355 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 635365..635598 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091359.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene nqrM CDS complement(635729..636976) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105062851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 637363..637749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 638031..638150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(638222..638671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 638833..639915 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene dinB CDS 639981..640754 product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 641039..641248 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(641408..641599) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(641603..641806) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(641892..643607) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(643690..644388) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene tsaA CDS 644899..646488 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(647428..648237) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(648265..648942) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(648932..649966) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene metN CDS 650147..650701 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene gmhB CDS complement(650778..651377) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 651697..652947 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(653007..653501) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(653626..653955) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(654079..655044) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene lipA CDS complement(655037..655729) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene lipB CDS complement(655902..656171) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene ybeD CDS complement(656342..657523) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(657657..658439) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(658439..659560) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene rodA CDS complement(659557..661455) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene mrdA CDS complement(661462..661932) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene rlmH CDS complement(661936..662253) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene rsfS CDS complement(662308..663318) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene holA CDS complement(663328..664059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(664172..666748) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene leuS CDS complement(667021..670143) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(670146..671297) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 671853..672326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 672720..673316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(673453..673743) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(673733..673981) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 674056..674214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 674567..675127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(675199..675939) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 676199..676669 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(676739..678280) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene lnt CDS complement(678334..679230) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene corC CDS complement(679290..679754) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene ybeY CDS complement(679755..680861) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(680933..682318) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene miaB CDS 682672..683829 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 tRNA complement(684056..684140) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(684212..684288) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(684325..684409) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(684508..684582) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(684618..684702) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(684872..684946) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(684982..685066) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(685236..685310) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(685346..685430) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(685530..685604) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(685640..685724) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(685796..685872) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(686024..686098) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(686107..686191) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(686234..686310) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(686625..687716) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene ychF CDS complement(687727..688317) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene pth CDS complement(688485..689432) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(689459..690328) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ispE CDS complement(690325..690951) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261468.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene lolB CDS 691068..692324 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene hemA CDS 692341..693429 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene prfA CDS 693432..694298 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene prmC CDS 694289..694672 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 694675..695484 product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 695509..696360 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene kdsA CDS 696473..698128 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809002.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene ushA CDS 698143..698616 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481362.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene ybaK CDS complement(698639..699223) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 699331..699774 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(699849..700850) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene rluF CDS complement(700868..701410) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene smrA tRNA 701838..701914 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 702344..703327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 703654..703938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 note possible pseudo, frameshifted CDS 703953..704690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 note possible pseudo, frameshifted CDS complement(704633..705430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 note possible pseudo, frameshifted CDS complement(705451..705717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 note possible pseudo, frameshifted CDS 706007..706582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 706645..707592 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 707656..707943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 note possible pseudo, frameshifted CDS 707906..708301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 note possible pseudo, frameshifted CDS complement(708382..708564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(708770..709300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(710348..710899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(710911..711561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(711596..711919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(711942..712955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 713522..714145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 714324..714884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(715157..715963) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(716179..717237) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 718786..719478 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(719532..720356) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 720576..722003 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene gltX CDS complement(722234..723652) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 724170..725471 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene tig CDS 725583..726206 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene clpP CDS 726274..727551 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene clpX CDS 727798..730158 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene lon CDS 730337..730612 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 730769..732625 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene ppiD CDS 732786..733091 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021449594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(733218..733763) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rrtA CDS 733862..734383 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(734380..735708) product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(735708..736295) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene yfbR CDS complement(736352..737566) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 737743..739098 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 739095..740810 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene menD CDS 740813..741622 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene menH CDS 741670..742665 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene menC CDS 742738..744120 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene menE CDS 744374..744586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(744625..745548) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 745791..746696 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(746852..748495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(748631..749578) product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 749953..750261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 750346..750639 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155655847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(750757..752892) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene pta CDS complement(752990..754186) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 754517..754969 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene yfbV CDS 755434..756399 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 756469..757386 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 757383..758177 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(758286..759242) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene dusC CDS 759399..760001 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(760126..760653) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene dsbB CDS complement(760870..762465) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene nhaB CDS 763061..763900 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene fadR CDS 764105..764374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 765047..765343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(765569..767794) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(767869..768801) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(768862..769068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 note possible pseudo, internal stop codon CDS complement(769435..770250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 note possible pseudo, internal stop codon, frameshifted CDS 770896..771333 product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(771428..772309) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 772284..772481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(772576..773514) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 773620..774648 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 775259..776410 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 776503..777114 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(777222..778451) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(778448..779173) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene fabG CDS complement(779170..779634) product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(779627..780811) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(780825..781508) product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(781508..783817) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(783819..784454) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(784456..784899) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(784899..786452) product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(786433..788145) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(788147..788506) product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(788521..789921) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(789927..790487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(790487..790744) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(790764..791024) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(791042..791806) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(791803..792636) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 792809..793876 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(794133..794969) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 795362..795940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(796056..796661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 796984..797565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(797634..798095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 798405..798983 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(799288..800265) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(800481..801347) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 801445..802509 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 802519..803535 product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 803526..804770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 804900..805916 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene lplA CDS 806025..806372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(806662..808137) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(808154..809497) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 809825..810571 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 810588..811145 product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene puuR CDS 811181..812665 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017820916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 812693..813970 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 813992..814858 product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene aguB CDS 814869..815951 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene aguA CDS 816059..817486 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 817502..818773 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene gabT CDS 819216..820352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 820342..821256 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 821260..822045 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 822263..822541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(822761..824956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 825819..827258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 827324..828427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 828445..830955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 830988..832451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(833050..833847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 note possible pseudo, frameshifted CDS complement(833868..834134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 note possible pseudo, frameshifted CDS 834465..835976 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138360839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene istA CDS 835987..836727 product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene istB CDS complement(836999..838906) product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016255537.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(841560..842801) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(842815..843132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 843443..843718 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(843932..844120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(844470..844856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 tRNA complement(844936..845026) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(845303..845379) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(845380..847179) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(847205..847420) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 847505..848506 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene yejK CDS 848688..849809 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263690.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene asd CDS complement(850016..850903) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(851013..851654) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 852254..854926 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene adhE CDS complement(855062..855739) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 856048..857067 product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(857648..858232) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene sodB CDS 858576..858908 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(858987..860312) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(860340..860984) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130223.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene rnt CDS complement(861186..861602) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene gloA CDS complement(861641..862276) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene nth CDS complement(862300..862992) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(862992..863621) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rsxG CDS complement(863626..864675) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rsxD CDS complement(864675..867458) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene rsxC CDS complement(867464..868045) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene rsxB CDS complement(868045..868626) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene rsxA tRNA complement(868963..869038) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 869539..871584 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene uvrB CDS 871625..873028 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 873021..873371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(873368..874264) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 874596..875585 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene moaA CDS 875640..876152 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene moaB CDS 876159..876638 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene moaC CDS 876635..876880 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene moaD CDS 876882..877331 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene moaE CDS 877863..879491 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 879573..880505 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene oppB CDS 880520..881422 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene oppC CDS 881443..882420 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 882417..883418 product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene oppF CDS complement(883484..884161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(884587..885429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 885714..886184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 886474..886746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 887363..888619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 888689..890068 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 890146..890778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(890985..891164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 891469..891723 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 891716..891985 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 892075..892488 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(892860..893984) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 894265..894639 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 tRNA complement(894696..894780) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(894861..894945) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(895026..895110) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(895191..895275) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(895356..895440) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 895810..896838 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 896838..899948 product vibriobactin export RND transporter permease subunit VexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene vexH CDS complement(900071..900478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 900791..901108 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481865.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(901357..902421) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 902551..903018 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(903084..904517) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene putP CDS complement(904724..905581) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene tesB CDS 905739..906176 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(906212..906514) product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 906574..907308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 907685..909160 product gamma-mobile-trio recombinase GmtY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene gmtY CDS 909157..911745 product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 911738..912376 product gamma-mobile-trio protein GmtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene gmtX CDS complement(912368..912655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(913162..916308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(916298..916840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(916827..918062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(918059..919117) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238828.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(919492..920907) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(920904..921446) product transcriptional regulator VspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901324.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene vspR CDS 921548..921760 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(921783..922343) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028006006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 922518..923225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 923269..923976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(924056..924196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(924199..924342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 924418..925512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 926192..928633 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 928913..929902 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 929991..931478 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 931478..933238 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 933241..934587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 934580..936583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 937037..937852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(938264..939319) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 939722..940690 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 940705..941637 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 941805..942197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 942190..943215 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 943208..944188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 944182..944910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 944897..946285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 946395..947327 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 947539..948765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 948850..949635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(949690..950313) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(950399..950905) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(951194..952081) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 952274..953251 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(953517..954215) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 954474..954947 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(955116..956060) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354569.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 956164..956559 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181837.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 956559..957242 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(957304..958548) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene yjeH CDS complement(958607..958858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(958937..959947) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 960084..961301 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 961348..962481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 962758..966957 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene fdhF CDS complement(967259..968731) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene ltrA CDS complement(968966..969109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(969394..969918) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263861.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(969931..970854) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(971209..972255) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rsgA CDS complement(972333..973178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(973290..974111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(974543..975343) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene kdgR CDS 975823..976347 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(976448..977890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(977901..978464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(978478..978963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 979656..980558 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene metR CDS 980712..981605 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(981723..982904) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(983276..983851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(984080..984982) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 985177..986643 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(986705..987760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(987750..988961) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 989293..989709 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 990029..990739 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene udp CDS complement(991057..992217) product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 992439..992789 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene hinT CDS 992882..994192 product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 994192..994581 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 994591..995181 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene lpoB CDS 995440..995979 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ycfP CDS 996320..997609 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(997759..998535) product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(998699..1002175) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481852.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene mfd CDS 1002155..1002340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1002465..1003589 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468890.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene lolC CDS 1003582..1004277 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene lolD CDS 1004277..1005518 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene lolE CDS complement(1005698..1006225) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1006555..1008570 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 1008603..1010351 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene msbA CDS 1010430..1011353 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053055813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene lpxK CDS 1011343..1011522 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 1011524..1012276 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene kdsB CDS complement(1012389..1013915) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1013939..1015207) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1015337..1017271) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456210.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1017501..1018217 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(1018236..1018736) product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(1018805..1019539) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene pflA CDS complement(1019648..1020655) product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1020781..1023057) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene pflB CDS complement(1023420..1024955) product DUF3360 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1025572..1026342 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1026421..1027197 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1027356..1028096 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1028099..1028782 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1028846..1029658) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene xthA CDS complement(1029739..1029918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1029918..1030466) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1030476..1031255) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1031273..1033342) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene dinG CDS 1033878..1034942 product porin OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene ompT CDS 1035159..1036607 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene glgA CDS complement(1036717..1038087) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene purB CDS complement(1038230..1038847) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene hflD CDS complement(1038865..1039995) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene mnmA CDS 1040160..1040423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1040535..1041077) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1041521..1043749 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1044255..1045025) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1045479..1045820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1046045..1047517) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene ltrA CDS complement(1047752..1047895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1048231..1050456 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1050907..1052331) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene arcD CDS 1052623..1053426 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1053512..1054168) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1054466..1054696 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423709.