COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..228811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1259..1747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 2487..2720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3120..3755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3783..5066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5266..6741 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098720.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6773..8185) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene ftsP CDS complement(8244..8981) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene plsC CDS complement(9145..11403) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene parC CDS complement(11522..11923) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 12062..12721 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene qseB CDS 12718..14067 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene qseC CDS 14173..14754 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 14786..15100 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098728.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15197..16084) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(16081..17031) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(17041..18081) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(18078..19061) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(19058..19870) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 20256..22397 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(22481..24373) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098740.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene parE CDS complement(24402..24983) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene yqiA CDS complement(24983..25810) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene cpdA CDS complement(25838..26260) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(26257..26889) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene nudF CDS 27094..28572 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene tolC CDS 28767..29432 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098745.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 29435..30595 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(30675..31463) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene ygiD CDS 31660..32433 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene zupT CDS 32766..33326 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 33435..35843 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 35853..36614 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 36598..37659 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(37704..38357) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene ribB CDS 38698..39030 product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene ubiK CDS complement(39145..40575) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene hldE CDS complement(40616..43471) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene glnE CDS complement(43493..44794) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 45021..45644 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 45696..46946 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(46957..47778) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene bacA CDS complement(47885..48256) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene folB CDS 48361..48975 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098765.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene plsY CDS 49066..50532 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 50681..51508 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 51519..51821 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 51832..52146 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 52139..53842 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene ureC CDS 53852..54310 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene ureE CDS 54320..54859 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 54859..55533 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 55543..56160 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene ureG CDS complement(56248..57261) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene tsaD CDS 57498..57713 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rpsU CDS complement(57801..57956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 58050..59573 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene dnaG CDS 59728..61575 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene rpoD CDS complement(61672..62178) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene mug tRNA 62303..62378 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 62731..63408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(64162..64377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(64464..64937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(64915..65217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 65517..66008 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 66396..67565 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(67566..68330) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 68478..68972 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(68969..70528) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(70866..72386) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 72913..74202 product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene ygjG CDS 74714..75256 product fimbrial protein BcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 75329..75862 product long polar fimbria major subunit LpfA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene lpfA1 CDS 75908..76615 product fimbrial biogenesis chaperone BcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene bcfB CDS 76924..79320 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123830139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 79321..80328 product fimbrial protein BcfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 80339..80884 product fimbrial protein BcfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368337.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 80894..81424 product fimbrial protein BcfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 81417..82136 product pili/flagellar-assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 82146..82433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(82535..82828) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene lsrG CDS complement(82825..83712) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene lsrF CDS complement(83724..84725) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene lsrB CDS complement(84727..85704) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene lsrD CDS complement(85705..86736) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene lsrC CDS complement(86733..88220) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene lsrA CDS 88436..89407 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098851.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene lsrR CDS 89441..91021 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene lsrK CDS 91207..93228 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(93319..94455) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene rlmG CDS 94539..95042 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 95113..96111 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 96363..97328 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 97584..98825 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene sstT CDS complement(98912..100399) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(100417..101829) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene uxaC CDS 102304..103602 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 103783..104559 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene exuR CDS 104904..105566 product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene yqjA CDS 105569..105952 product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene mzrA CDS 106096..106464 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 106494..106799 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 106801..107199 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 107196..107492 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 107744..108136 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 108208..109194 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 109301..109666 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(109708..110610) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 110715..111416 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(111478..112779) product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(112800..114068) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(114393..114803) product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(114956..117250) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098876.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene pflB CDS complement(117266..118477) product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098877.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene tdcD CDS complement(118505..119836) product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene tdcC CDS complement(119846..120835) product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene tdcB CDS complement(120936..121856) product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098880.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene tdcA CDS complement(122611..123315) product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene wcaA note possible pseudo, internal stop codon CDS complement(124613..125503) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene garR CDS complement(125525..126295) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene garL CDS 126669..128240 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene garD CDS complement(128394..129257) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene rsmI CDS 129362..131485 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 131443..131838 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 131860..132450 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene diaA CDS 132460..133035 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene dolP CDS complement(133101..134069) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(134178..134822) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 134951..135469 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(135449..135883) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 135940..136227 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(136214..136717) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(136711..137235) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 137447..138442 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 138450..139328 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 139407..140414 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(140501..141745) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene mtr CDS complement(141888..143783) product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(143964..144848) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene nlpI CDS complement(144957..147095) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene pnp CDS complement(147338..147607) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rpsO CDS complement(147762..148712) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene truB CDS complement(148712..149116) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene rbfA CDS complement(149206..151893) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene infB CDS complement(151918..153420) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene nusA CDS complement(153449..153871) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene rimP tRNA complement(154109..154185) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 154473..155819 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene argG tRNA complement(156006..156092) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(156102..156434) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene secG CDS complement(156658..157995) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene glmM CDS complement(157988..158836) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene folP CDS complement(158935..160878) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene ftsH CDS complement(160972..161598) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene rlmE CDS 161687..162019 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene yhbY CDS complement(162171..162647) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene greA CDS 162876..164309 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene dacB CDS 164312..164974 product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene pmrA CDS 164971..166014 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene pmrB CDS complement(166049..167224) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene cgtA CDS complement(167240..168205) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(168302..168559) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene rpmA CDS complement(168579..168890) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene rplU CDS 169148..170119 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene ispB CDS 170349..170636 product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene sfsB CDS complement(170697..171956) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene murA CDS complement(172007..172261) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene ibaG CDS complement(172388..172681) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098932.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene mlaB CDS complement(172681..173316) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098933.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene mlaC CDS complement(173335..173883) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene mlaD CDS complement(173888..174670) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene mlaE CDS complement(174678..175490) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098935.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene mlaF CDS 175718..176695 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 176709..177695 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene kdsD CDS 177710..178276 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene kdsC CDS 178273..178848 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene lptC CDS 178817..179371 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098940.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene lptA CDS 179378..180103 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene lptB CDS 180151..181584 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rpoN CDS 181607..181894 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene hpf CDS 181977..182468 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ptsN CDS 182514..183368 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rapZ CDS 183365..183637 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene npr CDS complement(183679..184341) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene mtgA CDS complement(184401..185054) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene elbB CDS complement(185287..187605) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene arcB CDS complement(187756..188838) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene lptG CDS complement(188838..189917) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene lptF CDS 190205..191716 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene pepA CDS 191836..192279 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene holC CDS 192279..195134 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 195258..195761 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098953.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 195845..196864 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(196908..198548) product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 198686..200188 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(200168..201151) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097533874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 201797..206257 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098958.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene gltB CDS 206267..207685 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098959.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene gltD CDS complement(207868..208428) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098960.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(208425..210839) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(210855..211472) product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(211794..212357) product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 note possible pseudo, internal stop codon CDS complement(212808..213299) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098964.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene sspB CDS complement(213311..213949) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene sspA CDS complement(214258..214650) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rpsI CDS complement(214666..215094) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene rplM CDS complement(215395..216519) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene zapE CDS 216709..217107 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene zapG CDS 217279..218646 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene degQ CDS 218738..219805 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene degS CDS complement(219862..220800) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene mdh CDS 221198..221668 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene argR CDS 222044..222307 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene yhcN CDS 222418..222684 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene yhcN CDS complement(222746..223018) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(223064..224518) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(224609..226576) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene aaeB CDS complement(226582..227514) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene aaeA CDS complement(227522..227725) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene aaeX sequence002 source 1..135339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..574) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene mobB CDS complement(571..1155) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene mobA CDS 1224..1493 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099387.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 1569..2555 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 2582..3205 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099385.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene dsbA CDS complement(3229..3978) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 4692..7370 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene polA CDS complement(7683..8312) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene yihA CDS 8893..9408 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene yihI CDS 9597..10970 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene hemN CDS complement(11071..11217) product YshB family small membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(11292..12704) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene glnG CDS complement(12716..13765) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene glnL CDS complement(13936..15345) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene glnA CDS 15722..17545 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene typA CDS complement(17626..18369) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene ompL CDS complement(18387..19811) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(19854..21236) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(21282..22046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 note possible pseudo, internal stop codon CDS complement(22095..23306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 note possible pseudo, internal stop codon CDS complement(23323..24564) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene yihS CDS complement(24579..25454) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420844.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene yihT CDS complement(25472..26362) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene yihU CDS 26518..26763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 note possible pseudo, frameshifted CDS 26661..27422 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 note possible pseudo, frameshifted CDS 27457..28251 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(28292..31168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 32405..33148 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 33148..33615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 33704..34303 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene yihX CDS 34297..35178 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 35175..35612 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099363.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene dtd CDS 35657..36598 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099362.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene fabY CDS complement(36607..37380) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 note possible pseudo, internal stop codon CDS complement(37747..38676) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene fdhE CDS complement(38673..39308) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene fdoI CDS complement(39305..40207) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene fdxH CDS complement(40220..43270) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086527976.1 transl_table 11 codon_start 1 transl_except (pos:42683..42685,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_02530 gene fdnG CDS 43642..44478 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene fdhD CDS 44593..44805 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(44846..45169) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(45169..45828) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 45931..46479 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 46497..47492 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 47596..49719 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 49764..51029 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 51192..51812 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene sodA CDS 51884..52558 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene yiiM CDS complement(52612..53985) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene cpxA CDS complement(53982..54680) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene cpxR CDS 54831..55337 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene cpxP CDS complement(55520..56500) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(56570..56863) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(57105..57341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 57436..57708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 57735..57950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 58126..58353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 58371..58643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 58711..58932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 58932..59483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 59492..59719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 59716..60681 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene dam CDS 60681..60887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 60884..61057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 61981..64620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 64738..65436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(65828..66880) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(66883..68604) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 68801..69598 product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 69622..70671 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 70718..71581 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene gpM CDS 71685..72182 product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 72182..72382 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 72373..72654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 72651..73202 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 73199..73594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 73736..74185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 74182..74823 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 74823..75407 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077826354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 75404..75772 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 75759..76655 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 76648..77262 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 77252..78718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 78721..79176 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106835.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 79372..79710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(79718..80215) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(80216..83134) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(83124..83372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(83297..83596) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048619990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(83651..84166) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290456.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(84167..85348) product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 85500..86654 product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 87051..87434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 87667..88560 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene fieF CDS 88735..89697 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene pfkA CDS 89916..90905 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 91013..91756 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 91830..93134 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(93216..93983) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene tpiA CDS complement(94095..94691) product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 94804..95223 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(95224..95970) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene fpr CDS complement(96067..97077) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene glpX CDS complement(97201..98709) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene glpK CDS complement(98731..99576) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 99987..100226 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene zapB CDS complement(100343..100570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(100811..101296) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rraA CDS complement(101389..102309) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene menA CDS complement(102378..103712) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hslU CDS complement(103722..104252) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene hslV CDS complement(104347..105231) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene ftsN CDS complement(105430..106455) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene cytR CDS complement(106575..108770) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene priA CDS 108971..109183 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rpmE CDS complement(109232..109549) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene metJ CDS 109826..110986 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene metB CDS 110989..113421 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 113648..114535 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene metF CDS 114683..116863 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene katG CDS complement(116955..118058) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(118071..118733) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene fsa CDS complement(118862..119626) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(119721..122372) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ppc CDS complement(122619..123770) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene argE CDS 123859..124863 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene argC CDS 124873..125646 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene argB CDS 125721..127094 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene argH CDS 127391..128308 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene oxyR CDS complement(128291..129691) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene sthA CDS 129891..130526 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene fabR CDS 130536..130895 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(130985..132085) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene trmA CDS 132432..134279 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene btuB CDS 134224..135075 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene murI sequence003 source 1..2439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(38..1576) product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(1626..1973) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene tnpB CDS complement(1970..2368) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 sequence004 source 1..2275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1470..1697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 1838..1957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 sequence005 source 1..2223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..668) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703376.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(665..1738) product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703375.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 sequence006 source 1..1951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence007 source 1..1873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence008 source 1..1781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 351..776 product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(748..1347) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 sequence009 source 1..1701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..585 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 sequence010 source 1..1618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..1467) product reactive chlorine resistance oxidoreductase RclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene rclA sequence011 source 1..1495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..1009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 sequence012 source 1..1432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..1259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 sequence013 source 1..125138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(635..1024) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(1361..2410) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 2556..3773 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099153.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(3778..4335) product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(4408..5073) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099151.