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1054925..1055146) product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene cspD CDS 1055589..1055909 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene clpS CDS 1055966..1058236 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene clpA CDS complement(1058466..1058684) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene infA CDS complement(1058755..1059453) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1059506..1060213) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene aat CDS 1060220..1060675 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1060793..1062070 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene aroA CDS complement(1062261..1063067) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1063236..1063481) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1063725..1066361 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene topA CDS 1066544..1067848 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1068246..1068662) product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1069409..1070992 product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene tet(35) CDS 1071303..1072199 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene hisG CDS 1072203..1073498 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene hisD CDS 1073530..1074582 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene hisC CDS 1074609..1075682 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene hisB CDS 1075692..1076312 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene hisH CDS 1076343..1077080 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hisA CDS 1077118..1077891 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene hisF CDS 1077888..1078523 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene hisIE CDS complement(1078595..1079401) product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1079607..1080095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1080185..1080568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1080776..1081480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1081590..1082309) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene lpxH CDS complement(1082371..1082865) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1082952..1084403 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene cysS CDS 1084486..1085064 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1085195..1086166) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1086171..1087676) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1087707..1088459) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1088591..1089565) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene cmoB CDS 1089868..1090773 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1091041..1091829) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1091826..1092821) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1092821..1093708) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1093695..1094657) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1094657..1096294) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene sapA CDS complement(1096366..1097355) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene pspF CDS 1097683..1098345 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462360.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene pspA CDS 1098358..1098585 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene pspB CDS 1098585..1098968 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene pspC CDS complement(1099069..1099737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1100038..1100739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1100965..1101993 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1101990..1103084 product efflux RND transporter periplasmic adaptor subunit VmeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene vmeH CDS 1103081..1106179 product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene vmeI CDS 1106289..1106849 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1106905..1108452) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene norR CDS 1108656..1109441 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1109757..1111286 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene norV CDS 1111286..1112428 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene norW CDS 1112767..1113372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1113439..1113678) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1113950..1114165 product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1114181..1114591 product ribosome recycling factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1114708..1114998) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921421.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1115263..1116405) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1116487..1117011) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1117168..1118376) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1118459..1119913) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene cls CDS 1120159..1120848 product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1120845..1121795 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1121892..1122305) product GspS/AspS pilotin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1122308..1122604) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1122615..1123025) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene yciA CDS complement(1123022..1123564) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 1123851..1124477 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1124664..1124900 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1125063..1126379) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1127001..1127210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1127467..1127919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454292.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1128060..1128416 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1128475..1128852 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1129222..1130028) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene trpA CDS complement(1130028..1131218) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene trpB CDS complement(1131272..1132663) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene trpCF CDS complement(1132666..1133664) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene trpD CDS complement(1133677..1134279) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1134272..1135849) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1136235..1137095 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1137120..1137740 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 1137897..1138787 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene rluB CDS 1139055..1139399 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1139411..1140574 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1140792..1140995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1141018..1141668 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1141674..1142336 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1142339..1142692 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1142749..1143564 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1143568..1144533 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1144629..1145591 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075549536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1145787..1146971 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1147099..1148019 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1148409..1149374 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1149570..1151054 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1151164..1151292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1151540..1152277 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1152803..1153645) product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1153647..1156616) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1157014..1158585 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1158715..1159914) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene gltS CDS complement(1160125..1160430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1160480..1161100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1161307..1162245 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1162262..1162795) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1162813..1163004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1163003..1163974 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1164257..1165426) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1165785..1168802 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1168857..1169813 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1169874..1170704) product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1171240..1171629) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1171674..1173278) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151653465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1173535..1174119 product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091021504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1174162..1174653) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1174751..1175908 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1175960..1176280) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1176340..1178742) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1179076..1179720 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene uvrY CDS 1179720..1181552 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene uvrC CDS 1181629..1182180 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene pgsA tRNA 1182489..1182562 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1182581..1182656 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1182934..1183020 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1183050..1183125 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 1183302..1183388 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 1183420..1183495 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 1183518..1183591 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 1183608..1183683 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1184144..1187074 product pyridoxal phosphate-dependent class III aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1187087..1188334 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1188407..1189537 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene nspC CDS 1189762..1190061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1190264..1190668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1190992..1191648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1192206..1192466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1192680..1192952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1193140..1193445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1193597..1194007 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1194007..1195260 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1195528..1197483 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1197493..1197957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1198167..1198985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1199255..1199914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1199899..1200387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1200616..1202238 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1202387..1204006 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189730977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(1204149..1204595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1204667..1206409) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1206601..1206777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1206951..1207745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1207699..1208436) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1208429..1209379) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1209376..1210113) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1210106..1210993) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1211040..1212065) product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1212119..1212328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1212871..1214088 product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1214076..1214729 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene cbiC CDS 1214734..1215987 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649057.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1215980..1216780 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene cobI CDS 1216780..1218447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1218478..1219326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1219323..1220141 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene cobM CDS 1220134..1221507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1221497..1222480 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene cbiB CDS 1222483..1223553 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene cobD CDS 1223622..1225088 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1225102..1226460 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1226457..1227068 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene gpmB CDS complement(1227070..1227801) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1227970..1228485) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1228756..1229958 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1230303..1230566) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1230823..1232016 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1232078..1232929) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1233162..1234811) product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene panP CDS complement(1234919..1235431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1235544..1236299) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1236826..1237404 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1237675..1238778) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1238919..1239284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1239419..1239604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1239834..1240547) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1240689..1243736 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1243845..1244552) product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1244906..1246834 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene thrS CDS 1247003..1247392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1247496..1247690 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001885060.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene rpmI CDS 1247733..1248086 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rplT CDS complement(1248164..1248646) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1249246..1250331) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1250688..1251671 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene pheS CDS 1251689..1254076 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene pheT CDS 1254204..1255499 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1255588..1255779 product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1256231..1257205) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1257379..1257792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1258118..1258495 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1258535..1258936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1259184..1259705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1259828..1260427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1260856..1261239 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene ihfA CDS complement(1261320..1262510) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene purT CDS complement(1262656..1263549) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454956.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene cdd CDS complement(1263727..1264404) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1264406..1264768) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1264773..1266188) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene sbcB CDS complement(1266594..1270976) product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene sslE CDS complement(1271819..1272493) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1272596..1273621 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1273618..1274784) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1275292..1276551 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene glgC CDS complement(1276579..1277859) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1278029..1279120) product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263256.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1279155..1280300) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263255.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1280344..1281303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1281535..1281984) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1282235..1282642 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1282675..1283685 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1283704..1284708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1284869..1286458 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rmuC CDS 1286565..1287089 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1287216..1288862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1288985..1289668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1290170..1290745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1291007..1292224 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene sbcD CDS 1292224..1295910 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1296206..1296778 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1296973..1298097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1298205..1298915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1299153..1300073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1300098..1301267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1301264..1302337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1302579..1303205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1303215..1303655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1303655..1304272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1304662..1306242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1306239..1307375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1307730..1308401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1308873..1309244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1309244..1311259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1311430..1312467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1312983..1313297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1313415..1313792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1314166..1315206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1315317..1315961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1316044..1316304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1316523..1317167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1317375..1317749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1317746..1318075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 tRNA complement(1318581..1318657) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1318694..1318770) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 1319101..1320111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1320231..1321604 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1321720..1322394 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1322926..1323915 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1323982..1324644) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene hxpB CDS 1324846..1325673 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1325689..1327059) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1327219..1327830 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1327827..1328030) product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1328057..1328929) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1329072..1329578) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453841.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1329578..1330363) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1330442..1331164 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001900033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1331293..1334697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1334817..1335140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1335271..1336179 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene nagK CDS 1336603..1336986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1337157..1337417) product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1337453..1338337) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1338339..1340693) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1340879..1341589 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105862.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene cobB CDS complement(1341631..1342107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1342243..1343187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1343212..1343379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1343561..1344412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625981.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1344423..1345073 product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 1345295..1346200 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene ttcA CDS complement(1346273..1347151) product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1347163..1348470) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1348467..1349054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1349257..1350333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1350345..1350992) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1351205..1351543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1351552..1352862 product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089468.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1352866..1354404 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1354556..1355233 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1355393..1356271 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1356341..1357291) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene uspE CDS complement(1357466..1358218) product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1358327..1358989) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1358986..1359162) product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene ccoS CDS complement(1359083..1361527) product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1361524..1362009) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1362085..1363065) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene ccoP CDS complement(1363065..1363238) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1363248..1363868) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene ccoO CDS complement(1363880..1365310) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene ccoN CDS 1365566..1365934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1366183..1371423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1372073..1373545) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene ltrA CDS complement(1373780..1373923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1374219..1375382) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1375544..1376500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1377450..1377749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1377774..1378223) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene matP CDS 1378448..1380091 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001965088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1380159..1380689 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene fabA CDS complement(1380931..1381104) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rmf CDS complement(1381437..1383410) product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1383417..1385330) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1385308..1385547) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1385547..1387685) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene rlmKL CDS complement(1388200..1388742) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1388947..1389957) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene pyrD CDS complement(1390004..1394848) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1395119..1397722) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481930.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene pepN CDS complement(1397943..1398602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1398760..1400766) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650135.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene prc CDS complement(1400785..1401417) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene proQ CDS complement(1401517..1401990) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1402232..1403449 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1403446..1406091 product MCE family putative adhesion factor MAM7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene mam7 CDS 1406187..1407617 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene rsmF CDS complement(1407796..1408632) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1408774..1409643) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1409905..1410957 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1410968..1411450 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1411589..1412023) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480229.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene trxC CDS complement(1412133..1413086) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457118.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1413528..1414556 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1414633..1415835 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1415837..1416934 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1416951..1417700 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1417911..1418573 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1418670..1418999 product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1419021..1419293) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene yccX CDS complement(1419356..1419967) product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1420259..1421446 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1421605..1425996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1426252..1427556 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1427558..1428154 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423894.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1428345..1428695 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1428754..1429560 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1429622..1430101) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1430085..1430711) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1430853..1431560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1431572..1431730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1432191..1433579 product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1433798..1434571) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263787.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1434568..1435617) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263788.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1435614..1436513) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1436746..1437285 product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1437282..1437911) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1437989..1439470 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1439591..1440475 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1440490..1441089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1441089..1441652 product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1441704..1445423 product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene brxC CDS 1445496..1449251 product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene pglX CDS 1449381..1450523 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1450526..1451272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1451276..1454050 product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene pglZ CDS 1454063..1456135 product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene brxL CDS complement(1456387..1457184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 note possible pseudo, frameshifted CDS complement(1457205..1457471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 note possible pseudo, frameshifted CDS complement(1457898..1459061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1459131..1459370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1459480..1459632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1459729..1460742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1460801..1461787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1461846..1462286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1462667..1463620) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1463859..1464407) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071296.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene cobU CDS complement(1464404..1465225) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071295.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1465299..1466348) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene cobT CDS complement(1466404..1467162) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071291.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1467625..1468599) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1469118..1469609) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1469684..1473520) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene hrpA CDS complement(1473735..1475213) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1475253..1475984) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1476082..1476531 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1476597..1477184) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1477289..1477921 product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1477921..1479765 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1479846..1482671 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 1482879..1484033 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene msrB CDS complement(1484202..1484684) product DUF2947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1484677..1485267) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1485255..1485848) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene rimJ CDS complement(1485853..1487397) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483314.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene tyrR CDS complement(1487490..1488632) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1488637..1490007) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1490080..1490265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1490415..1491932) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1492094..1493455 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene pabB CDS 1493543..1494154 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1494271..1495671 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene asnS CDS 1495862..1497052 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1497117..1497761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1497939..1499816 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1499821..1500555 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1500650..1500964) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene yqfB CDS complement(1501038..1502609) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1502718..1504007) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1504004..1504525) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1504604..1505692) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1506037..1506519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1506588..1507226) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1507289..1507840) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1507957..1509555) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1509740..1510336) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1510728..1513385) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene gyrA CDS 1513652..1514359 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1514896..1517178 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene nrdA CDS 1517249..1518382 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene nrdB CDS 1518427..1518708 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene yfaE CDS complement(1519060..1519407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1519555..1520823) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1521014..1521904 product DUF3943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1521970..1524258) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1524286..1524912) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1525424..1526584) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene nhaA CDS complement(1527359..1528363) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1528484..1530937) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1530918..1531589) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1531747..1533198 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1533222..1533974) product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462414.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1533968..1535164) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1535195..1535893) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rsuA CDS 1536079..1537815 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 1537993..1538271 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene rplY CDS complement(1538504..1538716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1538798..1539334) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1539470..1540366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1540601..1540843 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1540852..1541151 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1541307..1541609) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1541597..1541854) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1542569..1542826) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105788.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1542984..1543466 product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1543486..1543872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1544334..1546022 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1546088..1546813 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1546939..1547895 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene trxB CDS 1548004..1549776 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261563.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene cydD CDS 1549769..1551508 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene cydC CDS complement(1551573..1552586) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1552689..1553606 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1553831..1554919) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400868.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene serC CDS complement(1555069..1556334) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1556499..1558430 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489098.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1558445..1558942 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 1559132..1559671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1559837..1560037) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420090.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1560024..1560203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1560137..1560829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967009.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1560884..1562071) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1562199..1564523 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1564607..1567117) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1567370..1568020 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1568474..1569646 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene sstT CDS 1569904..1571292 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1571624..1572514 product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1572647..1574608 product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene cpdB CDS complement(1574756..1575709) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1575715..1576368) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1576379..1577254) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1577284..1578126) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1578131..1578814) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1579244..1580479 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene pepT CDS 1580757..1581029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1581185..1581778 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 1581779..1584247 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1584263..1584673 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene arfB CDS complement(1584700..1585119) product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1585277..1585831) product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1585836..1586543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1586610..1587263) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1587589..1588401) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene phnE CDS complement(1588414..1589214) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene phnE CDS complement(1589211..1590035) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene phnC CDS complement(1590143..1591081) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene phnD CDS complement(1591398..1591574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1591584..1592531) product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1593053..1593586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1593815..1595224 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene ptsG CDS 1595554..1596939 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1597121..1598443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1598427..1598849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1598862..1600202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1600634..1601494 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1601646..1602926 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1603162..1605189) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1605388..1606344 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190395680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1606997..1607311) product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1607593..1608069 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1608183..1609409 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1609511..1609939) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1609932..1610966) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1610984..1611592) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene fdh3B CDS complement(1611605..1614460) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1614473..1614673) product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396171.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1614689..1615288) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1615297..1616967) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396174.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1617146..1617847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1617869..1618294) product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1618423..1619274 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1619288..1620133 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1620133..1620831 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1620844..1621569 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1621571..1622140 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene mobA CDS 1622144..1623919 product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479452.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1624579..1625460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1625510..1626514 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1626514..1627557 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1627562..1629442 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1629452..1630441 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1630441..1631403 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1631423..1635307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1636057..1637721 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1637930..1638823 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1639053..1641215) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene recQ CDS complement(1641301..1641645) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1642195..1642923 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene artP CDS 1642981..1643715 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1643717..1644406 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene artQ CDS 1644403..1645074 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene artM CDS 1645262..1646926 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene fadD CDS 1647069..1647419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1647470..1648057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1648135..1650300) product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene pbpC CDS complement(1650297..1654961) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1655346..1660049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1660968..1661816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1661845..1662849 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1662850..1663893 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1663898..1665751 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1665763..1666752 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1666752..1667720 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1668001..1669071 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1669751..1673809 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1674141..1675271) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1675279..1676109) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1676112..1677884) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1677793..1677981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1678045..1678392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1678399..1679091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1679006..1680433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1680430..1681272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1681399..1681740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1682039..1683331) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1683728..1684732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1684807..1685769) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1685878..1686444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1686474..1687766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1687763..1688461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1688559..1689455) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1690089..1692086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1692104..1693963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1694022..1694189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1694209..1694922) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1694925..1696964) product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene pglZ CDS complement(1696964..1698769) product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1698762..1702166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1702163..1705540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1705601..1709056) product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene brxC CDS complement(1709066..1709614) product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1709611..1710300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 tRNA complement(1710725..1710812) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 1710998..1711597 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1711689..1712750) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483627.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene nadA CDS complement(1712865..1713644) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene ybgF CDS complement(1713660..1714235) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene pal CDS complement(1714272..1715621) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene tolB CDS complement(1715632..1716687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1716701..1717144) product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1717148..1717831) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene tolQ CDS complement(1717833..1718243) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483618.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ybgC CDS complement(1718490..1718654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1718614..1719750) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483614.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene cydB CDS complement(1719765..1721354) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene cydA CDS complement(1721698..1722711) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene ruvB CDS complement(1722712..1723326) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene ruvA CDS complement(1723482..1724003) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene ruvC CDS complement(1724073..1725848) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483110.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene aspS CDS 1726116..1726841 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene cmoA CDS complement(1727514..1729979) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene torA CDS complement(1729999..1731183) product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838511.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene torC CDS complement(1731222..1731398) product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene torE CDS 1731865..1732098 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1732100..1732945 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1733197..1737651) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene mukB CDS complement(1737648..1738313) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene mukE CDS complement(1738321..1739673) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene mukF CDS complement(1739682..1740464) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene cmoM CDS complement(1740633..1740788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1740889..1741410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1741528..1742178 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene torD CDS 1742319..1743335 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene purR CDS 1743495..1744181 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1744389..1744739 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(1744736..1745545) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1745641..1746192) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(1746192..1746770) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1746751..1747278) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1747286..1748560) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480406.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1748586..1749305) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1749317..1750732) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(1750732..1751463) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1751460..1751882) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1752102..1752977) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene htpX CDS 1753444..1753608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1753755..1754432) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene bioD CDS complement(1754429..1755226) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene bioC CDS complement(1755223..1756371) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene bioF CDS complement(1756379..1757431) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene bioB CDS 1757553..1758833 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487357.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene bioA CDS complement(1758921..1759496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1759592..1760899) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene serS CDS complement(1760985..1762331) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1762341..1762976) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene lolA CDS complement(1762976..1766221) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1766338..1766829) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene lrp CDS 1766986..1768113 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ald CDS complement(1768301..1769518) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1769570..1770544) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene cysB CDS 1770705..1771502 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1771629..1772321) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene pyrF CDS complement(1772407..1773576) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene lapB CDS complement(1773585..1773902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1774268..1774552) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene ihfB CDS complement(1774632..1776302) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene rpsA CDS complement(1776424..1777101) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene cmk CDS complement(1777431..1778489) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene sohB CDS 1778577..1779317 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1779337..1780023 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 1780375..1780542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1780682..1780939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1781037..1781189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1781300..1783249) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1783385..1783933) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1784060..1786063) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1786364..1788223 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene sppA CDS 1788517..1789542 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene ansA CDS complement(1789632..1789922) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1789969..1790382) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene msrB CDS 1790720..1791715 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene gap CDS 1792012..1792896 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1793075..1793827 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene rlmA CDS 1794190..1798410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1798423..1800636 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1800638..1801027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1801203..1802147 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1802284..1802505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 note possible pseudo, frameshifted CDS complement(1802734..1803123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 note possible pseudo, internal stop codon, frameshifted CDS complement(1803124..1803402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 note possible pseudo, internal stop codon CDS complement(1803531..1803794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1804181..1805128 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1805518..1805961) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 1806133..1806384 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460076.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1806468..1807151 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene aqpZ CDS complement(1807223..1807822) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene recR CDS complement(1807841..1808170) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1808243..1810306) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene dnaX CDS complement(1810333..1810878) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene apt CDS complement(1811159..1811503) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1811652..1812743) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1812916..1813803 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1814081..1815598) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene purF CDS complement(1815623..1816120) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1816184..1816834) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1816824..1818098) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192375.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene folC CDS complement(1818141..1819064) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene accD CDS complement(1819231..1820022) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene truA CDS complement(1820178..1821839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1822061..1823074) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1823071..1824204) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1824307..1825518) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene fabB CDS 1825629..1827704 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162806064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene mnmC CDS complement(1827772..1828323) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1828397..1828663) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1828667..1829194) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1829281..1830366) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene aroC CDS complement(1830501..1831433) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene prmB CDS 1831495..1832025 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene smrB CDS 1832101..1832598 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1832685..1833149) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene sixA CDS 1833352..1836129 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1836378..1837415 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1837491..1839602) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene fadJ CDS complement(1839602..1840909) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene fadI CDS 1841143..1841724 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1841717..1842439 product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1842722..1843996 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1844109..1844795) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1844892..1845641) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1845714..1846937) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene ccmI CDS complement(1846937..1847413) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(1847410..1847964) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1847964..1849922) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1849919..1850404) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ccmE CDS complement(1850401..1850607) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ccmD CDS complement(1850611..1851360) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1851387..1852055) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene ccmB CDS complement(1852055..1852672) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene ccmA CDS complement(1852946..1853848) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1854148..1855395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1855594..1856232) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1856242..1857732) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052678357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1857749..1858270) product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene tadF CDS complement(1858257..1858745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(1858746..1859819) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1859821..1860663) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012535186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1860663..1861571) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1861568..1862851) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1862848..1864116) product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1864116..1864580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1864577..1865911) product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1865911..1866774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1866771..1867202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1867223..1867447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1868307..1870100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1870519..1871814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 tRNA complement(1872494..1872569) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 1872943..1873530 product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1873659..1874762 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1874918..1875514 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene cobO CDS complement(1875638..1876327) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1876340..1878676) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1878839..1879480) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene udk CDS complement(1879624..1880697) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene apbC CDS 1880939..1882990 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene metG CDS 1883185..1884006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1884033..1885247) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1885352..1886515) product DUF6363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1886852..1887439 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1887894..1889363 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1889577..1890002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1890362..1891795) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene ptsG CDS complement(1892234..1893004) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1893083..1894045) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1894045..1894680) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene tmk CDS complement(1894681..1895697) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene mltG CDS complement(1895690..1896496) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene pabC CDS complement(1896671..1897921) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene fabF CDS complement(1898019..1898252) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004737381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene acpP CDS complement(1898415..1899149) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene fabG CDS complement(1899174..1900097) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene fabD CDS complement(1900240..1901190) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1901196..1902221) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene plsX CDS complement(1902231..1902401) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene rpmF CDS complement(1902407..1902943) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene yceD CDS 1903061..1903648 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1903645..1904589) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene rluC CDS 1905192..1908290 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene rne CDS 1908698..1910257 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1910736..1911257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1911257..1912315 product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1912655..1913251) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1913353..1913784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1914177..1914692 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1914891..1916345) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1916515..1917111) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1917508..1918491) product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1918509..1919201) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1919558..1920580) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1920623..1921675 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1921698..1922642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1922688..1923566) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196597804.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1923752..1924723 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene rlmF CDS complement(1924733..1925482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1925492..1927483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1927476..1929617) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1929622..1931463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1931641..1954401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1955731..1956486) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1956579..1957970) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1958429..1959403) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1959778..1960827 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 1960837..1961853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1961813..1962277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1962331..1962981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 tRNA complement(1963655..1963731) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 1963932..1964786 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene folD CDS complement(1964827..1965828) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1965850..1966137) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1966316..1966978 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene minC CDS 1966990..1967802 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene minD CDS 1967809..1968069 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene minE CDS complement(1968214..1969350) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene rnd CDS complement(1969459..1971123) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene fadD CDS complement(1971254..1972096) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1972099..1972644) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1972678..1973385) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene tsaB CDS complement(1973425..1975347) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1975582..1976415 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene purU CDS complement(1976432..1977016) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478779.