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 5241..5483 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene tusA CDS 5528..5788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(5925..6476) product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene yhgN CDS 6696..7799 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene asd CDS 8048..10234 product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene glgB CDS 10231..12204 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene glgX CDS 12222..13517 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene glgC CDS 13517..14950 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene glgA CDS 14969..17416 product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene glgP CDS complement(17504..19012) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene glpD CDS 19201..19533 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene glpE CDS 19581..20411 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene glpG CDS 20428..21186 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(21272..23977) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene malT CDS 24566..26959 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene malP CDS 26969..29047 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene malQ CDS complement(29135..30451) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene gntT CDS complement(30768..31343) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene nfuA CDS 31453..31800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(31883..32101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 32124..32906 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene bioH CDS complement(32878..33117) product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene feoC CDS complement(33130..35448) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene feoB CDS complement(35479..35706) product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene feoA CDS complement(36026..38356) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(38445..38918) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene greB CDS 39147..39866 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene ompR CDS 39872..41209 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene envZ CDS complement(41276..42895) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene pckA CDS complement(43249..44127) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene hslO CDS complement(44152..44553) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene hslR CDS complement(44550..45233) product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene yrfG CDS complement(45301..47436) product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 47761..48321 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene nudE CDS complement(48402..50882) product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099079.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene mrcA CDS 51075..51851 product pilus assembly protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099078.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 51848..52342 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 52346..52801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 52845..53195 product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 53122..54345 product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene hofQ CDS 54632..55153 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene aroK CDS 55322..56299 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene aroB CDS 56392..57693 product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene damX CDS 57761..58573 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene dam CDS 58615..59292 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene rpe CDS 59285..60046 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene gph CDS 60039..61043 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene trpS CDS complement(61188..61358) product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(61496..62869) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene cysG CDS complement(63004..63330) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene nirD CDS complement(63327..65870) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene nirB CDS 66110..67411 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(67430..68614) product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene tsgA CDS 68893..69465 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene ppiA CDS 69571..70155 product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 70186..70749 product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene pabA CDS 70821..72056 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(72053..74140) product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(74198..74830) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene crp CDS 75142..75546 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(75632..76501) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(76532..76750) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(76747..77769) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 77998..79653 product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene mdcA CDS 79653..80510 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 80520..80819 product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene mdcC CDS 80812..81645 product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 81642..82445 product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene mdcE CDS 82568..83527 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 83530..84147 product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 84147..85043 product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene mdcH CDS complement(85128..86060) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(86074..87978) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 88117..88668 product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene kefG CDS 88668..90473 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene kefB CDS 90487..90687 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 90782..91372 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene slyD CDS complement(91424..91615) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 91881..92699 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene fkpA CDS 92866..93588 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 93588..93974 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene tusD CDS 93974..94333 product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene tusC CDS 94341..94628 product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene tusB CDS 94753..95127 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rpsL CDS 95224..95694 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene rpsG CDS 95791..97905 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene fusA CDS 97975..99159 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene tuf CDS 99339..99533 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene bfd CDS 99606..100082 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene bfr CDS complement(100066..100539) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 100920..101231 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rpsJ CDS 101264..101893 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rplC CDS 101904..102509 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rplD CDS 102506..102808 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene rplW CDS 102826..103647 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301859.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene rplB CDS 103664..103942 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene rpsS CDS 103957..104289 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rplV CDS 104307..105008 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene rpsC CDS 105021..105431 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rplP CDS 105431..105622 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099027.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rpmC CDS 105622..105876 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene rpsQ CDS 106043..106414 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene rplN CDS 106425..106739 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene rplX CDS 106754..107293 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene rplE CDS 107308..107613 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene rpsN CDS 107644..108036 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene rpsH CDS 108049..108582 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rplF CDS 108592..108945 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099023.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene rplR CDS 108960..109460 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene rpsE CDS 109467..109646 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene rpmD CDS 109650..110084 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rplO CDS 110092..111423 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene secY CDS 111718..112074 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rpsM CDS 112091..112480 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003031137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rpsK CDS 112513..113133 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene rpsD CDS 113159..114148 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene rpoA CDS 114189..114572 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rplQ CDS 114680..115048 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 115051..115476 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene zntR CDS 115534..115749 product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099018.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(115750..116160) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene mscL CDS complement(116307..117683) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene trkA CDS complement(117706..118968) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene rsmB CDS complement(119045..119992) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene fmt CDS complement(120018..120527) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene def CDS 120655..121779 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene dprA CDS 121751..122224 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene smg CDS 122251..122805 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 122798..123370 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene tsaC CDS 123375..124193 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene aroE CDS 124190..124438 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(124414..124968) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 sequence014 source 1..1259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 508..945 product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 945..1115 product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 sequence015 source 1..1198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence016 source 1..1161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 886..1152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 sequence017 source 1..1148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence018 source 1..1087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1048 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483023.1:site-specific integrase locus_tag LOCUS_05040 sequence019 source 1..1037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence020 source 1..1010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..961 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097284.1:site-specific integrase locus_tag LOCUS_05050 sequence021 source 1..1009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705914.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 misc_feature complement(468..>1009) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095946.1:YqaJ viral recombinase family protein locus_tag LOCUS_05070 sequence022 source 1..898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 683..850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 sequence023 source 1..843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(13..>843) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000427623.1:IS110-like element IS4321 family transposase locus_tag LOCUS_05090 sequence024 source 1..120583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 902..1039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 1498..3138 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene sapA CDS 3135..4100 product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096396.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene sapB CDS 4087..4977 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene sapC CDS 4977..5969 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene sapD CDS 5971..6777 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene sapF CDS 6926..7867 product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(7848..8912) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096389.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(8909..9613) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 9879..10271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 10367..13462 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 13733..14521 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene fabI CDS 14677..15663 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 15752..17686 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 18010..20001 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene pdeR CDS complement(19998..20867) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 21061..21243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 21288..22040 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 22300..22518 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene osmB CDS complement(22624..22950) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene yciH CDS complement(22950..23687) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene pyrF CDS complement(23873..25042) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene lapB CDS complement(25049..25357) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096374.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(25506..26273) product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene pgpB CDS 26470..27060 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene ribA CDS complement(27097..29772) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene acnA CDS complement(30820..31794) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene cysB CDS complement(31982..34579) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene topA CDS 34979..35230 product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856804.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(35265..36311) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096366.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene sohB CDS 36564..37325 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 37322..37912 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene cobO CDS complement(37948..38823) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rluB CDS complement(38920..39540) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(39537..40418) product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rnm CDS 40698..42260 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 42260..43855 product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene trpD CDS 43859..45217 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene trpCF CDS 45228..46421 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene trpB CDS 46421..47230 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene trpA CDS 47412..48623 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene yedE CDS 48620..48853 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene yedF CDS 48980..49318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(49365..49997) product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene ompW CDS 50710..51453 product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 51510..52049 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 52154..52549 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene yciA CDS complement(52588..53310) product TonB system transport protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene tonB CDS 53531..53827 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(53869..54822) product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(54921..55556) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene leuE CDS complement(55668..55841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 note possible pseudo, frameshifted CDS 55986..57446 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene cls CDS 57480..57809 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(57841..58563) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(58725..59729) product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene oppF CDS complement(59726..60739) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(60751..61659) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene oppC CDS complement(61672..62592) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene oppB CDS complement(62677..64308) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene oppA CDS complement(65079..65726) product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 66205..68883 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene adhE CDS complement(68952..69566) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene tdk CDS 70059..70529 product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene hns CDS complement(70731..71639) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene galU CDS complement(71840..72853) product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene rssB CDS complement(72945..73847) product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene rssA CDS 73962..74420 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 74467..75309 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene purU tRNA 75467..75551 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 75587..75671 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(75925..76305) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214575952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 76476..77372 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(77369..78046) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene narI CDS complement(78046..78756) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene narJ CDS complement(78753..80288) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene narH CDS complement(80285..84028) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(84407..85648) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 86147..87910 product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene narX CDS 87903..88553 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856701.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene narL CDS complement(88557..89780) product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 89790..89930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(90011..92536) product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(92533..96519) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene nirB CDS complement(96533..97321) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(97331..98209) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ntrB CDS complement(98212..99459) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(99688..100872) product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene nasR CDS 100945..101298 product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 101405..103189 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 103401..103640 product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(103670..104365) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(104543..104776) product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene chaB CDS 105044..106144 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene chaA CDS complement(106260..107114) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene kdsA CDS complement(107151..107960) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene sirB1 CDS complement(108082..108912) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene prmC CDS complement(108912..109994) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene prfA CDS complement(110036..111292) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene hemA CDS 111494..112105 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene lolB CDS 112102..112971 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene ispE CDS 113097..114044 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene prs CDS 114169..115848 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene dauA CDS complement(115834..116892) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(117014..117289) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene ychH CDS 117564..118148 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene pth CDS 118275..119369 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ychF CDS complement(119717..120097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(120094..120249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 sequence025 source 1..807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence026 source 1..788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 sequence027 source 1..745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 sequence028 source 1..708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..548 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 sequence029 source 1..680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 sequence030 source 1..655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..597 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145832239.1:group II intron reverse transcriptase/maturase locus_tag LOCUS_06210 sequence031 source 1..649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence032 source 1..609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence033 source 1..598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence034 source 1..595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence035 source 1..117997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..1354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 note possible pseudo, frameshifted CDS 1342..1704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 note possible pseudo, frameshifted CDS 1801..2802 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene add CDS complement(2856..3896) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 4104..4265 product division septum protein Blr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168112406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene blr CDS 4497..4712 product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene ydgT CDS 4799..5239 product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 5316..5897 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rsxA CDS 5897..6475 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene rsxB CDS 6468..8489 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene rsxC CDS 8490..9542 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rsxD CDS 9553..10173 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene rsxG CDS 10176..10862 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 10859..11494 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096904.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene nth CDS 12087..13595 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene dtpA CDS 13701..14306 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene gstA CDS complement(14398..15258) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene pdxY CDS complement(15325..16599) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene tyrS CDS complement(16725..17381) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene pdxH CDS complement(17439..17762) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene mliC CDS complement(17856..18980) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene anmK CDS 19236..19703 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene slyB CDS 20032..21264 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(21300..21734) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene slyA CDS 21927..22163 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 22166..23026 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 23026..25059 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(25038..25556) product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene sodC CDS complement(25637..26533) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096918.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(26582..26821) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 26971..28596 product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene eptA CDS 28638..29237 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 29292..30389 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 30490..30897 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene gloA CDS 30993..31652 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene rnt CDS complement(31728..32075) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003832760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene grxD CDS 32414..33187 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 33310..33891 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene sodB CDS complement(33930..35096) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 35095..35367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 35647..36672 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene purR CDS complement(36690..37601) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096930.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene punR CDS 37716..38915 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene punC CDS 39214..40362 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene cfa CDS complement(40394..41035) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 41261..42634 product MdtK family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene mdtK tRNA 42788..42864 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 42869..42945 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 43065..44660 product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(44689..45324) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(45397..46179) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 46306..46446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(46492..47898) product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(48043..48228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 48450..49286 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 49286..50104 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 50104..50880 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 50864..51550 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(51531..51740) product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene fumD CDS complement(51851..52663) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(52812..53480) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(53473..54495) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 54896..56266 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 56278..57423 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096949.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 57801..59213 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096950.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene pykF CDS 59524..59760 product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene lpp CDS complement(59821..60834) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096951.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(60932..61348) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene sufE CDS complement(61363..62583) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene sufS CDS complement(62580..63851) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene sufD CDS complement(63826..64572) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene sufC CDS complement(64582..66072) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene sufB CDS complement(66081..66449) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096957.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene sufA CDS complement(66762..67490) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(67679..68899) product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 69251..69490 product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene ycgZ CDS 69845..70123 product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 70314..72464 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene fdhF CDS 72728..73225 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(73276..73470) product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(73556..73966) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene menI CDS complement(73963..77019) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 77220..78335 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene ydiK CDS complement(78656..81031) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(81035..82435) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(82670..85048) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene ppsA CDS 85384..86217 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene ppsR CDS 86370..87416 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene aroH CDS 87613..87795 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene hemP CDS 87868..89850 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 89886..90914 product hematinate-forming heme oxygenase ChuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene chuS CDS 90911..91732 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 91732..92724 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 92717..93496 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(93535..94977) product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene selO CDS complement(95039..95755) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(96049..96513) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(96588..97343) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene btuD CDS complement(97343..97894) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(97917..98897) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene btuC CDS complement(99001..99300) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene ihfA CDS complement(99305..101692) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene pheT CDS complement(101708..102691) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene pheS CDS complement(102996..103352) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rplT CDS complement(103402..103599) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene rpmI CDS complement(103697..104131) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023616141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene infC CDS complement(104243..106171) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene thrS CDS 106659..106895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(106875..107633) product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 107929..108861 product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene pfkB CDS 108968..109258 product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene ghoS CDS 109364..110224 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(110261..110797) product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 110946..111617 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene hxpB CDS 111707..112309 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 112437..113828 product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene tcyP CDS complement(113878..114132) product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene cedA CDS 114321..116570 product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene katE CDS complement(116665..117414) product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene chbG misc_feature complement(117426..