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1977223..1978956 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene argS CDS complement(1979044..1979301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1979359..1979619) product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1979666..1981006) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1981096..1982079 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1982405..1983835 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1984306..1985250 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1985325..1985546) product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1985565..1987838) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene feoB CDS complement(1987838..1988065) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1988199..1988963) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261504.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene znuA CDS 1989229..1990038 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene znuC CDS 1990031..1990816 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene znuB CDS complement(1990897..1991769) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene sucD CDS complement(1991769..1992935) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418307.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene sucC CDS complement(1993076..1994290) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene odhB CDS complement(1994304..1997129) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene sucA CDS complement(1997251..1997961) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1997973..1999739) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene sdhA CDS complement(1999740..2000087) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene sdhD CDS complement(2000081..2000461) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene sdhC CDS 2000858..2002147 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2002201..2002959) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455494.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 2003066..2003839 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(2004600..2006246) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455478.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene pgm CDS complement(2006331..2006885) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene seqA CDS 2006969..2007748 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 2007819..2008037 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 2008091..2008618 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene fldA CDS 2009018..2009458 product ferric iron uptake transcriptional regulator FcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene fcrX CDS 2009498..2010079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(2010187..2011851) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene glnS CDS complement(2011998..2013485) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene nagE CDS 2013766..2014902 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene nagA CDS 2014905..2016125 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 2016192..2017784 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 2017900..2019063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 2019234..2020898 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene asnB CDS complement(2020960..2021451) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene rfaH CDS complement(2021561..2022535) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene hemH CDS complement(2022621..2023265) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene adk CDS complement(2023435..2025336) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene htpG CDS 2025590..2026447 product transcriptional regulator ToxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene toxR CDS 2026447..2026971 product transmembrane regulator ToxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene toxS CDS complement(2027042..2027590) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene yfcE CDS 2027829..2028737 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 2029080..2029934 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 2030070..2030990 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454552.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 2030987..2031439 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(2031489..2033513) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene ligA CDS complement(2033587..2034594) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene zipA CDS 2034775..2035521 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene cysZ CDS 2035660..2036628 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene cysK CDS 2036875..2037132 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 2037257..2038981 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489822.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene ptsI CDS 2039023..2039532 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene crr CDS complement(2039745..2040653) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457759.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 2041206..2041547 product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(2041555..2041833) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2042125..2042301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(2042417..2043136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2043130..2044083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2044080..2044493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2044481..2045017) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2045499..2045936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(2045943..2046476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2046521..2046859 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 2047042..2048178 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262397.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene dapE CDS 2048180..2048875 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457656.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 2048907..2049143 product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404231.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(2049288..2050337) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene bamC CDS complement(2050392..2051270) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene dapA CDS 2051512..2052051 product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2052305..2052769 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene bcp CDS 2053129..2054694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(2054964..2056043) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(2056048..2056269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 2056472..2057941 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2057954..2058304 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene arsC CDS 2058361..2058753 product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(2059092..2060294) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(2060400..2061026) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene upp CDS 2061326..2062366 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene purM CDS 2062369..2062953 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene purN CDS 2063099..2064253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(2064237..2065079) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2065121..2065699) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene lpcA CDS 2066229..2068448 product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene fadE CDS complement(2068509..2069231) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene dnaQ CDS 2069288..2069752 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene rnhA CDS complement(2069780..2070415) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 2070545..2071303 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene gloB CDS 2071424..2073010 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2073000..2073746) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(2074019..2074357) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene glnB CDS complement(2074458..2074769) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(2074771..2076105) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene tilS CDS complement(2076231..2077190) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene accA CDS complement(2077237..2080716) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909664.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene dnaE CDS complement(2080735..2081355) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rnhB CDS complement(2081357..2082499) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480975.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene lpxB CDS complement(2082573..2083364) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420540.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene lpxA CDS complement(2083366..2083818) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene fabZ CDS complement(2083905..2084924) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210023.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene lpxD CDS complement(2084931..2085440) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794125.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2085458..2087896) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262428.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene bamA CDS complement(2087942..2089297) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129778.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene rseP CDS complement(2089309..2090505) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene ispC CDS complement(2090530..2091375) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2091386..2092141) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2092238..2092795) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene frr CDS complement(2092853..2093584) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484104.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene pyrH CDS complement(2093772..2094614) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene tsf CDS complement(2094745..2095476) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene rpsB CDS 2095823..2096713 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456732.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene map CDS complement(2096922..2100053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 2100239..2102872 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene glnD CDS 2103011..2103394 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(2103497..2104699) product IS256-like element ISSod4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2104757..2105497) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene truC CDS complement(2105498..2105815) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456758.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2105896..2106939 product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 2106940..2107236 product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 2107315..2107629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2107626..2108084 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2108158..2109771) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2109969..2110376 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2110445..2111188) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(2111227..2112003) product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459158.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(2112005..2112613) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene syd CDS 2112637..2113503 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene queF CDS 2113507..2115822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2116117..2117478 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ppnN CDS 2117577..2118353 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene xni CDS complement(2118414..2119499) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155650284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rlmM CDS complement(2119573..2120478) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105705.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(2120814..2122262) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene thiI CDS 2122550..2122810 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene xseB CDS 2122797..2123690 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene ispA CDS 2123718..2125586 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483016.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene dxs CDS complement(2125625..2126128) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene pgpA CDS complement(2126161..2127129) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene thiL CDS complement(2127238..2127711) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene nusB CDS complement(2127711..2128181) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene ribE CDS complement(2128321..2129430) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene ribBA CDS complement(2129476..2130132) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2130146..2131243) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene ribD CDS complement(2131294..2131743) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene nrdR CDS complement(2131957..2133207) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(2133282..2134391) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene proB CDS complement(2134518..2134907) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene crl CDS complement(2135010..2136248) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455935.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene frsA CDS complement(2136529..2136993) product oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381590.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene tet(34) CDS complement(2137020..2138312) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 2139458..2140930 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2140995..2141537) product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2141766..2145659) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene purL CDS 2145987..2147492 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene mltF CDS complement(2147852..2148382) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene tadA CDS complement(2148375..2149289) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261379.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2149408..2150538 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 2150599..2151435 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene fghA CDS complement(2151501..2153060) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2153363..2153755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2153745..2154680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2154667..2155251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2155245..2155736) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2155887..2157047) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043914.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene dnaJ CDS complement(2157294..2159210) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene dnaK CDS complement(2159440..2160054) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455958.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene grpE CDS 2160205..2161089 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene nadK CDS 2161183..2162856 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene recN CDS 2163026..2163385 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene bamE CDS complement(2163673..2163984) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2163974..2164417) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2164520..2165005 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455975.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene smpB tmRNA 2165072..2165438 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 2165627..2166103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 note possible pseudo, frameshifted repeat_region 2166912..2167955 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcattgctacgtgattttgataaggtattgaagc CDS complement(2168146..2168718) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene cas4 CDS complement(2168715..2169014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2169032..2170024) product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene cas1 CDS complement(2170021..2174229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 2174552..2174953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 2175073..2175273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2175503..2176546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2176852..2177613 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene kduD CDS complement(2178256..2179356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2179522..2181012) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463023.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2181022..2181468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(2181537..2182463) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2182490..2182963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2183326..2184387) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene arsB CDS complement(2184492..2184797) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2185046..2185975 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2186038..2187513) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489212.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene focA CDS complement(2187753..2188358) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2188351..2188998) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2188982..2190673) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(2190680..2191825) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 2192225..2193172 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2193288..2193809) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2193954..2195531) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460250.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene guaA CDS complement(2195764..2197227) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417956.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene guaB CDS 2197535..2198782 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene xseA CDS complement(2199467..2200954) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene der CDS complement(2201267..2202427) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene bamB CDS complement(2202439..2203053) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2203065..2204303) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene hisS CDS complement(2204374..2205495) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163464.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene ispG CDS complement(2205498..2206427) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene rodZ CDS complement(2206476..2207150) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene pilW CDS complement(2207212..2208327) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417927.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2208477..2208905) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene ndk CDS complement(2208988..2210274) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene pepB CDS complement(2210486..2210680) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene iscX CDS complement(2210703..2211041) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene fdx CDS complement(2211054..2212904) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene hscA CDS complement(2212924..2213439) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene hscB CDS complement(2213500..2213823) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene iscA CDS complement(2213872..2214255) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene iscU CDS complement(2214289..2215503) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(2215531..2216034) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene iscR CDS complement(2216147..2216878) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene trmJ CDS 2217032..2217835 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene suhB CDS complement(2218000..2219337) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene glmM CDS complement(2219354..2220184) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene folP CDS complement(2220276..2222168) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene ftsH CDS complement(2222322..2222951) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene rlmE CDS 2223083..2223379 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene yhbY CDS complement(2223450..2223923) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene greA CDS 2224416..2225453 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2225569..2226951 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene dacB CDS complement(2227002..2227847) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2227810..2228019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(2228244..2229431) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene tyrS CDS 2229559..2230854 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(2230913..2234023) product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene vmeK CDS complement(2234034..2235116) product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene vmeJ CDS complement(2235244..2235585) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461279.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene erpA CDS 2235784..2237070 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene hemL CDS 2237179..2238264 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2238277..2239296 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene rsmC CDS 2239455..2242787 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2243365..2245038 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 2245190..2246176 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2246178..2247212 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646270.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 2247209..2248228 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2248225..2249220 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 2249352..2251238 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060994152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2251255..2252295) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(2252295..2253920) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2254001..2255014) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2255406..2256638) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2256663..2257001) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene glnK CDS complement(2257208..2257576) product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2257897..2260485) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032551753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene acnB CDS complement(2260749..2262965) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2263126..2265498) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene mrcB CDS complement(2265517..2267991) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480202.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene hrpB CDS 2267983..2268765 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545814.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene sfsA CDS 2268907..2269353 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene dksA CDS 2269419..2270306 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106435.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene gluQRS CDS 2270412..2271764 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015297242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene pcnB CDS 2271761..2272243 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene folK CDS 2272272..2273066 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene panB CDS 2273075..2273926 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195750.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene panC CDS 2274150..2274311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2274395..2275165) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2275165..2276088) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 2276184..2276834 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114117.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene can CDS complement(2276924..2277451) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene hpt CDS complement(2277650..2279077) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene lpdA CDS complement(2279326..2281194) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462571.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene aceF CDS complement(2281222..2283885) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene aceE CDS complement(2283949..2284722) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009602124.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene pdhR CDS complement(2284961..2285503) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene ampD CDS 2285472..2286488 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017019488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene nadC CDS 2286908..2287312 product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2287323..2288873 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene pilB CDS 2288866..2290071 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2290154..2291032 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2291032..2291631 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011557.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene coaE CDS 2291675..2292415 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene zapD CDS 2292439..2292633 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene yacG CDS 2293134..2293370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2293407..2293760) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene rplS CDS complement(2293802..2294560) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene trmD CDS complement(2294582..2295112) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene rimM CDS complement(2295145..2295393) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene rpsP CDS complement(2295658..2297046) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene ffh CDS 2297196..2297990 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2298070..2299332 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2299400..2299915) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene luxS CDS complement(2299932..2301497) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene gshA CDS complement(2301716..2304601) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2304611..2305066) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2305279..2306409) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2306419..2308197) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene oadA CDS complement(2308207..2308476) product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 tRNA complement(2308884..2308960) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(2309024..2309100) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(2309164..2309240) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(2309304..2309380) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(2309446..2309522) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(2309610..2309702) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(2309745..2309821) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(2309865..2309957) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(2310139..2310336) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene csrA CDS complement(2311022..2311354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2311820..2312200) product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene tnpA CDS complement(2312331..2312576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 note possible pseudo, frameshifted CDS complement(2312853..2313023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 note possible pseudo, internal stop codon, frameshifted CDS complement(2313170..2313445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 2313929..2316715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2316914..2318116) product IS256-like element ISSod4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2318216..2318557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2318811..2319086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 note possible pseudo, internal stop codon CDS complement(2319296..2320417) product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2320854..2325335) product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene sslE CDS 2325349..2325597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2325604..2325741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2325772..2326077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 2326108..2326653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2326993..2327328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2327537..2330128) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene alaS CDS complement(2330289..2330759) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene recX CDS complement(2330869..2331894) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene recA CDS complement(2332000..2332425) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene pncC CDS 2332577..2335144 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene mutS CDS complement(2335204..2336181) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene rpoS CDS complement(2336232..2337089) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2337082..2337708) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(2337712..2338452) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene surE CDS complement(2338465..2339496) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene truD CDS complement(2339513..2339992) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene ispF CDS complement(2340017..2340631) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene ispD CDS complement(2340730..2340951) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene ftsB CDS complement(2341379..2342677) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262541.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene eno CDS complement(2342758..2344398) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2344546..2345349) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene mazG CDS complement(2345409..2347631) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene relA CDS complement(2347730..2349043) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene rlmD CDS 2349219..2351996 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482572.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene barA CDS complement(2352050..2352430) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene acpS CDS complement(2352430..2353161) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene pdxJ CDS complement(2353158..2353877) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene recO CDS complement(2353931..2354917) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene era CDS complement(2354910..2355587) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene rnc CDS complement(2355597..2356493) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene lepB CDS complement(2356589..2358382) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene lepA CDS complement(2358492..2358986) product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490334.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2358983..2359945) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene rseB CDS complement(2359942..2360565) product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2360577..2361155) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene rpoE CDS 2361576..2363204 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918879.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene nadB CDS complement(2363258..2363521) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 2363710..2364651 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene ygfZ CDS 2365218..2365442 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380970.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2365682..2366659 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(2366630..2366845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2367010..2368212) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2368222..2369427) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene ubiH CDS complement(2369446..2370012) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2370292..2370582 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2370798..2371388 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2371482..2372138 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189749.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rpiA CDS 2372345..2373577 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene serA CDS complement(2373710..2374402) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2374563..2375435) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene mscS CDS complement(2375656..2376732) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417587.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene fbaA CDS complement(2376860..2378023) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2378184..2379209) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461726.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene epd CDS complement(2379344..2381338) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene tkt CDS 2381676..2382830 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene metK CDS 2383112..2383906 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 2384015..2384509 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461721.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2384632..2385327 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene endA CDS 2385422..2386153 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene rsmE CDS 2386163..2387131 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene gshB CDS 2387272..2387832 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2387829..2388254 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091869.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene ruvX CDS complement(2388263..2389366) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461714.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2389613..2390659) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2390684..2391394 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2391418..2392242 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482485.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene proC CDS 2392261..2392830 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482440.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 2392862..2393305 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2393312..2393926 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 2393923..2395095 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene hemW CDS complement(2395231..2396262) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(2396335..2397054) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene trmB CDS 2397262..2398314 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene mutY CDS 2398324..2398596 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2398644..2399783 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene mltC tRNA 2399888..2399963 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 2400017..2400092 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 2400100..2400175 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 2400215..2400290 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 2400843..2400918 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 2400964..2401039 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 2401061..2401136 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 2401217..2401292 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA 2401311..2401386 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS 2402098..2403978 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2404082..2405230 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2405294..2405830 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228269.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene mtlR CDS complement(2405926..2406726) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene nagB CDS 2407059..2407826 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2407879..2409711 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene glmS CDS 2410175..2411017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2411456..2412001 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106217.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2412035..2412535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2413028..2413492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2413814..2414902) product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2415078..2415275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2415531..2416238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2416309..2416866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2417295..2418650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2418758..2421937) product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2421948..2423807) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2423864..2424625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2424638..2427907) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2427916..2428164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2428319..2429992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2430024..2430227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2430443..2430724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2430808..2431383) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188025301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(2431521..2432393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2433245..2433790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 tRNA complement(2434263..2434347) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS 2434721..2435161 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461101.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2435259..2436329) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene lptG CDS complement(2436330..2437169) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587726.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene lptF CDS 2437649..2439157 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene pepA CDS 2439249..2439695 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2439800..2442673 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2443056..2443211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2443539..2443952) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455099.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene rraB CDS 2444146..2445366 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455102.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene arcA CDS 2445441..2446445 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 2446622..2447575 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene pyrB CDS 2447591..2448052 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene pyrI CDS 2448094..2448483 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417516.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2448721..2449482) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455109.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2449755..2451023) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene murA CDS complement(2451033..2451287) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene ibaG CDS complement(2451280..2451612) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2451609..2452253) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2452256..2452735) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene mlaD CDS complement(2452738..2453529) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene mlaE CDS complement(2453526..2454329) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene mlaF CDS 2454518..2455483 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 2455493..2456467 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene kdsD CDS 2456471..2457028 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261184.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene kdsC CDS 2457145..2457588 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059348.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene lptC CDS 2457569..2458075 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830444.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene lptA CDS 2458083..2458808 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene lptB CDS 2458836..2460305 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2460327..2460614 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene hpf CDS 2460617..2461087 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene ptsN CDS 2461089..2461961 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene rapZ CDS 2461954..2462226 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135899.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 2462346..2463704 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene mgtE CDS complement(2463773..2465116) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pmbA CDS 2465247..2465771 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene yjgA CDS complement(2465875..2467320) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene tldD CDS complement(2467324..2468163) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2468163..2472044) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2472053..2473522) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene rng CDS complement(2473541..2474116) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461824.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2474120..2474608) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461823.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene mreD CDS complement(2474598..2475416) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene mreC CDS complement(2475540..2476583) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381144.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2476734..2480132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2480125..2480601) product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(2480591..2481358) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481003.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2481358..2481981) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2481971..2482468) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481001.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2482604..2483092) product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139685680.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2483423..2484022) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2484116..2484571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2484574..2485794) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190444.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2485801..2487528) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2487518..2488825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2488822..2489667) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2489667..2491289) product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene mshL CDS complement(2491305..2491628) product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(2491621..2492262) product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene gspM CDS complement(2492262..2493611) product MSHA biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2493752..2495758) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene csrD CDS complement(2495989..2496543) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 2496830..2497465 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480993.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 2497571..2498449 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466627.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene galU CDS 2498573..2501398 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene uvrA CDS 2501416..2503188 product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2503196..2504308) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 2504683..2506038 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene lysC CDS complement(2506173..2509841) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene metH CDS 2510028..2511320 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(2511382..2512323) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene metA CDS complement(2512421..2512972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263434.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 tRNA complement(2513127..2513203) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 rRNA complement(2513419..2513529) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(2513688..2516574) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA complement(2516992..2518542) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 rRNA complement(2519090..2519200) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2519359..2522245) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(2522605..2522680) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 rRNA complement(2522751..2524299) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(2524960..2525733) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2525726..2527441) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455813.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene cysI CDS complement(2527441..2529246) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2529359..2529589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2529726..2530385) product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2530469..2530669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(2530857..2531837) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene dusA CDS complement(2532045..2532848) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(2533009..2534661) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene pgi CDS complement(2534871..2535956) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene alr CDS complement(2535974..2537374) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2537635..2538357 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455861.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2538422..2538874) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene rplI CDS complement(2538908..2539135) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene rpsR CDS complement(2539152..2539454) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene priB CDS complement(2539463..2539852) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381299.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene rpsF CDS complement(2540138..2540875) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene rlmB CDS complement(2540888..2543344) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene rnr CDS complement(2543447..2543872) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460673.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene nsrR CDS complement(2544120..2545436) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(2545575..2545760) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2545833..2546813) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene hflC CDS complement(2546816..2548015) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene hflK CDS complement(2548061..2549350) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene hflX CDS complement(2549400..2549660) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262725.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene hfq CDS complement(2549822..2550754) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192300.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene miaA CDS complement(2550747..2552696) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480064.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene mutL CDS complement(2552750..2554420) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2554417..2554881) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene tsaE CDS 2555080..2556192 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061012950.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene queG tRNA complement(2556761..2556837) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(2556896..2556971) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(2557012..2557088) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(2557144..2557219) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(2557260..2557336) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(2557395..2557470) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA complement(2557511..2557587) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA complement(2557644..2557719) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA complement(2557760..2557836) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(2558005..2558080) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 CDS complement(2558200..2558745) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene orn CDS 2558915..2559970 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene rsgA CDS 2560026..2560901 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene asd CDS complement(2560945..2561592) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2561839..2562588 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066162.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 2562676..2563191 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene rraA CDS 2563374..2564789 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2564822..2565541 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 2565642..2566529 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2566526..2567500) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene epmA CDS 2567728..2569551 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene frdA CDS 2569551..2570288 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 2570288..2570671 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381491.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene frdC CDS 2570685..2571044 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456924.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene frdD CDS complement(2571127..2571693) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene efp CDS 2571728..2572753 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene epmB CDS complement(2572881..2573444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(2573622..2575208) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(2575312..2576748) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071037.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2576908..2580816) product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene pulA CDS complement(2580847..2580996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2581179..2582825) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene groL CDS complement(2582885..2583175) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2583404..2584753 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(2584821..2585642) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421201.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene cysE CDS complement(2585670..2586707) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene gpsA CDS complement(2586865..2587341) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene secB CDS complement(2587406..2587879) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 2588234..2589772 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene gpmM CDS 2589839..2591002 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2591063..2591305) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007388.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene zapB CDS 2591601..2592608 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458880.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene glpX CDS complement(2592645..2593067) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058339.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2593078..2593428) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 2593647..2594420 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene tpiA CDS complement(2594548..2595510) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460467.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene pfkA CDS complement(2595746..2596660) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene fieF CDS complement(2596898..2597407) product CpxP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 2597584..2598267 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 2598264..2599634 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene cpxA CDS 2599728..2600204 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478594.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene trmL CDS complement(2600226..2600714) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene fxsA CDS 2601035..2602486 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene aspA CDS 2602582..2603889 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 2604041..2605840 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2605981..2606631 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2606873..2607136 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2607149..2608876 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 2609019..2609501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(2609498..2612938) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(2613029..2614204) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2614381..2616198 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2616201..2616833 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2617017..2618966 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478589.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene acs CDS 2619289..2619738 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene aroQ CDS 2619794..2620258 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene accB CDS 2620273..2621616 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene accC CDS 2621764..2622654 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421283.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene prmA CDS 2622834..2623751 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496441.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene dusB CDS 2623797..2624093 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene fis CDS complement(2624416..2625291) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene yddG CDS complement(2625410..2626603) product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2626600..2627028) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene zntR CDS 2627464..2629056 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262778.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene purH CDS 2629192..2630481 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene purD CDS complement(2630678..2631625) product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2631826..2633142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2633285..2633479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2633683..2634378) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456449.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2634418..2634690) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene hupA CDS 2634946..2636052 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2636098..2636685) product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 2636774..2637700 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262782.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(2638211..2638852) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene pyrE CDS complement(2638949..2639665) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene rph CDS 2639812..2640678 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2640757..2640891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2641034..2642434) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 2642677..2642955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2642962..2643867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(2644033..2645343) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(2645333..2645623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(2645959..2649099) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(2649150..2649803) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766675.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene bluB CDS complement(2649930..2650355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2650546..2650785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2651932..2652174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2652168..2652539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2652650..2653075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2653066..2659416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 2659630..2660553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 2660590..2661723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2661883..2662506 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene gmk CDS 2662565..2662837 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379346.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene rpoZ CDS 2662874..2664994 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene spoT CDS 2664997..2665683 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene trmH CDS complement(2665722..2666396) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene radC CDS 2666572..2667774 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene coaBC CDS 2667785..2668240 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene dut CDS 2668293..2668883 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene slmA CDS 2668899..2669852 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 2670173..2671117 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(2671184..2672251) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421300.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene hemE CDS complement(2672393..2673169) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884422.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene nudC CDS 2673343..2673837 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(2674146..2678354) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456484.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene rpoC CDS complement(2678428..2682456) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene rpoB CDS complement(2682689..2683057) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene rplL CDS complement(2683115..2683609) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene rplJ CDS complement(2683885..2684589) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene rplA CDS complement(2684594..2685022) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421326.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene rplK CDS complement(2685164..2685712) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene nusG CDS complement(2685724..2686101) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene secE CDS complement(2686357..2687541) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene tuf tRNA complement(2687645..2687720) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA complement(2687733..2687807) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(2687843..2687927) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(2687951..2688026) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 CDS 2688228..2689151 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075698.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene coaA CDS complement(2689140..2690096) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene birA CDS complement(2690083..2691144) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene murB CDS 2691240..2691665 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 2691770..2693110 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene pssA tRNA complement(2693407..2693483) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA complement(2693561..2693637) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 rRNA complement(2693708..2693818) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA complement(2693942..2696828) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 tRNA complement(2697204..2697279) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA complement(2697324..2697399) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA complement(2697402..2697477) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 rRNA complement(2697605..2699153) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 rRNA complement(2699519..2699629) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA complement(2699789..2702675) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 tRNA complement(2703014..2703089) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 tRNA complement(2703201..2703277) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 rRNA complement(2703492..2705057) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 rRNA complement(2705467..2705577) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 rRNA complement(2705737..2708623) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 tRNA complement(2708963..2709038) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA complement(2709127..2709203) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 rRNA complement(2709304..2710854) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 rRNA complement(2711218..2711328) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 rRNA complement(2711452..2714338) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA complement(2714758..2716323) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 CDS 2717008..2717481 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2717462..2718247) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene murI CDS 2718462..2719571 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene trmA CDS complement(2719602..2719958) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460363.