>117997) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097019.1:6-phospho-beta-glucosidase locus_tag LOCUS_07390 sequence036 source 1..577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 sequence037 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence038 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence039 source 1..537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence040 source 1..518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence041 source 1..461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence042 source 1..425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 sequence043 source 1..416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence044 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence045 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence046 source 1..111270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..525 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172412315.1:recombinase family protein locus_tag LOCUS_07420 CDS 742..969 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 1456..1707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 1704..1919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(2003..3424) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095878.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 3511..4122 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095879.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 4201..5271 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095880.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 5375..8464 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(8504..9325) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 9458..9730 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(9723..11288) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 11508..11768 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(11908..12618) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095885.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 12720..14180 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(14152..14619) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095887.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(14737..15288) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene maa CDS complement(15495..15713) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(15741..16115) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene tomB CDS complement(16625..19771) product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene acrB CDS complement(19794..20861) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene acrA CDS 21128..21781 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene acrR CDS 21895..25242 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene mscK CDS complement(25239..25421) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rsmS CDS complement(25436..25963) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene priC CDS 26014..26391 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 26543..27094 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene apt CDS 27183..29111 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene dnaX CDS 29166..29498 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 29498..30103 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene recR CDS 30214..32088 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene htpG CDS 32284..32928 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809841.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene adk CDS 33053..34015 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095900.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene hemH CDS 34078..35382 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(35492..37168) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ybaL CDS complement(37401..38609) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 38779..40431 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene ushA CDS complement(40522..41001) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene ybaK CDS complement(41200..41994) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(42045..44543) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene copA CDS 44652..45062 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene cueR CDS complement(45059..45511) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(45508..46422) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(46467..47318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 47462..48133 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene fetA CDS 48126..48908 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene fetB CDS complement(48958..49812) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(49871..50641) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(50670..51326) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene tesA CDS 51264..51950 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 51947..54361 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 54545..55690 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(55778..56848) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene mnmH CDS complement(56934..58001) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095918.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene purK CDS complement(57998..58507) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene purE CDS complement(58679..58876) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(59013..59735) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene lpxH CDS complement(59739..60233) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene ppiB CDS 60408..61793 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene cysS CDS complement(61880..62401) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(62475..63491) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene malI CDS complement(63575..65074) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(65358..65570) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene ybcJ CDS complement(65572..66438) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene folD CDS 66748..67311 product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene fimA CDS 67380..67925 product type 1 fimbrial protein subunit FimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene fimI CDS 68005..68652 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene fimC CDS 68667..71231 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 71245..72249 product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene fimH CDS 72259..72783 product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene sfmF CDS complement(72835..73467) product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene fimZ CDS complement(74268..74837) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 74730..74930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(75021..75719) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 tRNA 75998..76074 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 76177..77007 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 77366..78382 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097700.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 78407..79981 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 79968..81014 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 81164..81439 product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene yahO CDS 81625..83808 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 83935..85908 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 86012..87400 product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene pheP CDS 87646..88881 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 88897..89922 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 89915..91057 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 91133..92104 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(92105..93349) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(93415..94851) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 94959..95828 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 95979..96581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(96609..97262) product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene nfsB CDS complement(97383..97751) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(97741..98331) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 98558..99625 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 99658..99999 product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(100054..100302) product DUF1158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 100791..103499 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 103583..104644 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 104654..107809 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(107739..108860) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 108965..109855 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 109974..110120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 110131..110412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(110594..110992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 sequence047 source 1..390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence048 source 1..390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence049 source 1..382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence050 source 1..361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence051 source 1..332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence052 source 1..308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence053 source 1..307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence054 source 1..298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence055 source 1..278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence056 source 1..276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence057 source 1..108934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..663) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(711..1454) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 1606..2976 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(3022..3342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(3342..3887) product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095440.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 4299..5657 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(5726..6679) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene yjiA CDS complement(6690..6893) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(6990..9143) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(9335..10252) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(10431..10943) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(10961..12523) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene hpaB CDS complement(12719..13609) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene hpaA CDS complement(13581..14933) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene hpaX CDS complement(14955..15752) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene hpaI CDS complement(15762..16565) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene hpaH CDS complement(16672..17052) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(17062..17913) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene hpaD CDS complement(17916..19382) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene hpaE CDS complement(19379..20656) product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene hpaG CDS 20927..21367 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene hpaR CDS 21451..23115 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene tsr CDS complement(23207..23743) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(23743..24219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(24219..24959) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(25086..25964) product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(26033..28261) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(28242..29018) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(29021..29515) product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(29694..30332) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(30513..32810) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene opgB CDS complement(33075..33560) product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(33641..34378) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene dnaC CDS complement(34375..34920) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene dnaT CDS complement(35069..35497) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(35582..36073) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(36076..36717) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(36785..37258) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(37249..38025) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 38443..39180 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 39126..39812 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene bglJ CDS complement(39851..40309) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 40638..41984 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(42067..42855) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene fhuF CDS complement(42951..43775) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 44270..44500 product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 tRNA complement(44540..44626) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(44669..44755) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(44784..44870) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(45043..46071) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene rsmC CDS 46174..46587 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 46556..46999 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene rimI CDS 47020..47715 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene yjjG CDS 47789..49378 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene prfC CDS 49678..50295 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene osmY CDS 50423..50584 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 50705..51757 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095485.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 51757..52536 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(52531..53343) product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(53366..54913) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 55176..55955 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene deoC CDS 56045..57379 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene deoA CDS 57433..58656 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene deoB CDS 58760..59479 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene deoD CDS complement(59534..60550) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene lplA CDS complement(60590..61234) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095494.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 61352..62320 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene serB CDS 62395..63780 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene radA CDS 63816..65048 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095497.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene nadR CDS complement(65103..66104) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 66213..67112 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(67205..68872) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ettA CDS 69100..71037 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene sltY CDS 71093..71419 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene trpR CDS complement(71416..71931) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882672.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene yjjX CDS 71982..72629 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095504.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene gpmB CDS complement(72626..73495) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene robA CDS 73707..74180 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene creA CDS complement(74227..74943) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene arcA CDS 75579..76265 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 76626..79088 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene thrA CDS 79090..80019 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene thrB CDS 80023..81309 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene thrC CDS 81618..81899 product DUF2502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(81932..82705) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene yaaA CDS complement(82772..84202) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 84465..85418 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene tal CDS 85529..86116 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene mog CDS 86239..87561 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(87538..88104) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene satP CDS 88401..90314 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene dnaK CDS 90402..91547 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene dnaJ CDS 91721..92896 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene nhaA CDS 92955..93854 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene nhaR CDS complement(93914..94177) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene rpsT CDS 94507..95433 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene ribF CDS 95479..98295 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095526.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene ileS CDS 98295..98795 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene lspA CDS 98912..99361 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095528.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene fkpB CDS 99363..100313 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095529.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene ispH CDS 100519..101340 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095530.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene dapB CDS 101795..102943 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene carA CDS 102962..106186 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene carB CDS 106326..106559 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 misc_feature complement(106608..>108934) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_186277866.1:autotransporter outer membrane beta-barrel domain-containing protein locus_tag LOCUS_09460 sequence058 source 1..264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence059 source 1..263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence060 source 1..255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence061 source 1..251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence062 source 1..248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence063 source 1..242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence064 source 1..242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence065 source 1..240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(126..201) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence066 source 1..225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence067 source 1..213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence068 source 1..104562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1214..2791) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene guaA CDS complement(2859..4325) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene guaB CDS 4484..5857 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene xseA CDS 5916..6935 product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 6936..7286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(7283..7504) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(7555..8589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(8646..10190) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 10770..11129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(11122..11664) product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(11785..11970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(12036..12410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(13558..13839) product PerC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(13851..14312) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(14710..17481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(17494..18120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(18117..18338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(18335..18652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 note possible pseudo, frameshifted CDS complement(19123..19710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(19724..20071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(20071..20289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(20455..21318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(21315..22556) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(22802..24277) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882245.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene der CDS complement(24390..25568) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene bamB CDS complement(25579..26199) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(26213..27487) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene hisS CDS complement(27568..28686) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098277.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene ispG CDS complement(28713..29729) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rodZ CDS 29700..29882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(30022..31188) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(31358..31789) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860625.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene ndk CDS complement(32786..33574) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(33567..34196) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene dmsB CDS complement(34193..34603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 note possible pseudo, internal stop codon CDS complement(34634..36571) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 note possible pseudo, internal stop codon CDS complement(36658..38979) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene pbpC CDS complement(38987..43939) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 44228..45772 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 45785..47152 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 47243..48088 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene sseA CDS 48088..48858 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(48876..49652) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene sseB CDS complement(49749..51035) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene pepB CDS complement(51096..51296) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene iscX CDS complement(51298..51633) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene fdx CDS complement(51635..53485) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene hscA CDS complement(53500..54015) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098293.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene hscB CDS complement(54096..54419) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860659.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene iscA CDS complement(54433..54819) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene iscU CDS complement(54844..56058) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene iscS CDS complement(56178..56669) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene iscR CDS complement(56901..57626) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene trmJ CDS 57758..58561 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene suhB CDS complement(58621..59601) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(59592..60230) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 60422..61633 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene csiE CDS complement(61628..62773) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 62947..63369 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(63424..64677) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 64981..66171 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene hmpA CDS complement(66245..66583) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene glnB CDS complement(66649..67986) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene glrR CDS complement(67973..68710) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene qseG CDS complement(68712..70094) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene qseE CDS complement(70672..74559) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098307.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene purL CDS 74827..76377 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene mltF CDS complement(76265..76804) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene tadA CDS complement(76829..77464) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene yfhb CDS complement(77468..78829) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098311.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(78841..79734) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene murQ CDS 79852..80700 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 80747..81007 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(81004..81384) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene acpS CDS complement(81384..82115) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene pdxJ CDS complement(82191..82898) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene recO CDS complement(82916..83821) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene era CDS complement(83818..84432) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene rnc CDS complement(84721..85695) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene lepB CDS complement(85711..87510) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene lepA CDS complement(87695..88171) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene rseC CDS complement(88168..89121) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene rseB CDS complement(89121..89771) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene rseA CDS complement(89803..90378) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene rpoE CDS 90802..92421 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene nadB CDS complement(92406..93143) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 93276..94604 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene srmB CDS complement(94658..95041) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene grcA CDS 95356..96045 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene ung CDS complement(96086..97186) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 97391..97810 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene trxC CDS 97880..98578 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene tapT CDS 98614..101277 product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene pat CDS 101385..102743 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene pssA CDS 102789..103112 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(103109..104185) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 sequence069 source 1..212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence070 source 1..212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence071 source 1..206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence072 source 1..104521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(864..2648) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(2768..3877) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 4241..5641 product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene mmuP CDS 5628..6560 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene mmuM CDS 6787..7749 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene tauA CDS 7760..8527 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene tauB CDS 8524..9351 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene tauC CDS 9348..10196 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene tauD CDS complement(10303..12003) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(12131..13105) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene hemB CDS 13559..16333 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 16427..17050 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095800.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(17053..18213) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095801.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene ampH CDS 18418..18951 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 19066..20286 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene sbmA CDS 20301..21398 product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(21395..21694) product DUF2755 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095805.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 21942..22178 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095806.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(22175..23275) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ddlA CDS 23379..24062 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 24230..25444 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 25654..25914 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene iraP CDS 26014..27429 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene phoA CDS 27519..27839 product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene psiF CDS 27942..29045 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene adrA CDS complement(29062..29871) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene proC CDS 29969..30430 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 30572..31096 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene aroL CDS 31141..31332 product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene yaiA CDS 31570..32247 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 32319..32606 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene ppnP CDS complement(32655..33581) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rdgC CDS complement(33597..33773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 33693..34598 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene mak CDS complement(34709..37840) product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene sbcC CDS complement(37837..39042) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene sbcD CDS 39230..39919 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene phoB CDS 39941..41236 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene phoR CDS 41646..42965 product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene brnQ CDS 43047..44420 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene proY CDS 44583..46400 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene malZ CDS 46487..49108 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 49105..50490 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(50534..51136) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(51264..51716) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene acpH CDS 51711..51872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 51938..53008 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene queA CDS 53062..54189 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene tgt CDS 54212..54544 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene yajC CDS 54605..56419 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene secD CDS 56430..57401 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene secF CDS 57544..57909 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 57924..58604 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(58692..59582) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(59847..60386) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 60539..60988 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene nrdR CDS 60993..62096 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene ribD CDS 62184..62654 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene ribE CDS 62675..63094 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene nusB CDS 63172..64143 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene thiL CDS complement(64206..65180) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(65245..67107) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095842.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene dxs CDS complement(67132..68031) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095843.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene ispA CDS complement(68032..68274) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene xseB CDS 68466..69914 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene thiI CDS complement(70010..70603) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095845.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene yajL CDS complement(70566..71477) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095846.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene panE CDS 71599..72090 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(72122..73483) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095847.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(73634..74521) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene cyoE CDS complement(74533..74859) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(74859..75473) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(75463..77454) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene cyoB CDS complement(77471..78418) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene cyoA CDS complement(78898..80373) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene ampG CDS complement(80420..81052) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 81304..81621 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene bolA CDS 81952..83250 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene tig CDS 83511..84134 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene clpP CDS 84261..85535 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene clpX CDS 85718..88072 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene lon CDS 88283..88555 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene hupB CDS 88768..90639 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene ppiD CDS 90788..91168 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 91268..91666 product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(91728..92423) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene queC CDS complement(92489..94189) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 94073..94288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 94291..95109 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene cof CDS complement(95150..96196) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 96312..96770 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095868.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 96801..98573 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 98566..100347 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 100568..100906 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene glnK CDS 100942..102231 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene amtB CDS complement(102327..103187) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene tesB CDS 103391..103918 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(103951..104262) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 sequence073 source 1..104028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(666..1010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1004..1507) product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1504..3825) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(4117..5358) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene agp CDS 5511..5954 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 6080..6874 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(6876..7235) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 7336..8085 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(8087..8590) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097208.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 8979..9980 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097209.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(10066..11295) product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene hpxK CDS complement(11292..12533) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(12547..13284) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(13265..13921) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(13921..14586) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(14591..15373) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(15565..16404) product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene hpxU CDS 16547..18130 product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene hpxW CDS 18141..18329 product oxalurate catabolism protein HpxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097226.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene hpxX CDS 18326..19723 product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 19720..20106 product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097228.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene hpxZ CDS 19989..20231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(20222..21154) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene puuE CDS complement(21170..21910) product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene hpxA CDS complement(21910..22626) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 22771..24267 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 24367..25686 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene guaD CDS complement(25666..25989) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene uraH CDS complement(25986..26486) product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene uraD CDS 26726..27880 product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene hpxO CDS 27898..28932 product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene hpxD CDS 28944..29879 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 tRNA complement(29924..30011) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 30269..31426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 31423..31545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 31666..32673 product membrane-bound O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 32670..34103 product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 34121..34339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 34495..35331 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(35433..35690) product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 36005..36406 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 tRNA complement(36472..36559) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(36690..38318) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 38589..39248 product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097244.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene yccA CDS complement(39304..39780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(39777..40529) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 40838..41581 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 41657..42163 product CS1 type fimbrial major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 42236..44953 product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 44955..46112 product CfaE/CblD family pilus tip adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 46123..46638 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 46707..47036 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904442.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene tusE CDS complement(47033..47314) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene yccX CDS complement(47326..48114) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(48125..48682) product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene ybcL CDS 48871..50046 product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene rlmI CDS 50107..50424 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene hspQ CDS complement(50462..50875) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 51049..51711 product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 51780..52250 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene mgsA CDS complement(52311..54365) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene helD CDS 54489..54935 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 54955..57117 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene yccS CDS complement(57074..57700) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 57918..58427 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene sulA CDS 58782..59837 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883252.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene ompA CDS complement(59902..60354) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene matP CDS 60541..62301 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 62370..62888 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene fabA CDS complement(63382..63948) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene pqiC CDS complement(63945..65585) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene pqiB CDS complement(65590..66843) product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene pqiA CDS complement(66857..68764) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(68777..70885) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rlmKL CDS 70984..72093 product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(72090..72632) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene zapC CDS complement(72799..73809) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene pyrD CDS 74059..74634 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene ssuE CDS 74627..75589 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 75586..76731 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene ssuD CDS 76741..77532 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene ssuC CDS 77529..78299 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene ssuB CDS complement(78350..80962) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene pepN CDS 81387..81653 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 81776..81901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 note possible pseudo, frameshifted CDS complement(81882..82334) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(82337..83266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(83318..83911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(83908..85050) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208847.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(85052..85489) product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208848.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(85486..86028) product phage baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(86067..87152) product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(87149..88552) product DNA circularization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(88623..89189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(89237..91120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(91113..91247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(91262..91540) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(91542..91913) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(91917..93419) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208856.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(93416..93613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(93617..94162) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208858.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(94159..94518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(94523..94903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(94905..95954) product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522647.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(96052..96456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(96456..97025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(97027..97893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(97890..99527) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(99527..99790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(99799..101928) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(101864..102433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 102724..103227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(103369..103875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 sequence074 source 1..101430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..2983) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(3241..4038) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(4035..4385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(4517..5659) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene gspL CDS complement(5675..6685) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097345.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene gspK CDS complement(6763..7311) product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene gspJ note possible pseudo, internal stop codon, frameshifted CDS complement(7308..7691) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene gspI CDS complement(7684..8169) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene gspH CDS complement(8169..8618) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene gspG CDS complement(8622..9830) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene gspF CDS complement(9830..11308) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene gspE CDS complement(11323..13245) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene gspD CDS complement(13259..13990) product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene gspC CDS 14292..15857 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 15857..16489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(16490..17113) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(17389..18219) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(18216..18539) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 18637..19155 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 19382..20110 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene artP CDS 20130..20861 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene artJ CDS 20868..21584 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene artQ CDS 21584..22252 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene artM CDS 22427..23158 product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene artJ CDS complement(23245..24714) product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(24698..25423) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(25478..26605) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene rlmC CDS complement(26646..27119) product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(27185..28030) product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene potI CDS complement(28027..28980) product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene potH CDS complement(28991..30124) product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene potG CDS complement(30223..31335) product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene potF CDS complement(31687..32163) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(32227..33129) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene rimK CDS complement(33199..33921) product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene nfsA CDS 34107..34376 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(34412..34780) product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 35060..36745 product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 36999..37319 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 37360..38649 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 38662..39093 product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene arsC CDS complement(39163..40620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(40779..41342) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097419.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 41424..42638 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 42628..43440 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(43499..44731) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 45020..45628 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 45636..46244 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene ybjG CDS 46312..47070 product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene deoR CDS complement(47157..48383) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene dacC CDS 48604..49230 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(49231..50349) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(50456..50839) product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene bssR CDS 51056..52381 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene rimO CDS complement(52445..53356) product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene gsiD CDS complement(53358..54278) product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene gsiC CDS complement(54284..55822) product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene gsiB CDS complement(55846..57717) product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene gsiA CDS complement(57729..58667) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene iaaA CDS 58855..60087 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene moeA CDS 60089..60841 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene moeB CDS complement(60927..61589) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene fsa CDS 61719..62618 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 62623..65055 product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 65222..66037 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 66189..67451 product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(67448..68521) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355593.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 68810..70111 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 70129..72492 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(72576..74171) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 74394..75314 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ldtB CDS complement(75356..76072) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(76088..77410) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(77462..78838) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 79139..80242 product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(80357..81397) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(81502..82989) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(83025..84596) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(84593..85687) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(85789..86898) product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(86895..87368) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene mntR CDS 87552..87680 product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene mntS CDS 87964..89547 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(89707..90225) product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene ompX CDS complement(90310..90501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 90580..91467 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene rhtA CDS 91767..92270 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene dps CDS 92633..93376 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene glnH CDS 93470..94129 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene glnP CDS 94126..94848 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene glnQ CDS 94973..97186 product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene ybiO CDS complement(97235..98146) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene rlmF CDS 98390..98656 product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene mcbA CDS 98778..99044 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 99330..99590 product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097471.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ybiJ CDS complement(99709..100671) product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene ybiB sequence075 source 1..189342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..833 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098409.1:LysR substrate-binding domain-containing protein locus_tag LOCUS_13480 CDS complement(830..988) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1170..1469 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1479..2000 product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 2080..2259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(2298..2702) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098413.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene stpA CDS 3196..3645 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene alaE CDS complement(3678..4022) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 4183..4509 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 4753..4992 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene nrdH CDS 4989..5399 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene nrdI CDS 5372..7516 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene nrdE CDS 7526..8485 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene nrdF CDS 8816..10018 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene proV CDS 10011..11075 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098424.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene proW CDS 11085..12080 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene proX CDS 12267..13451 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 13766..14296 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene mprA CDS 14423..15595 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene emrA CDS 15612..17159 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene emrB CDS 17355..19010 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene leuA CDS complement(18997..19815) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(19826..20341) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene luxS CDS complement(20495..22039) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene gshA CDS complement(22123..22551) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152081995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(22548..23114) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene yqaB tRNA complement(23232..23308) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(23337..23413) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(23443..23519) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 23572..23644 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(23584..23660) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(23665..23757) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(24100..24285) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene csrA CDS complement(24527..27154) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene alaS CDS complement(27286..27786) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene recX CDS complement(27855..28913) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene recA CDS complement(29003..29500) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene pncC CDS complement(29631..30515) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(30530..31390) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(31387..32040) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(32341..33441) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645252.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene mltB CDS 33693..34256 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573335.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene srlA CDS 34253..35212 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 35225..35587 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene srlB CDS 35602..36381 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene srlD CDS 36474..36833 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene gutM CDS 36897..37670 product DNA-binding transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 37663..38628 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene gutQ CDS complement(38625..40169) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene norR CDS 40328..41770 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene norV CDS 41767..42900 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene norW CDS complement(42982..44004) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(44006..46222) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene hypF CDS complement(46228..46788) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833044.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene hydN CDS complement(46908..47921) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 48135..49586 product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ascF CDS 49605..51029 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(51111..51566) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene hycI CDS complement(51559..51969) product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(51966..52733) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(52733..53275) product formate hydrogenlyase complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(53285..54994) product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene hycE CDS complement(55010..55933) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(55935..57749) product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene hycC CDS complement(57746..58354) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098468.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(58426..58890) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene hycA CDS 59101..59451 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene hypA CDS 59455..60318 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene hypB CDS 60309..60581 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098473.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 60584..61705 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene hypD CDS 61702..62712 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene hypE CDS 62777..64849 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene flhA CDS 65003..66001 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 66001..67038 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 67038..67799 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 67816..69036 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(69042..69386) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 69562..69792 product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098482.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 69906..72467 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene mutS CDS complement(72606..72827) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(72838..74265) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(74255..74839) product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 75030..75437 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(75434..76321) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098490.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 76430..77632 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098491.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 77629..78009 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098492.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(78062..79054) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene rpoS CDS complement(79114..79995) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene nlpD CDS 80075..80260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(80355..80981) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(80975..81736) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene surE CDS complement(81717..82766) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene truD CDS complement(82763..83242) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene ispF CDS complement(83242..83952) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene ispD CDS complement(83972..84283) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene ftsB CDS complement(84450..84776) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(84835..85440) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene cysC CDS complement(85440..86864) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098504.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene cysN CDS complement(86874..87782) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene cysD CDS complement(87792..89150) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene cysG CDS 89388..90431 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(90530..91264) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene cysH CDS complement(91280..92992) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene cysI CDS complement(92992..94797) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene cysJ CDS 95104..95466 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene queD CDS complement(95555..96226) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene queE CDS complement(96299..96988) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098511.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(96988..98547) product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 98713..99537 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 99908..101005 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(101059..102357) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene eno CDS complement(102440..104077) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene pyrG CDS complement(104301..105092) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene mazG CDS complement(105159..107390) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene relA CDS complement(107442..108740) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rlmD CDS 108798..111557 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene barA CDS complement(111647..112786) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(112864..114201) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene gudD CDS complement(114217..115563) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(115563..116918) product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene gudP CDS complement(117253..117702) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(117727..118503) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene truC CDS complement(118500..118829) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(119462..120007) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene syd CDS 120077..120919 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene queF CDS 121036..122400 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene ppnN CDS 122916..124211 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 124277..125644 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098532.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 125757..126512 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene xni CDS complement(126576..127676) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene rlmM CDS complement(127669..128064) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(128104..128928) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene gcvA CDS complement(129371..129598) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499648.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 129791..130996 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene csdA CDS 130996..131442 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene csdE CDS complement(131433..132239) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene tcdA CDS complement(132315..133412) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098540.