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(2719969..2720580) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene fabR CDS 2720756..2722156 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene sthA CDS complement(2722161..2723528) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene dinF CDS complement(2723614..2724231) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene lexA CDS complement(2724322..2724678) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459671.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2724845..2727268 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene plsB CDS complement(2727348..2728199) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene ubiA CDS complement(2728199..2728699) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262812.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2728839..2729675) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene glpG CDS complement(2729672..2729995) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349528.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene glpE CDS complement(2730361..2731221) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene rpoH CDS complement(2731386..2732318) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene ftsX CDS complement(2732308..2732982) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene ftsE CDS complement(2733005..2734210) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481951.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene ftsY CDS 2734350..2734958 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene rsmD CDS 2734961..2735230 product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 tRNA complement(2735340..2735416) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 tRNA complement(2735471..2735546) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 tRNA complement(2735591..2735667) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 tRNA complement(2735723..2735798) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 tRNA complement(2735844..2735920) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00970 CDS 2736209..2736622 product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2736676..2738691) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene rep CDS 2738860..2739432 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2739448..2740548 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 2740559..2743630 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262875.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 2743767..2744024 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262876.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2744178..2745662) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene ilvC CDS 2745801..2746691 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455228.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene ilvY rRNA complement(2746747..2746857) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 tRNA complement(2746903..2746978) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00980 rRNA complement(2747069..2747179) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00260 rRNA complement(2747413..2750299) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00270 tRNA complement(2750684..2750759) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00990 rRNA complement(2750835..2752383) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00280 CDS complement(2752978..2753688) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene fre CDS complement(2753704..2753973) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459133.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2753970..2755826) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene ubiD CDS complement(2755895..2756860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(2757033..2758292) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene rho CDS complement(2758524..2758850) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280783.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene trxA CDS 2758963..2760270 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750771.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene rhlB CDS 2760278..2761762 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene gppA CDS 2761872..2762846 product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS complement(2762905..2763570) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015358.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2763766..2764068) product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458579.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2764061..2765893) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458577.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene recQ CDS 2766036..2766935 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480950.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene rarD CDS 2766932..2767579 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 2767813..2769435 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042987999.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene ggt CDS 2770137..2770763 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(2770808..2772979) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene uvrD CDS 2773259..2773519 product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2773598..2774452 product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 2774452..2775204 product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458569.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2775241..2775693 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(2775724..2776005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2776232..2778013 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260919.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(2778088..2779200) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene thiH CDS complement(2779197..2779979) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(2779982..2780191) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416828.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene thiS CDS complement(2780188..2780946) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene thiF CDS complement(2780933..2782102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2782338..2782721) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene crcB CDS complement(2783344..2783871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 note possible pseudo, frameshifted CDS complement(2783891..2784379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 note possible pseudo, frameshifted tRNA complement(2784925..2785015) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01000 rRNA complement(2785100..2785210) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00290 rRNA complement(2785444..2788330) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00300 tRNA complement(2788706..2788781) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01010 tRNA complement(2788826..2788901) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01020 tRNA complement(2788904..2788979) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01030 rRNA complement(2789107..2790657) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00310 CDS 2791247..2791795 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(2791788..2792051) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(2792051..2792884) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene aroE CDS complement(2792948..2793853) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene hemF CDS complement(2793857..2794411) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 2794599..2795084 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene purE CDS 2795089..2796201 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2796243..2796794) product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461441.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(2796803..2797276) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2797279..2798406) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461424.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene dprA CDS 2798516..2799028 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene def CDS 2799043..2799990 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene fmt CDS 2800046..2801326 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene rsmB CDS 2801364..2802740 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461427.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene trkA CDS 2802752..2804197 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2804194..2805000) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008130.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 2805490..2805756 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421548.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 2806048..2807466 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481163.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene ccoG CDS 2807536..2808522 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 2808556..2809158 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732279.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(2809229..2810518) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 2810606..2812453 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 2812714..2813652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 2813649..2815694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(2816155..2816379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 2817186..2817743 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 2818460..2820106 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145255.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene ilvG CDS 2820117..2820401 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378958.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene ilvM CDS 2820413..2821357 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 2821367..2823208 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene ilvD CDS 2823213..2824745 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene ilvA CDS complement(2824809..2825585) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 2825677..2826420 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456023.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(2826489..2827856) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421582.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene glmU CDS complement(2828045..2828467) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(2828486..2829889) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene atpD CDS complement(2829925..2830791) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene atpG CDS complement(2830836..2832377) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene atpA CDS complement(2832391..2832924) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene atpH CDS complement(2832939..2833409) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene atpF CDS complement(2833463..2833720) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450922.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene atpE CDS complement(2833765..2834574) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene atpB CDS complement(2834583..2834921) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421593.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 2834875..2835057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(2835108..2836001) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458443.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(2836026..2836805) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(2836802..2837443) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene rsmG CDS complement(2837440..2839341) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene mnmG CDS complement(2839818..2840258) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581314.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene mioC CDS complement(2840261..2841622) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene mnmE CDS complement(2841734..2843371) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene yidC CDS complement(2843598..2843954) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene rnpA CDS complement(2843967..2844104) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene rpmH CDS complement(2844374..2845108) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481188.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(2845105..2845776) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481192.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(2845873..2846634) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 sequence2 source 1..1007363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..2077) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897651.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(2384..2647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 3059..3829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(3879..4598) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477212.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 4876..5799 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038155721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 5932..6309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(6390..6626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(7039..8271) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486542.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(8793..9107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 9328..10830 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020334188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 11244..12287 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(12688..13665) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(13844..15040) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348936.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(15168..15887) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(15884..17539) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(17654..18100) product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261386.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(18296..19498) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(19987..21738) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(22444..23067) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(23113..24036) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(24070..24405) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 24722..26878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 26878..29016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 29305..31050 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(31126..32505) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(32579..33289) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 33873..34592 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 34776..36647 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 36651..37358 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263231.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(37482..38162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(38620..39327) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(39715..40845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 41924..42673 product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700857.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 42737..44266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 44537..48205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 48461..50074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 50493..52091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 52350..54140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 55097..55852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 55938..57794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 58053..58181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 59807..61585 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 62335..64110 product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 64185..65753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 66087..66860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(66959..67798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 68068..69879 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544192.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 69995..70654 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421904.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS 71025..71780 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469307.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(72026..72817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(73246..73995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(74190..75017) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480808.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene nadE CDS 75113..75634 product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 75722..76162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(76197..76838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 76993..78135 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(78261..78560) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488152.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 78779..79240 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 79516..79794 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene ppiC CDS 80150..81232 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 81232..81891 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(81952..82374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(82589..82798) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 83149..83547 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479962.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(83613..83909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 84042..84560 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(84555..85325) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(85333..85653) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(85775..86683) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462838.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 86847..88043 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 88043..89074 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene tdh CDS complement(89132..90070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 90157..90369 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 90491..91348 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene yghU CDS 91871..93373 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene zwf CDS 93373..94086 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607048.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene pgl CDS 94111..95559 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene gnd CDS 95757..96521 product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073756.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(96825..97802) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071467.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 97950..98546 product type B-5 chloramphenicol O-acetyltransferase CatB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene catB CDS complement(98635..99861) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene gltS CDS complement(99934..100983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 101257..101988 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(101991..102536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454376.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 102846..103367 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797827.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 103370..103939 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(104014..105645) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 105880..107607 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 107863..108054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479763.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 108322..108624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 108621..108914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 108994..110235 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(110427..110987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 111310..111549 product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 111539..111820 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(111964..113415) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224052.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene aspA CDS complement(113674..114426) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095557.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(114440..115144) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 115356..116669 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(116769..118259) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 118453..119316 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 119440..120087 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 120111..120776 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084339.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 120769..121626 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 122033..122167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 note possible pseudo, internal stop codon, frameshifted CDS complement(122710..123666) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(124156..124740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 124931..125254 product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 125402..126505 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(126716..127108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(127518..127697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(127724..128077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(128390..128668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 note possible pseudo, internal stop codon CDS 128795..129040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 129219..130262 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263350.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(130720..131289) product PhnA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102406.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(131427..132131) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 132378..132818 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 132815..133036 product DUF3389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455381.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 133103..134788 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(134812..136257) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(136295..137887) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000856.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 138133..138372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(138414..139430) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(139431..140522) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(140619..142427) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001914695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(142724..143083) product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 143685..144374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 144747..145016 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 145013..145543 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(146058..148265) product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018575409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 148716..149306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(149298..150038) product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene istB CDS complement(150049..151560) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138360839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene istA CDS 151807..152415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 152427..153638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 153638..154288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 154605..154748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 154983..156455 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene ltrA CDS complement(156957..157496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(157675..158601) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262935.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 158755..159702 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221064.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 159767..160168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 160191..160931 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(161229..162455) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(162909..163925) product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 164026..164634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(164699..165610) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 165769..166641 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 167317..167550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 167543..167995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 169107..170114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 170190..170444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 170549..171313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(171562..172773) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 173605..174072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 174709..175620 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(175696..176568) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(176970..177383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 177655..178398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 178426..178734 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 178953..179771 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 179945..180154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(180142..180351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 180376..181221 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(181437..182387) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 182574..183461 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 183623..184180 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene sigZ CDS complement(184447..185643) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 185884..186765 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(186829..188148) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943380.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(188505..189782) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(189796..191190) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 191443..192774 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 192831..194195 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 194252..195361 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene potF CDS 195417..196559 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene potG CDS 196556..197473 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105415.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene potH CDS 197470..198306 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061639.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene potI CDS 198357..198899 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(198963..200450) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(200466..201014) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704252.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 201272..202618 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704253.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 202623..204119 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 204127..204876 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 205332..205520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 note possible pseudo, frameshifted CDS 205528..206052 product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921691.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(206694..207176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 207966..208739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(208743..209477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 note possible pseudo, frameshifted CDS complement(209609..209809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 209932..210426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 tRNA 210881..210965 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01040 CDS 211036..211356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 211360..211656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(211722..212459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 note possible pseudo, frameshifted CDS complement(212363..213250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 note possible pseudo, frameshifted CDS complement(213336..213680) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene tnpB CDS complement(213677..213976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 214029..214799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(215490..216884) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464136.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(217110..217841) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 218269..218826 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 218886..219470 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 219699..220970 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479127.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(221102..222106) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene ltaE CDS complement(222117..222635) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463851.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 222894..224561 product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106400.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 224570..226015 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106399.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene viaA CDS complement(226121..227779) product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479764.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(227868..229790) product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479772.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(230010..231203) product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(231273..231869) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455373.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 231868..232572 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 232581..235037 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(235412..236350) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(236347..237081) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(237082..237813) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 238055..239068 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene galE CDS complement(239466..241862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 242065..242646 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455347.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 242677..243681 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(243665..244630) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263422.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 244785..245096 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene yciH CDS 245491..245877 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 247269..247511 product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261276.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 247542..247991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 248025..248861 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263117.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene cpaB CDS 248858..250204 product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 250201..250737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 250747..251973 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263120.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 251975..253264 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 253276..254211 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263122.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 254211..255104 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261284.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 255104..255892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 255892..256428 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263124.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 256409..256972 product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene tadF CDS 256975..257610 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 257600..259036 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263126.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(259294..259479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(259461..259868) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675091.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(260153..260308) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479401.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(260331..261215) product DUF2861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(261215..261877) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815044.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(261852..263306) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960565.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(263461..264840) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272521.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene pntB CDS complement(264851..266389) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165536.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(266547..266828) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(266978..267961) product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 268243..268677 product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(268783..269877) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479305.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene modC CDS complement(269874..270566) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene modB CDS complement(270556..271227) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene modA CDS complement(271383..272030) product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460890.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(272066..273247) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(273402..273872) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106209.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene nrdG CDS complement(273891..276011) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479384.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene nrdD CDS 276333..277202 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(277282..277701) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057552266.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(277705..278127) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658156.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(278791..279882) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 280125..280322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 280442..281128 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(281432..281911) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(282039..282695) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(282870..283421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 283572..284141 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 284246..285550 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 285610..286254 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482658.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 286247..286720 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461979.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(286772..287389) product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183228.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 287610..288587 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071467.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 288902..289477 product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 289615..291324 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483312.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 291554..291886 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454817.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 291937..292764 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491469.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 292751..294835 product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483457.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 294835..295518 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263832.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 295575..296012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 296045..297538 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483461.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 297516..298622 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483417.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 298755..300002 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483478.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 300298..301269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 301266..302681 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263839.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 303020..304066 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483419.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 304229..304996 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 304989..306107 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263842.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 306104..307528 product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483455.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(307625..310132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(310564..311559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(311864..313729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 314329..315105 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480657.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(315175..315963) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263858.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 316257..317579 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(317580..317996) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(318070..319128) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(319881..321401) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(321461..321814) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene tnpB CDS complement(321811..322122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 322438..323520 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 323523..324713 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 324785..325423 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 325677..327815 product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 327847..328371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477075.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(328489..328926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 328958..329254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(329532..330305) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480270.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene cobA CDS complement(330428..331249) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418214.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(331335..331658) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460996.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene nirD CDS complement(331673..334231) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene nirB CDS complement(334570..335805) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(335872..336258) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460588.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 336558..337556 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene add CDS complement(337627..337977) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418869.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene yajD CDS complement(338070..338690) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423161.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(338776..339111) product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(339270..340100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(340516..341709) product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072096.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(342125..344050) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483383.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 344625..346610 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489296.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene rnb CDS 346973..347611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 347882..349030 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479145.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(349096..350157) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 350995..351735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 351888..352535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 352528..353253 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(353360..353800) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263155.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(353859..354470) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780723.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 354675..355682 product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479922.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(355758..357188) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454152.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(357404..359002) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(359070..361238) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206605.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 361584..363002 product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(363273..363716) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040992281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(363785..364177) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262952.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(364254..365225) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045461484.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(365836..366345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(366386..366961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(367004..367438) product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483203.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene nrfF CDS complement(367435..369399) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262124.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(369472..370419) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262125.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene nrfD CDS complement(370421..371107) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene nrfC CDS complement(371116..371700) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene nrfB CDS 372173..373594 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262128.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene nrfA CDS 373675..374310 product heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(374248..374556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 374655..376199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(376631..377338) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815798.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene baeR CDS complement(377374..378807) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene baeS CDS complement(378818..380818) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481460.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(380821..382047) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 382482..382739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(383022..383969) product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(384123..386957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 387177..387443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(388023..388649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(388669..389502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 389728..390726 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene ftsZ CDS 390713..391456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 391446..392456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 392513..393619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 394246..395193 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 395526..396908 product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 396918..397514 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene lpoB CDS 397591..399006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 399007..400140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(400820..401437) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene thiE CDS complement(401451..402245) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263206.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene thiM CDS complement(402266..402931) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391859.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene tenA CDS complement(402941..403909) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(403937..404905) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(404937..405731) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(405724..406542) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263202.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(406550..407371) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene thiD CDS complement(407617..408105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(408106..408546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(408594..409088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(409093..409536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(409536..409889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 410328..410918 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 411007..411825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(411879..412910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(412914..413423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(413837..414796) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 415099..415479 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 415720..416781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 417004..418566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(418649..419338) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene rsuA CDS complement(419437..420045) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 420241..421068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 421089..423296 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 423439..424029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(424093..424929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 425077..426108 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480191.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene pyrC CDS complement(426166..427692) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene glpK CDS 427960..429177 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454156.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene glgC CDS complement(429181..429549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 429719..430552 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462121.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(430784..431470) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462115.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(431647..432342) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261725.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(432346..434760) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007386.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(434893..450789) product retention module-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489282.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 454902..455129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 455302..455601 product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(455685..456461) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 456567..457466 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263892.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 457989..458582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 458615..459559 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163391.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene pfkB CDS 459721..460443 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705684.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene nfsA CDS 460445..460999 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 461173..462507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(463195..464496) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454697.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene dbpA CDS 465160..466083 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263347.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 466272..466892 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482721.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(466989..467336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187740.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(467352..468635) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106286.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(468906..469529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 469842..470084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017447309.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(470196..471086) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252027.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene malG CDS complement(471098..472675) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895488.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene malF CDS complement(472744..473922) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463104.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene malE CDS 474616..475740 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene malK CDS complement(475780..476595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(476595..479006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(479021..479710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(479795..480364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(480456..481145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(481636..481836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422950.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(481997..482746) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene pstB CDS complement(482787..483650) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene pstA CDS complement(483656..484567) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene pstC CDS complement(484704..485525) product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(485987..487321) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499754.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 487581..487865 product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038496.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(487989..488918) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(488908..490359) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478177.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene phrB CDS complement(490405..491385) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 491615..492964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263279.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(493027..493917) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619521.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 494048..494434 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478107.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 494434..495564 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(495746..496924) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(496921..498849) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263152.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(498885..499529) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263153.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 499782..501230 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene nhaD CDS 501319..502425 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 502559..503437 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 503437..503862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 503859..504464 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458304.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 504461..504898 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(504983..506362) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479245.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(506566..506985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015694.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 507297..507935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(507998..508645) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712470.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene queE CDS complement(508665..509147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(509183..510166) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(510806..511384) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 511580..512818 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263303.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(512979..513833) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(513931..514305) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258882.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(514404..516584) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778752.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene glgB CDS complement(516907..519096) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene malQ CDS complement(519253..521706) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 522257..524962 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene malT CDS 525038..526945 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462474.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 526999..527910 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261051.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 527903..528451 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(528618..529397) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(529425..530372) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097856.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(530408..531508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(531511..532311) product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455037.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(532308..533336) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(533346..534068) product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(534058..535218) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(535220..536719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480626.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(536838..537854) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(537938..539062) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(539769..540893) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(541024..542172) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(543148..544785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(545171..546277) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene wecA CDS complement(547319..548911) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene ahpF CDS complement(549124..549681) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene ahpC CDS complement(550229..550735) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705365.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(550726..550992) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(551618..552919) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(552919..553131) product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301023.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene hipB CDS complement(553667..554104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(554115..554327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(554970..556310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 556431..556637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 556598..557503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 557646..558023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(558034..559710) product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560455.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(559807..560370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(560390..560917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 note possible pseudo, frameshifted CDS complement(560937..561425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 note possible pseudo, frameshifted CDS complement(561459..562025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(562584..563840) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(563837..564151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 564711..564908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(564961..565149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 565306..565602 product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 565612..566832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(567369..567833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(568320..569171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 note possible pseudo, frameshifted CDS complement(569186..569470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 note possible pseudo, frameshifted CDS 569768..570004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 569976..570278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(570506..571168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(571162..571416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 572197..572493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 note possible pseudo, internal stop codon, frameshifted CDS complement(572627..573295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(573295..574233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(574283..575026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 575871..576176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 576173..576469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(576484..576981) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070962.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(576978..577250) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070963.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 577668..579245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 579256..582138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 582148..583359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 583624..584787 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211738.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(585131..586135) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481622.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(586188..587054) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417439.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene galU CDS complement(587243..587803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(587815..588939) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(589095..589607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 note possible pseudo, internal stop codon CDS complement(589750..590793) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(591143..592267) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(592409..592609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(592775..592966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(593193..594338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(594340..594915) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103394993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(594908..595813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 596515..596706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(596955..597836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(597837..598670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(598663..600180) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(600177..600728) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene rfbC CDS complement(600730..601614) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene rfbD CDS complement(601614..602540) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene rfbA CDS complement(602500..603564) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene rffG CDS complement(603717..604841) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(605186..606202) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(606257..607381) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 607741..607932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(608355..609557) product IS256-like element ISSod4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(609667..610380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(610403..611527) product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(611669..612124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(612542..614737) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(614870..615298) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(615327..616541) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(617253..618239) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(618401..618751) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422463.