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene mltA tRNA 133621..133697 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 133742..133818 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 133863..133939 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(134027..135223) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene amiC CDS 135508..136839 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene argA CDS complement(136874..138694) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene recD CDS complement(138691..142233) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene recB CDS complement(142230..145112) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene ptrA CDS complement(145252..148626) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene recC CDS complement(148639..148962) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(148947..149348) product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098548.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(149345..149899) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(149896..150399) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(150546..151340) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene thyA CDS complement(151347..152222) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene lgt CDS complement(152415..154661) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene ptsP CDS complement(154674..155204) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene rppH CDS 155888..156580 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098554.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene mutH CDS 156805..156927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 157059..158099 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(158192..159385) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene lplT CDS complement(159378..161537) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene aas CDS 161963..162979 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098559.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene galR CDS complement(162940..163425) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 163646..164683 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(164653..165915) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene lysA CDS 166037..166963 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(166958..167650) product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(167741..168865) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene wzz(fepE) CDS complement(169074..170462) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098574.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(170801..171562) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene kduD CDS complement(171626..172462) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene kduI CDS complement(172704..173882) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(173976..174842) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 174947..175408 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020687112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 175528..176757 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420528.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(176813..177265) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 177388..177993 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(178163..178435) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(178446..178676) product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene yjdI CDS 179045..180685 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045909943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 180669..181385 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098687.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 181532..182620 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 182701..184470 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 184463..185533 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(185714..186070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(186073..186615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(187586..188572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(188663..189154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 sequence076 source 1..100838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..971) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1263..2768 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 2780..4705 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene iolD CDS 5010..5996 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene iolG CDS 6028..6957 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 7012..8559 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 8571..9599 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 9608..10741 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 10754..12658 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene iolC CDS 12670..13560 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene iolE CDS 13570..14394 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene iolB CDS complement(14450..15193) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(15205..15672) product DUF6130 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(15724..16953) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 17051..17980 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(17939..18127) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 18429..20720 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(20725..22263) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene ppx CDS complement(22267..24327) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ppk1 CDS complement(24532..25173) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene purN CDS complement(25170..26207) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene purM CDS 26474..27904 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 28129..28755 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene upp CDS 28842..30131 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene uraA CDS 30203..30928 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(31013..31369) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene arsC CDS complement(31388..32851) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene bepA CDS 33073..34137 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(34221..34691) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene bcp CDS complement(34691..35260) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 35406..36284 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene dapA CDS 36301..37335 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene bamC CDS 37445..38158 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 38279..39148 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 39148..41094 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 41168..41863 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene ypfH CDS complement(41903..42100) product YpfN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(42125..43252) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene dapE CDS complement(43263..43613) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098220.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(44170..47283) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene acrD CDS complement(47426..49120) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene narQ CDS 49273..51252 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene aegA CDS 51319..51912 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene nudK CDS 51984..53057 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(53154..55142) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene tkt CDS complement(55162..56112) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene tal CDS 56402..58681 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene maeB CDS complement(58761..59660) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene hemF CDS complement(59660..60535) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene amiA CDS 60748..61173 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 61160..61609 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 61673..62248 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 62341..63240 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 63416..64429 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene cysP CDS 64429..65262 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene cysT CDS 65262..66137 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene cysW CDS 66127..67221 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene cysA CDS 67340..68251 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene cysM CDS 68257..69093 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene pdxK CDS complement(69138..69647) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861316.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene crr CDS complement(69688..71415) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene ptsI CDS complement(71460..71717) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene ptsH CDS complement(72035..73006) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene cysK CDS complement(73170..73931) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene cysZ CDS complement(74219..74845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 74744..75145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 note possible pseudo, frameshifted CDS 75215..77230 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene ligA CDS 77232..77447 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(77444..78439) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 78529..79464 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(79461..79799) product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 tRNA complement(79926..80001) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(80006..80081) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(80111..80186) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(80228..80303) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 80562..81977 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene gltX CDS complement(82022..82393) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(82416..82778) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 tRNA 82996..83071 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 83113..83188 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 83716..85593 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(85638..86825) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 87237..88412 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420300.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(88445..88786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(88914..89912) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene mgrA CDS 90098..91756 product indolepyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene ipdC CDS complement(91757..92992) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 93198..94163 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene glk CDS complement(94199..94930) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(94934..96622) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 97027..98265 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene alaC CDS complement(98747..99664) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene lpxP sequence077 source 1..96206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..1908 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene purH CDS 1924..3216 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095019.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene purD CDS complement(3307..4005) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(4011..4283) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene hupA CDS complement(4470..5060) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(5102..5773) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095016.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene nfi CDS complement(5783..6847) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene hemE CDS complement(6886..7659) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095014.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene nudC CDS 7755..8240 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 8483..10378 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095012.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene thiC CDS 10378..11013 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene thiE CDS 11006..11761 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095010.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 11745..11945 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene thiS CDS 11947..12717 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene thiG CDS 12714..13841 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene thiH CDS 14178..15719 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 15900..16208 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 16208..16525 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(16583..20806) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene rpoC CDS complement(20883..24911) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene rpoB CDS complement(25231..25596) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene rplL CDS complement(25663..26160) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene rplJ CDS complement(26452..27156) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene rplA CDS complement(27160..27588) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene rplK CDS complement(27744..28289) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene nusG CDS complement(28291..28674) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene secE CDS complement(28904..30088) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene tuf tRNA complement(30207..30282) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(30289..30363) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(30481..30565) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(30574..30649) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 30991..31917 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene coaA CDS complement(31961..32974) product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene dppF CDS complement(32971..33954) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene dppD CDS complement(33965..34867) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene dppC CDS complement(34877..35896) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene dppB CDS complement(36074..37654) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 tRNA complement(38302..38378) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(38470..40161) product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene eptB CDS complement(40419..41621) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(41860..42294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 42722..43303 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene tag CDS 43281..43727 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(43690..46017) product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094982.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 46182..46844 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 47024..48040 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 48144..48893 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 48897..49835 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 49952..51232 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 51260..52234 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ghrB CDS complement(52293..52505) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene cspA CDS complement(52753..53463) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 53795..54082 product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(54122..55741) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(55952..58021) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene glyS CDS complement(58031..58942) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene glyQ CDS complement(59103..59309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 59591..60586 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(60579..61499) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(61499..62038) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(62142..63596) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene xylB CDS complement(63664..65049) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene xylA CDS 65358..66350 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene xylF CDS 66423..67964 product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 67942..69123 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene gguB CDS 69157..70335 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(70374..70946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 71512..73542 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 73726..74982 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094957.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene avtA CDS 75737..76468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 76559..78277 product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(78261..78716) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(78720..79538) product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene yiaJ CDS 79763..80761 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene yiaK CDS 80772..81239 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 81391..82317 product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 82361..83680 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 83776..85281 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 85278..85931 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene ulaD CDS 85934..86794 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 86788..87483 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094947.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene araD CDS complement(87571..88311) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 88429..89394 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(89391..90929) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(91016..92863) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene selB CDS complement(92860..94245) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene selA CDS complement(94349..94957) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(95048..96184) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 sequence078 source 1..92068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1426) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene icd CDS 1664..2197 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rluE CDS 2207..2680 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 2721..3833 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene mnmA CDS 3862..4491 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene hflD CDS 4511..5881 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene purB CDS 6002..6676 product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097083.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene phoP CDS 6689..8140 product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene phoQ CDS 8232..9353 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(9444..9935) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(10035..11258) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene pepT CDS 11414..11581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 11526..12644 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene potA CDS 12628..13485 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene potB CDS 13482..14273 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene potC CDS 14270..15304 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene potD CDS complement(15352..16581) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 16866..18749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(18795..19616) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene cobB CDS complement(19631..20542) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene nagK CDS complement(20596..21840) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene lolE CDS complement(21840..22541) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene lolD CDS complement(22534..23733) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene lolC CDS 23990..25063 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 25212..28658 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene mfd CDS 28806..29771 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097101.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(29847..30104) product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene bhsA CDS 30349..30984 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(31045..31584) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(31778..33082) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(33320..33862) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ycfP CDS complement(33897..34928) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene nagZ CDS complement(34946..35758) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene thiK CDS complement(35739..36386) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097109.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene lpoB CDS complement(36397..36771) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(36773..37132) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene hinT CDS complement(37379..38812) product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097113.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene ptsG CDS complement(39110..39904) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(39915..40919) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097115.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene holB CDS complement(40916..41557) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene tmk CDS complement(41547..42569) product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097117.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene yceG CDS complement(42572..43381) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene pabC CDS complement(43503..44744) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419106.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene fabF CDS complement(44836..45072) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene acpP CDS complement(45227..45961) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene fabG CDS complement(45974..46903) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene fabD CDS complement(46919..47872) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(47879..48883) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063411321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene plsX CDS complement(48994..49167) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene rpmF CDS complement(49184..49705) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene yceD CDS 49888..50430 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(50507..51427) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048027428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rluC CDS 52027..55155 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rne CDS complement(55202..56140) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 56250..57464 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(57540..58493) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene flgL CDS complement(58508..60148) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene flgK CDS complement(60224..61177) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene flgJ CDS complement(61177..62274) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(62287..62985) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene flgH CDS complement(63043..63825) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene flgG CDS complement(63837..64592) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(64613..65821) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene flgE CDS complement(65848..66558) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene flgD CDS complement(66570..66974) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene flgC CDS complement(66978..67394) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene flgB CDS 67540..68211 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097140.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene flgA CDS 68305..68598 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene flgM CDS 68603..69028 product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027944.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene flgN CDS complement(69088..70623) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene murJ CDS complement(70753..71589) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(71496..71690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 note possible pseudo, frameshifted CDS complement(71693..72343) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(72353..72937) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097146.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene rimJ CDS 73174..74382 product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene mdtH CDS 74506..75066 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 75193..76239 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene pyrC CDS 76314..76559 product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene dinI CDS 76834..77088 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene bssS CDS 77205..78323 product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene solA CDS 78693..79271 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 79273..79851 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(79893..80942) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 81164..82090 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 82222..83451 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene mdtG CDS 83548..83922 product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(83929..84156) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(84241..86769) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene mdoH CDS complement(86762..88288) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene mdoG CDS 88570..89709 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene mdoC CDS complement(89744..90286) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ymdB CDS complement(90392..90712) product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(90873..91205) product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene csgC CDS complement(91267..91719) product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene csgA sequence079 source 1..91499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..1419 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1554..2459 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(2508..3698) product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene nepI CDS complement(3801..4253) product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(4429..5820) product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094812.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene uhpT CDS complement(5953..7272) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(7265..8770) product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene uhpB CDS complement(8767..9360) product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene uhpA CDS complement(9443..9730) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene ilvN CDS complement(9734..11422) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene ilvB CDS complement(11735..12214) product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene tssD CDS complement(12420..13124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119936441.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 13926..14372 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 14435..15268 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 15477..16628 product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420858.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene emrD CDS complement(16531..17619) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094800.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(17704..18630) product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene dsdC CDS 18835..20172 product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032644228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene dsdX CDS 20190..21476 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene dsdA CDS complement(21560..21907) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(21897..22244) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(22337..23659) product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(23656..25278) product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094793.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 25500..26246 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(26214..27875) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094791.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(28048..28476) product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094790.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene ibpB CDS complement(28613..29023) product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177605.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene ibpA CDS 29410..29670 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685435.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(29667..30896) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(30947..31759) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene yidA CDS complement(31874..32899) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 33009..33944 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(33979..36390) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene gyrB CDS complement(36419..37492) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene recF CDS complement(37492..38592) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500170.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene dnaN CDS complement(38597..39922) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene dnaA CDS 40781..41107 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene rnpA CDS 41331..42974 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene yidC CDS 43047..44411 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene mnmE CDS 44523..45698 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159032.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 45667..46638 product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene yidZ CDS 46908..47507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099416.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 47544..48110 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(48202..49539) product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene adeP CDS 49705..50370 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099413.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene yieH CDS complement(50402..51577) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(51710..52435) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene phoU CDS complement(52462..53235) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene pstB CDS complement(53283..54173) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099412.