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(619462..620148) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477815.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene queC CDS 620295..620750 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(620804..621142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(621382..623460) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene helD CDS 623661..625814 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454352.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene yccS CDS 625839..626543 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 627154..627585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 627706..628683 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 629148..630143 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 630146..631642 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(631886..632839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263040.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(632833..635391) product LuxQ periplasmic sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477121.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(635394..636485) product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(636476..636769) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422778.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(636773..637426) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 637651..637965 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453573.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(638077..638592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 638872..639462 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(639466..640413) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263942.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(640544..641443) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 641607..643301 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 643411..644547 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene lldD CDS 644593..647445 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(647638..650790) product multidrug efflux RND transporter permease subunit VmeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene vmeZ CDS complement(650795..651982) product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene vmeY CDS complement(652154..653011) product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922269.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(653082..653987) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(653980..654507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 654800..656827 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480125.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 657193..657402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 657412..657750 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(657882..659222) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818937.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 660237..661700 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427054.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene tnaA CDS 661816..663069 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(663524..664075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(664214..664993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(665390..667252) product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene nadN CDS 667614..670382 product GlyGly-anchored extracellular endonuclease Xds inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene xds CDS complement(670495..670968) product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(670998..671744) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071805.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(671845..673605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 674139..675254 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495030.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene potA CDS 675238..676095 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene potB CDS 676095..676865 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389180.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene potC CDS 676979..678013 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484168.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(678167..678472) product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(678472..678948) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(678945..680657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(680659..682839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(682843..684669) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 684834..685781 product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(686397..687998) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483430.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(688292..688798) product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(689056..690033) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(690180..690431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421716.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(690710..691882) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479628.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(691882..692505) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263092.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(692515..692919) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236425.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(692953..693510) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263090.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(693510..694883) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(694883..695665) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263605.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 696043..697410 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469664.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene yegD CDS 697624..697785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(697797..698819) product GlyGly-anchored extracellular serine protease VesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene vesA CDS complement(699100..699672) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene yeiP CDS complement(699858..701081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(701690..701902) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(702817..703257) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(703271..704656) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene atpD CDS complement(704685..705554) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262900.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene atpG CDS complement(705601..707142) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074332.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene atpA CDS complement(707152..707703) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene atpH CDS complement(707715..708185) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene atpF CDS complement(708253..708489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(708536..709303) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene atpB CDS complement(709305..709706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 710309..710794 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 710937..712031 product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479954.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(712088..712276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(712545..712901) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene raiA CDS 713526..715604 product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 715921..716814 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065641382.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 716940..717368 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 717671..719224 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 719747..720706 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 720781..721284 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 721286..722590 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 723049..724008 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 724090..724590 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 724592..725896 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(726040..726894) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(727147..728514) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479004.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(728511..729173) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS complement(729564..730190) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478451.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 730350..731675 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 731885..732184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 732588..735023 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 735099..736802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 note possible pseudo, frameshifted CDS 736769..737887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 737952..739658 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 739856..740413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 740538..741515 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(741759..742148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(742375..742590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(742692..743918) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(743915..744631) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140495.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(744631..746019) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(746198..747352) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171814.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(747339..748487) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679653.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(748493..749473) product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(749463..750965) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865460.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 751285..752559 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063626.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 752692..755049 product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032475098.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(755301..756278) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(756462..757280) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 757613..759772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(760048..760473) product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882826.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(760377..761324) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664563.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(761446..761802) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(761913..762788) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266186.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(762939..763655) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(763728..763937) product DUF3283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009502.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(764086..764283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026548.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 764551..765024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451231.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(765067..767043) product DUF3346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093519.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 768492..769712 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 769716..770690 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(770751..772019) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263251.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 772338..774416 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162813643.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(774686..776803) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(776976..778367) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 778699..779340 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene pdxH CDS 779384..779782 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263243.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(779933..780142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(780048..781910) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454756.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 782280..785468 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477456.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene putA CDS 785471..786166 product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 786328..787428 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711606.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 788001..788414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(788488..788718) product DUF3622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455950.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 789008..789985 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(790234..791310) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(791334..792296) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106053.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 792378..793526 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955540.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene chrA CDS 793671..793862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705509.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(794000..795052) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263273.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene aroG CDS 795475..795918 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(796181..797542) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263665.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene astB CDS complement(797557..798594) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212031.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene astA CDS 798708..798896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 799010..799750 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704255.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(799995..801875) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(802056..803939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(804227..806227) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene glgX CDS 806835..808043 product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757932.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene lamB CDS 808205..809023 product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244228.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 809334..809975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(810144..812210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(812310..813203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(813277..813834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 814170..815057 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 815054..815884 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(815958..817274) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(818411..820012) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263910.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 820344..821615 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene coxB CDS 821615..823258 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482647.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene ctaD CDS 823265..823864 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 823861..824736 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482671.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(824769..824990) product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482739.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 824959..825753 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106290.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 825756..826340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482681.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 826348..827397 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 827394..828290 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482743.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene cyoE CDS complement(828625..829602) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 830217..830852 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482830.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(830921..831949) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 832144..833346 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 833339..833563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 834533..834814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(834972..836417) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 836880..837782 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435926.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 837769..839304 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(839366..840001) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261932.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(840279..841055) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(841069..842145) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102709.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene hisC CDS 842298..843182 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543524.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 843300..844277 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(844572..846221) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151656485.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(846215..848308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(848301..849269) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135747.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(849266..849541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(849770..850846) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(850857..851813) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(852174..852437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(853026..853628) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261716.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 853907..854536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(854635..856791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(856788..857399) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene ccoO CDS complement(857399..858811) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene ccoN CDS complement(858823..859161) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513613.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(859385..861865) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 862289..863101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 863137..865695 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene nirB CDS 865763..866107 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261473.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene nirD CDS 866195..867664 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 867781..869487 product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(869523..869975) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 870330..870683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(870686..871186) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481711.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 871309..871584 product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262023.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 871813..872175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 872568..874064 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464242.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 874393..874698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 874860..875282 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257579.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 875371..876348 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 876665..877039 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(877269..880136) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene gcvP CDS complement(880319..880699) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene gcvH CDS 880922..881545 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478414.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 881699..882817 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263531.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene gcvT CDS complement(883634..886468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(887393..890365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 890672..890866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(890859..893528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 893512..893796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 894970..897918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 tRNA 898370..898444 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t01050 CDS complement(898798..899625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 899972..900688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 900695..900844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 901047..901286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(901555..901893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(902247..903224) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 903342..903896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 904054..905802 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936297.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(905950..907320) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 907564..908094 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201885365.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(908182..909057) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263538.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 909262..910854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(910899..911966) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(912110..912403) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263074.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(912479..913144) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042817.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(913232..914047) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464042.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(914040..915425) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(915428..916528) product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481450.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene phnW CDS 916766..917770 product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481434.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 918192..919301 product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481435.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 919303..921045 product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481462.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 921058..921768 product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481525.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene phnR CDS 921887..923290 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481488.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 923724..925511 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261610.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 925504..927363 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261611.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 927386..928927 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 929632..948699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(949072..950364) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073845.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(950357..952438) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073844.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(952435..954012) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(954479..955405) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(955728..956702) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(956695..957321) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene cysC CDS complement(957398..959131) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(959135..960553) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707308.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene cysN CDS complement(960605..961513) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene cysD CDS complement(961874..962653) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261836.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(962653..963660) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261837.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(963720..964568) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(964565..964987) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(964984..965673) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479222.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(965691..966557) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700188.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 966732..968117 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261842.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene hutW CDS 968131..968649 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050752171.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene hutX CDS 968649..969230 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene hutZ CDS 969607..971349 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480797.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(971387..971950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 972090..973268 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(973294..973836) product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(974382..976529) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055063916.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 977119..978282 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 979171..979656 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 980208..980975 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759079.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(981083..981970) product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409986.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 982093..983076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(983310..983987) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525154.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 984755..985288 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 985650..985850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 985902..986264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(986690..986839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(987172..987312) product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(987322..987894) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463498.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(987927..988481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(988551..991040) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene napA CDS complement(991037..991366) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463501.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(991353..991871) product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477204.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene napF CDS 992051..993769 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593383.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene narQ CDS 993762..994388 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477224.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(994449..994655) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(994806..995762) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463537.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene tal CDS complement(995912..996664) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626053.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene moeB CDS complement(996676..997914) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene moeA CDS 998086..998739 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene folE CDS complement(998778..999743) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463561.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(1000016..1001410) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene clcA CDS 1002146..1003129 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482750.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(1003375..1004319) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene ylqF CDS complement(1004755..1005732) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 1005945..1007141 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479020.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 sequence3 source 1..22852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1380..3947) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479527.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 4452..4793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 4986..6185 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074409.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 6185..7255 product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074410.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 7642..9051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 9044..9367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 9374..10021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 10444..11001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(11061..11579) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074350.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(11560..12351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074348.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(12317..13039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074347.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(13591..13827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 14273..15169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 15169..16077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 16113..16721 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 16836..17384 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213258.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 17393..17908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 18130..19119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 19182..19439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548929.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 20744..21634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(21741..21923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750