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene pstA CDS complement(54173..55132) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene pstC CDS complement(55261..56301) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene pstS CDS complement(56547..57623) product fimbrial protein StgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene stgD CDS complement(57633..60152) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(60171..60752) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(60926..61507) product long polar fimbria major subunit LpfA-O113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(61936..63765) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene glmS CDS complement(63991..65361) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene glmU CDS complement(65500..65919) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(65940..67322) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene atpD CDS complement(67354..68217) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene atpG CDS complement(68269..69810) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene atpA CDS complement(69823..70356) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene atpH CDS complement(70371..70841) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene atpF CDS complement(70890..71129) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene atpE CDS complement(71179..71994) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene atpB CDS complement(72003..72383) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene atpI CDS complement(73000..73623) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene rsmG CDS complement(73731..75620) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene mnmG CDS complement(75995..76444) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene mioC CDS complement(76535..76993) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene asnC CDS 77145..78137 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene asnA CDS complement(78138..79589) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene viaA CDS complement(79583..81079) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene ravA CDS 81302..83170 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene kup CDS 83387..83806 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene rbsD CDS 83814..85319 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene rbsA CDS 85324..86289 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099395.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rbsC CDS 86317..87207 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099394.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene rbsB CDS 87299..88243 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene rbsK CDS 88247..89239 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene rbsR CDS complement(89205..90638) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene mdtD CDS complement(90635..91342) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 sequence080 source 1..81044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 46..121 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(219..1040) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene hdfR CDS 1159..1497 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1528..3048) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 3627..5273 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ilvG CDS 5270..5533 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene ilvM CDS 5552..6481 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene ilvE CDS 6542..8392 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099286.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ilvD CDS 8395..9939 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene ilvA CDS complement(9985..10884) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099284.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene ilvY CDS 11028..12503 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099283.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene ilvC CDS complement(12590..12871) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene ppiC CDS 12957..14981 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene rep CDS complement(15033..16517) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene gppA CDS complement(16524..17792) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rhlB CDS 17937..18266 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004386384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene trxA CDS 18612..19871 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene rho CDS 20213..21217 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene wecA CDS 21261..22277 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene wzzE CDS 22379..23464 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene wecB CDS 23461..24723 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene wecC CDS 24720..25397 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene rffC CDS 25402..26532 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene rffA CDS 26534..27784 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene wzxE CDS 27781..28860 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 28857..30209 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene wzyE CDS 30222..30962 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099269.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene wecG CDS 31160..32545 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 tRNA 32648..32724 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 32792..32867 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 32889..32974 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 33020..33096 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(33603..34814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(34987..36186) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099267.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene hemY CDS complement(36189..37385) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene hemX CDS complement(37406..38146) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene hemD CDS complement(38143..39018) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene hemC CDS 39434..41977 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene cyaA CDS complement(42067..42387) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099261.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene cyaY CDS 42523..42726 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 42762..43586 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene dapF CDS 43583..44290 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 44287..45189 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene xerC CDS 45189..45905 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene yigB CDS 46013..48175 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene uvrD CDS 48532..49482 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501540.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene corA CDS complement(49566..50462) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene rarD CDS complement(50514..50981) product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene yigI CDS 51145..52014 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099252.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene pldA CDS 52105..53934 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene recQ CDS 53996..54616 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833703.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene rhtC CDS complement(54613..55233) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene rhtB CDS 55343..56335 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene pldB CDS 56367..57167 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene yigL CDS 57250..58149 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(58037..58990) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene metR CDS 59106..61367 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene metE CDS complement(61412..62218) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 62474..63235 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene udp CDS 63376..64833 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene rmuC CDS 64900..65655 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene ubiE CDS 65669..66274 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene ubiJ CDS 66271..67911 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene ubiB CDS 67988..68242 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene tatA CDS 68246..68788 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099237.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene tatB CDS 68791..69561 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene tatC CDS 69591..70385 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099235.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene tatD CDS complement(70382..70873) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene rfaH CDS 71044..72537 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene ubiD CDS 72580..73281 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene fre CDS complement(73443..74606) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene fadA CDS complement(74616..76805) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099230.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene fadB CDS 76992..78326 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099229.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene pepQ CDS 78326..78940 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 78980..80431 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene trkH CDS 80442..80987 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene hemG sequence081 source 1..70777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..1633) product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(1633..3054) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(3056..4162) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(4210..5340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(5344..6204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(6683..7498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(7558..8820) product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene wzx CDS complement(8817..9374) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene rfbC CDS complement(9378..10259) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene rfbA CDS complement(10307..11206) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023616.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene rfbD CDS complement(11209..12291) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene rfbB CDS complement(12646..13542) product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene galF CDS complement(13719..15110) product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene wcaM CDS complement(15123..16343) product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene wcaL CDS complement(16340..17620) product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene wcaK CDS complement(17638..19116) product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene wzxC CDS complement(19118..20458) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene wcaJ CDS complement(20559..21929) product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene cpsG CDS complement(22041..23477) product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene cpsB CDS complement(23481..24704) product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097872.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene wcaI CDS complement(24701..25180) product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(25183..26148) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(26151..27272) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene gmd CDS complement(27297..27845) product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene wcaF CDS complement(27861..28607) product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene wcaE CDS complement(28624..29844) product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene wcaD CDS complement(29819..31036) product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene wcaC CDS complement(31033..31524) product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene wcaB CDS complement(31524..32366) product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene wcaA CDS complement(32432..34594) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene wzc CDS complement(34597..35040) product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene wzb CDS complement(35047..36102) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(36662..36823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 36871..38454 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097884.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(38530..40380) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene asmA CDS complement(40403..40984) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097886.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene dcd CDS complement(41076..41717) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene udk CDS 41700..41849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 42091..45393 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(45352..46230) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene alkA CDS 46361..47713 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene yegD CDS 47982..49184 product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 49184..52306 product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097900.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 52307..55384 product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097901.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene mdtC CDS 55385..56800 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 56797..58200 product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene baeS CDS 58197..58919 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097904.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene baeR CDS 59088..60449 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene yegQ CDS complement(60612..61109) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 61254..62153 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene yegS CDS complement(62207..63259) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene fbaB CDS 63510..64787 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 64784..65788 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097909.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 65785..66738 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097910.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(66712..67458) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(67501..68301) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene thiD CDS complement(68298..69068) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene thiM CDS 69392..69637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 69684..70115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 sequence082 source 1..67918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 269..2689 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene bcsB CDS 2693..3802 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene bcsZ CDS 3784..7266 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene bcsC CDS 7386..9392 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene hmsP CDS 9552..10838 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 11066..12559 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(12617..13546) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 13776..14549 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene pdeH CDS 14660..16657 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099208.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(16751..18073) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(18334..19359) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene yhjD CDS complement(19410..20309) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 20429..21187 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 21531..21944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(21923..22261) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099202.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(22333..22872) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099201.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 23020..24609 product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(24669..26321) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099199.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(26505..27857) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099198.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene gorA CDS complement(27929..28771) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 28979..31021 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene prlC CDS 31044..31781 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017384177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene rsmJ CDS complement(31873..32310) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene uspA CDS 32648..32929 product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene uspB CDS complement(32984..34483) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene pitA CDS 34712..35908 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(35941..36879) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099186.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(36879..37571) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 37741..38478 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(38513..39850) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214577462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 40166..40564 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395858.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 40728..41753 product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(41838..42497) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 42828..43265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(43271..44065) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(44098..44979) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420773.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 45079..45582 product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 45981..47048 product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene arnB CDS 47050..48033 product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene arnC CDS 48030..50012 product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene arnA CDS 50009..50911 product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene arnD CDS 50908..52563 product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099173.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene arnT CDS 52563..52898 product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene arnE CDS 52895..53275 product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene arnF CDS complement(53232..53840) product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene acpT CDS complement(53843..55072) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(55069..55800) product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(55797..56270) product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(56267..57436) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216358298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(57438..58016) product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(58013..60319) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149367168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(60306..60911) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(60908..61330) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(61334..63025) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099161.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(63016..63369) product hydroxymyristoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(63356..64717) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(64710..65297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(65304..65555) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(65664..65825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 note possible pseudo, internal stop codon CDS complement(65806..66621) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(66618..67340) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099155.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 misc_feature complement(67410..>67918) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000273200.1:methyltransferase locus_tag LOCUS_20610 sequence083 source 1..65248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..1684 product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene csy1 CDS 1681..2616 product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene csy2 CDS 2630..3628 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene csy3 CDS 3638..4192 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene cas6f CDS complement(4214..4687) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(4684..5127) product type II toxin-antitoxin system antitoxin Xre inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 repeat_region 5366..5813 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctctgccgtacaggcagcttagaaa CDS complement(5986..6204) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene infA CDS complement(6489..7193) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097324.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene aat CDS complement(7239..8960) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene cydC CDS complement(8960..10726) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097322.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene cydD CDS complement(10841..11809) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene trxB CDS complement(11787..12017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 12354..12848 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene lrp CDS 12984..16640 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 16769..17383 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097319.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene lolA CDS 17393..18736 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rarA CDS 18829..20121 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499983.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene serS CDS 20333..22777 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene dmsA CDS 22788..23405 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097316.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene dmsB CDS 23407..24270 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 24546..25694 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 25818..26348 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097313.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(26384..27124) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene pflA CDS complement(27328..29610) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene pflB CDS complement(29662..30519) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene focA CDS complement(30926..32686) product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene ycaO CDS 32814..33506 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 33669..34757 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene serC CDS 34827..36110 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene aroA CDS 36295..36978 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene cmk CDS 37090..38763 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499966.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene rpsA CDS 38934..39221 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene ihfB CDS 39435..41699 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 41735..43483 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene msbA CDS 43480..44457 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097302.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene lpxK CDS 44502..45731 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 45777..45959 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene ycaR CDS 45956..46702 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene kdsB CDS 46845..47738 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(47715..48494) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene elyC CDS 48619..49398 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene cmoM CDS 49402..50724 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene mukF CDS 50705..51409 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene mukE CDS 51409..55860 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene mukB CDS 56038..57861 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene ldtD CDS 58036..58587 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 58608..59255 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097289.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(59304..60494) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(60679..61737) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene ompF CDS complement(62344..63744) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene asnS CDS complement(63911..65113) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene pncB sequence084 source 1..58116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(799..1581) product replication initiation protein RepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807689.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene repE CDS complement(2012..3283) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(3283..3714) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene umuD CDS 3944..4918 product plasmid segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127849944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene parM CDS 4921..5583 product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 5587..5850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 5879..6079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 6170..6517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 7036..7503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 7814..8506 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 8503..8724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 8780..9202 product DUF1380 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(9405..10040) product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(10226..11197) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 11721..12149 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087148.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 12192..12602 product DUF1380 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 12652..12849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072050670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 13636..13908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 13952..14317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 14385..16397 product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 16441..16869 product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143347806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene psiB CDS 16866..17594 product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 17591..17917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 17973..18347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(18531..19055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 19753..21093 product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(21420..21632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 21736..22308 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 22508..23431 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(23475..23669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 23694..23933 product type II toxin-antitoxin system antitoxin RelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene relB CDS 23933..24220 product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323025.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene relE CDS 24496..24696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 25327..25641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050863355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 25703..25909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 25987..26448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 26536..26736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 26777..27568 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 27610..27762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 note possible pseudo, frameshifted CDS 27780..27938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 note possible pseudo, frameshifted CDS 28627..28920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 28937..29758 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(29787..30125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 30948..31334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(31372..32211) product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087192.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 32210..32563 product type IV conjugative transfer system pilin TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 32567..32869 product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene traL CDS 32876..33457 product TraE/TraK family type IV conjugative transfer system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 33469..34209 product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene traK CDS 34206..35615 product F-type conjugal transfer pilus assembly protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene traB CDS 35629..35922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 35919..36341 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 36334..36801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 36965..37360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 37414..37968 product type IV conjugative transfer system lipoprotein TraV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene traV CDS 37965..38219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 38216..40825 product type IV secretion system protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene traC CDS 40822..41235 product type-F conjugative transfer system protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015572098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene trbI CDS 41232..41867 product type-F conjugative transfer system protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087208.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene traW CDS 41864..42214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 42321..42536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 42659..43051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 43042..43320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 43311..44342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 44446..44661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 44717..45037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 45034..46032 product conjugal transfer pilus assembly protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235028129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene traU CDS 46043..46666 product type-F conjugative transfer system pilin assembly protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene trbC CDS 46663..48498 product type-F conjugative transfer system mating-pair stabilization protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087216.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene traN CDS 48495..49277 product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087217.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene traF CDS 49287..49754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 49751..49969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 49959..50570 product type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 50588..50851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 50848..51264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 51257..52621 product conjugal transfer pilus assembly protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087223.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene traH CDS 52621..56025 product conjugal transfer mating-pair stabilization protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087224.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene traG CDS 56027..56716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087225.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 56865..57596 product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032641144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene traT CDS 57788..58099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087227.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 sequence085 source 1..54724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 726..1070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 1067..1699 product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene mexL CDS 1730..2134 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2153..2665 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096749.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2646..3434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(3436..3633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 3890..4324 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 4321..5040 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096720.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 5037..6296 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 6298..7020 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 7017..8237 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096717.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 8234..8719 product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096716.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 8731..9240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 9237..9770 product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(9767..10225) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096713.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(10230..10664) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 10760..11722 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096711.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(11697..12725) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096710.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(12749..13723) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096709.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(13903..14394) product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene hcp CDS complement(14398..14583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(14648..15169) product DUF2778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193786.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 15437..15976 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096708.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(15984..16670) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(16761..17366) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene azoR CDS 17572..21474 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene hrpA CDS complement(21556..22215) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096704.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(22300..23679) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(23676..24758) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(24781..26310) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096701.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(26592..27884) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 28239..29033 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(29083..30084) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene gap CDS 30173..30331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 30274..30804 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene cybB CDS complement(30903..31970) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096694.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(31984..32727) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 33562..34803 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 34925..50260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 note possible pseudo, frameshifted CDS 50257..51132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 note possible pseudo, frameshifted CDS 51205..53385 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096691.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 53382..54209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 note possible pseudo, internal stop codon CDS 54210..54557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 note possible pseudo, internal stop codon sequence086 source 1..175755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(220..1419) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851503.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 tRNA complement(1595..1669) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(1745..2674) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098160.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2990..3742 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene mlaA CDS complement(3787..5115) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene fadL CDS 5482..5766 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098157.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 6045..7355 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene fadI CDS 7355..9502 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene fadJ CDS 9712..10197 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832802.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene sixA CDS complement(10244..10795) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098153.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene smrB CDS 10941..11873 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene prmB CDS 11934..13019 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098151.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene aroC CDS 13022..13846 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene mepA CDS 13846..14655 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 14655..15200 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 15214..15489 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(15587..17584) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene mnmC CDS 17743..18960 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098145.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene fabB CDS 19169..20347 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(20437..21441) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098143.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene flk CDS 21555..22691 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene pdxB CDS 22759..23772 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098141.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 23772..24584 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene truA CDS 24612..25271 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 25426..26331 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098138.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene accD CDS 26402..27670 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene folC CDS 27660..28358 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene dedD CDS 28524..29012 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene cvpA CDS 29046..30563 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene purF CDS 30563..31222 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 31514..32296 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene argT CDS 32523..33305 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene hisJ CDS 33394..34080 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 34077..34793 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 34802..35575 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020690627.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene hisP CDS complement(35674..36183) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(36228..37121) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(37135..37503) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene folX CDS complement(37579..38208) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098126.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene yfcG CDS 38349..38993 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene yfcF CDS 39050..39601 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098124.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene yfcE CDS 39657..40211 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene yfcD CDS complement(40215..41234) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 41469..41912 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 41993..42265 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 42281..43678 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 43675..44505 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 44498..45451 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(45563..47704) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene pta CDS complement(47781..48983) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098115.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene ackA CDS 49321..49776 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene yfbV CDS 49868..50362 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 50374..51033 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 51109..52941 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(53022..53621) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene yfbR CDS complement(53740..54954) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene alaA CDS 55917..56831 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene lrhA CDS 57462..57902 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014171000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene nuoA CDS 57918..58592 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene nuoB CDS 58682..60484 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene nuoC CDS 60487..60987 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene nuoE CDS 60984..62321 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene nuoF CDS 62377..65100 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene nuoG CDS 65097..66074 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene nuoH CDS 66088..66630 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861491.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene nuoI CDS 66641..67195 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500212.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene nuoJ CDS 67192..67494 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene nuoK CDS 67491..69332 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene nuoL CDS 69409..70938 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene nuoM CDS 70945..72402 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene nuoN CDS complement(72501..73505) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(73570..74487) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene rnz CDS 74559..75020 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420256.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 75074..75379 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene elaB CDS 75466..76761 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098096.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene menF CDS 76850..78520 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene menD CDS 78517..79293 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene menH CDS 79290..80147 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene menB CDS 80147..81112 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene menC CDS 81109..82470 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098091.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene menE CDS 82595..83134 product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098023.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 83229..84428 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(84462..85652) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene glpC CDS complement(85649..86866) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene glpB CDS complement(86856..88484) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene glpA CDS 88736..90088 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene glpT CDS 90100..91155 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene glpQ CDS complement(91252..91506) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene yfaE CDS complement(91506..92636) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene nrdB CDS complement(92691..94976) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene nrdA CDS complement(95325..96053) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098010.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene ubiG CDS 96200..98836 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene gyrA CDS 98972..101818 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene rcsC CDS complement(101930..102580) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene rcsB CDS complement(102597..105269) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene rcsD CDS 106013..107101 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 107217..108272 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene apbE CDS 108345..109403 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene ada CDS 109403..110059 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098003.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene alkB CDS 110072..111772 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 111963..113399 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene mgtE CDS complement(113362..114651) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 114857..116488 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene mqo CDS complement(116582..117085) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene eco CDS 117295..117555 product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 117680..118867 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 tRNA complement(118905..118981) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(119054..120814) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene yejM CDS complement(120834..121061) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135586.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 121196..122203 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene yejK CDS complement(122254..122538) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene rplY CDS complement(122664..124424) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097991.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 124577..125284 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene rsuA CDS 125300..126496 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 126776..127120 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(127124..128713) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene yejF CDS complement(128715..129743) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(129740..130834) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(130844..132649) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097984.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(132723..134279) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(134407..134871) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619753.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene mepS CDS complement(135392..136105) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136374357.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(136139..137125) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(137248..138735) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 138918..140108 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene uxuA CDS complement(140226..140798) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene yeiP CDS complement(141214..142395) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene setB CDS 142757..143887 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097968.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene fruB CDS 143887..144825 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene fruK CDS 144842..146527 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene fruA CDS complement(146574..147431) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene nfo CDS complement(147496..148542) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097963.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 148640..149506 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene yieE CDS 149665..151134 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097961.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 151407..153329 product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene cirA CDS complement(153433..154260) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene fghA CDS 154399..155547 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 155650..156318 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene folE CDS 156338..157495 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene yeiB CDS 157651..158673 product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene galS CDS 158969..159967 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene mglB CDS 160047..161567 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883073.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene mglA CDS 161583..162593 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene mglC CDS complement(162644..164044) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(164157..164873) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene sanA CDS complement(165001..165885) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene cdd CDS complement(166015..166710) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097948.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(166707..167102) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(167292..167996) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 168056..168853 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 168895..169827 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene dusC CDS 170130..171476 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 171643..172476 product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365726.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene bglG CDS 172613..174466 product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277858.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene bglF sequence087 source 1..53972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..796 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188259.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein locus_tag LOCUS_23890 CDS 811..3927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 4068..9068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(9122..11020) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833212.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene speA CDS 11902..13056 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene metK CDS 13498..14895 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene galP CDS 14996..15451 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 15546..16253 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene endA CDS 16305..17036 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene rsmE CDS 17056..18003 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene gshB CDS 18086..18646 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098664.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 18646..19062 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene ruvX CDS complement(19073..20053) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883139.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 20071..20772 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 20794..21360 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 21357..21653 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene yggU CDS 21657..22250 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098669.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 22243..23391 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene hemW CDS complement(23582..24298) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(24355..24681) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(24681..25400) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene trmB CDS 25539..26597 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene mutY CDS 26624..26896 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 27018..28097 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene mltC CDS 28316..29572 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098677.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(29652..30455) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene citG CDS complement(30433..30972) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098679.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene citX CDS complement(30969..32492) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098680.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene citF CDS complement(32503..33378) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098681.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene citE CDS complement(33375..33668) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene citD CDS complement(33685..34707) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene citC CDS complement(34721..35584) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(35602..36963) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 37308..38933 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045909943.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 38923..39615 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098687.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(39705..41840) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 42023..42736 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 tRNA 42832..42907 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 43087..44334 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 44448..45050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 45186..47117 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951079.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 47127..50087 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(50156..50725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(51064..51387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(51470..51985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(52012..52326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 sequence088 source 1..53923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(492..833) product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857836.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene osmE CDS 1055..1879 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene nadE CDS 1968..2873 product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097025.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene cho CDS complement(2851..3408) product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene ves CDS complement(3705..4199) product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene spy CDS complement(4538..5503) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097028.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene astE CDS complement(5514..6839) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097029.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene astB CDS complement(6826..8313) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene astD CDS complement(8310..9344) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene astA CDS complement(9341..10561) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 10995..11801 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097033.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene xthA CDS 11808..12491 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097034.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 12498..13667 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097035.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 13640..15169 product thiamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 15169..15789 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 15863..17170 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(17167..17784) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(17777..18346) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 18422..18838 product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097041.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(18798..19076) product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 19306..20649 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene gdhA CDS complement(20765..22678) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097044.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(22683..23726) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene selD CDS complement(23843..24394) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 24562..26418 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene sppA CDS 26482..27498 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097048.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene ansA CDS 27508..28149 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene pncA CDS 28371..29624 product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(29675..29947) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(29989..30402) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene msrB CDS 30744..31739 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene gapA CDS 31812..32696 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097054.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(32775..33521) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097055.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 33953..35887 product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene yeaG CDS 35944..37245 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 37345..37845 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(37866..38024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 38116..38562 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(38546..39337) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 39437..40624 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(40656..41363) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 41465..41809 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097067.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(41810..42115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097068.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(42196..42450) product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419130.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 42717..43787 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(44062..44310) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500746.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(44594..46066) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097071.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(46246..46407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 note possible pseudo, frameshifted CDS complement(46524..47795) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246475.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 note possible pseudo, frameshifted CDS 48002..49252 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097072.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 note possible pseudo, internal stop codon CDS 49280..49501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 note possible pseudo, internal stop codon CDS complement(49792..50037) product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097073.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(50112..50459) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(50537..50689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 51041..51604 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334583.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 note possible pseudo, internal stop codon CDS 51653..52234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(52217..53485) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457648.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 sequence089 source 1..53832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..1020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 1420..1830 product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173442.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(1874..2329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096818.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(2728..3231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 3293..3529 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087716.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(3595..4482) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 4663..5721 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 5771..6955 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 7040..7663 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096819.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 7823..8560 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831711.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 8837..9547 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene osmY CDS 9566..10465 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene osmX CDS 10474..11121 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene osmW CDS 11121..12269 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene osmV CDS 12372..13682 product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene clcB CDS complement(13617..14312) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene bioD CDS complement(14443..15663) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(15758..16690) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 16634..16798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 16791..18065 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096829.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(18130..19521) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(19511..19705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096831.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(19878..21296) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 21523..22275 product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene puuD CDS 22301..22858 product HTH-type transcriptional regulator PuuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096835.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene puuR CDS 23016..24509 product aldehyde dehydrogenase PuuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene puuC CDS 24506..25786 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096837.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 25812..27083 product 4-aminobutyrate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene puuE CDS 27234..28721 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096839.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 28902..29417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 29586..29966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 30245..31066 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(31068..33230) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705283.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(33315..33644) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096842.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene mdtI CDS complement(33631..34023) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene mdtJ CDS 34415..35449 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096844.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(35453..36400) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(36426..37451) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 37630..37977 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808895.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene yajD CDS complement(38015..38800) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096846.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 38925..39620 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096847.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 39617..40813 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 40892..42040 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096849.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 42037..45114 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096850.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(45133..45900) product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556107.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 45997..47442 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(47414..48298) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705466.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 48433..49413 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(49480..49908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(50002..51057) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096853.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 51155..52051 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096854.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(52059..53321) product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene umuC CDS complement(53305..53739) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882790.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene umuD sequence090 source 1..52752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(354..737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 note possible pseudo, internal stop codon CDS complement(741..1946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 note possible pseudo, internal stop codon CDS complement(1977..2327) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624688.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene tnpB CDS 2726..3028 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 3217..3648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 note possible pseudo, frameshifted CDS 3867..4943 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084879622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(5531..6367) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419039.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene fghA CDS complement(6432..6830) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(6874..7983) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene frmA CDS complement(8018..8293) product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene frmR CDS complement(8407..8700) product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087249.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(8829..9053) product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(9641..9937) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(10224..10433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 10796..14071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 14276..14605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 14705..15730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(15828..16655) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene dkgA CDS complement(16761..17924) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene yqhD CDS 18119..19018 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(19068..19727) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene yghB CDS complement(19871..21058) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098713.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene metC CDS 21310..22041 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098712.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene exbB CDS 22046..22471 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833267.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene exbD CDS complement(22515..22964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(22966..23370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098709.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 23474..23977 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 24060..24548 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098707.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(24613..25653) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(25835..28426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 28932..30089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 note possible pseudo, frameshifted CDS 30070..30477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 note possible pseudo, frameshifted CDS 30603..30857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 31060..31332 product protein YbjH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene ybjH CDS complement(31377..31703) product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(31716..32048) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(32241..32573) product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098702.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(32732..33598) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098701.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene yghU CDS 33844..35433 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727693.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 35479..36432 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278786.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 36438..37283 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065285.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 37276..38253 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291145.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 38250..39227 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 39411..41273 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene gss CDS complement(41326..41757) product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene pgaD CDS complement(41754..43085) product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene pgaC CDS complement(43078..45012) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098697.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene pgaB CDS complement(45024..47408) product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene pgaA CDS complement(47353..47547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 48303..48662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 48818..49147 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(49172..49543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 49786..50628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 50804..51022 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 51162..51479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 51545..51781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 51847..52143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 52206..52442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 sequence091 source 1..52744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 617..1099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 2043..2552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2579..3100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 3184..3507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 3843..4406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 4563..6059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(6217..9177) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(9187..11193) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 11388..12776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(12823..14097) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 tRNA complement(14278..14353) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(14518..16614) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(16734..18059) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097825.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(18056..19798) product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097824.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(19795..20742) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097823.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(20742..22484) product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097822.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 22623..23834 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420064.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(23831..24586) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene mtfA CDS 24988..26517 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 26612..27511 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(27486..28274) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(28271..29584) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(29865..31163) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097761.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 31270..32163 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058660535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(32152..33801) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097759.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene fumA CDS complement(33854..35362) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097758.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 35972..38752 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 38847..39809 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(39790..40509) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097755.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene dcuR CDS complement(40506..42122) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 42288..43151 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097753.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(43209..44351) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene ompC CDS 44636..45337 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097750.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 45399..46814 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097749.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 46795..47286 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(47258..48172) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene yedA CDS 48375..49262 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 49341..49523 product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097745.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 49597..50994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(50979..51779) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(52081..52308) product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene yodD CDS 52445..52633 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene dsrB sequence092 source 1..48929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 457..594 product YlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 594..1283 product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 tRNA 1377..1452 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1908..2156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 2158..2697 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101164.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 2676..3083 product DUF2570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309362.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 2971..3225 product Rz1 lytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198404582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 3387..3884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 3881..4138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 4196..4912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108106.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 4914..6245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 6257..7678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 7675..8499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 8512..10131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 10147..11007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 11024..12055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 12124..12606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 12603..13031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 13028..13465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 13449..14390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 14395..15789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 15793..16230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 16221..16826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 16950..18770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 18770..19486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 19483..19758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 19758..20777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 20774..21490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 21487..21819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 21816..23234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 23236..23940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 24303..25016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 25019..25432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 25449..25610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(25663..26025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096640.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 26870..28036 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097838.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene dacD CDS 28156..28629 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097837.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene sbmC CDS 28722..29780 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097836.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 29939..30274 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432067.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(30322..30657) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881834.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 tRNA complement(30711..30786) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 30982..32403 product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene emmdR tRNA 32507..32582 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(32728..34500) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097833.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(34519..35973) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(36047..37360) product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097831.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene shiA CDS 37552..38451 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene ldtA tRNA complement(38596..38671) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 38992..39909 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene nac CDS 40006..40956 product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097829.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene cbl CDS complement(41000..41608) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 41779..42426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(42461..43399) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097828.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 43499..43942 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 44452..45315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 45501..45719 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 45735..46064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 46078..46389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 46468..46758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 46808..47188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(47752..48018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(48109..48513) product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287388.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 sequence093 source 1..47601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 745..2652 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 2753..3901 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene mtlD CDS 3898..4488 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene mtlR CDS 4547..4909 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369186.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 5181..6836 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094927.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene lldP CDS 6833..7606 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686511.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene lldR CDS 7603..8790 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094925.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene lldD CDS 8972..9616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 9662..10135 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene trmL CDS complement(10132..10953) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene cysE CDS complement(11028..12047) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094921.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene gpsA CDS complement(12047..12514) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860835.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene secB CDS complement(12547..12798) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene grxC CDS complement(12810..13241) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094920.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 13489..15033 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094919.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene gpmM CDS complement(15097..15456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 15361..16326 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene envC CDS 16330..17262 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094917.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(17266..18066) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152082698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(18208..19233) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene tdh CDS complement(19243..20439) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene kbl CDS 20655..21587 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene rfaD CDS 21590..22636 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene rfaF CDS 22640..23626 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211479.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene rfaC CDS 23619..24728 product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene rfaQ CDS 24725..25834 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(25813..26916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 27147..28517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 28663..29646 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 29655..30626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 30645..32279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 32436..33710 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene waaA CDS 33710..34480 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 34484..34963 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094895.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene coaD CDS complement(34966..35775) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094894.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene mutM CDS complement(35848..36015) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene rpmG CDS complement(36038..36274) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene rpmB CDS complement(36493..37161) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094892.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene radC CDS 37331..38545 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528250.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene coaBC CDS 38523..38981 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene dut CDS 39102..39698 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369151.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene slmA CDS complement(39781..40422) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene pyrE CDS complement(40490..41206) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094888.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene rph CDS 41326..42195 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 42387..43649 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 44389..45591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(45937..46311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(46308..47141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 sequence094 source 1..45072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 472..816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 910..1155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 1152..1385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 1730..2098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704129.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 2748..3203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 3500..3850 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417647.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 4035..4286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(4343..5431) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094854.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(5577..6536) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(6639..7052) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene uraH CDS complement(7152..7877) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418306.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 7995..8519 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 8598..9644 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 9699..10154 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094870.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(10187..10708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 10986..11270 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 11312..12121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 note possible pseudo, frameshifted CDS 12324..13244 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095445.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 13283..14380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 14427..15998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 15995..16267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(16455..16958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 note possible pseudo, internal stop codon CDS complement(16965..17228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 note possible pseudo, internal stop codon, frameshifted tRNA complement(17796..17890) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 18180..19571 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 19584..21902 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094875.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene yicI CDS complement(22031..23725) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(23845..25236) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 25462..26664 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene gltS CDS complement(26667..28748) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene recG CDS complement(28752..29408) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene trmH CDS complement(29446..31560) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094882.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene spoT CDS complement(31580..31855) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene rpoZ CDS complement(31910..32533) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094883.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene gmk CDS 32785..34455 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094885.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene ligB CDS complement(34452..36104) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930873.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(36218..36835) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 37796..38593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 38590..41835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(43106..43339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 43624..44247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(44302..44685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 sequence095 source 1..43822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..956 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene dkgB CDS complement(986..1891) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095682.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene yafC CDS 1996..3171 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 3284..4108 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095684.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 4185..4958 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(5011..6195) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095686.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene mltD CDS complement(6444..7202) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene gloB CDS 7235..7951 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095688.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(7952..8419) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene rnhA CDS 8484..9215 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095690.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene dnaQ tRNA 9348..9424 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 9811..10530 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095718.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 10527..11540 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095719.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 11537..12616 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 12661..14133 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 14152..15093 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 15096..15971 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095723.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 15981..17582 product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095724.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(17641..18411) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(18520..20964) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095726.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene fadE CDS 21204..21782 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene lpcA CDS 21831..22598 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(22569..23309) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene dpaA CDS complement(23393..23590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 23608..24951 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 24955..26190 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095731.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 26183..26977 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 26970..27608 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 27615..28211 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095734.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene nqrE CDS 28222..29445 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene nqrF CDS 29448..29648 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686315.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene nqrM CDS 29757..30815 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095738.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene dinB CDS complement(30890..32347) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene pepD CDS 32608..33066 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene gpt CDS 33173..34417 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095741.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene frsA CDS 34475..34876 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025760274.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene crl CDS complement(35013..36065) product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095744.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene phoE CDS 36370..37473 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene proB CDS 37485..38738 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene proA tRNA 38850..38925 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(38940..39953) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(39980..40327) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130834290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(40369..40551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(40566..41237) product phage-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816496.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(41234..41455) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(41448..41633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(41749..43719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 sequence096 source 1..42591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 448..663 product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene bdm CDS 759..896 product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096533.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene sra CDS 1073..2770 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096532.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 3152..4861 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096531.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 5058..6068 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096530.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene adhP CDS 6218..7837 product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705506.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 7848..8792 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 8789..9640 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705508.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 9637..11244 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705509.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 11241..12230 product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 12241..12582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 note possible pseudo, internal stop codon CDS 12607..13332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 note possible pseudo, internal stop codon CDS complement(13339..14493) product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene araJ CDS 14681..15505 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096528.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene ppk2 CDS complement(15564..16220) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096526.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene fdnI CDS complement(16213..17097) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene fdxH CDS complement(17109..20156) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_table 11 codon_start 1 transl_except (pos:19569..19571,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_28520 gene fdnG CDS 20434..21255 product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene yddG CDS 21885..22958 product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(23015..23947) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene gcvA CDS 24103..25068 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 25077..26183 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 26180..26947 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 26940..27659 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 27688..28845 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 28863..29345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 note possible pseudo, frameshifted CDS 29342..30568 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992339.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(30635..32122) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 32240..32815 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 33023..34411 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096516.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 34439..38179 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096515.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 38176..39720 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene narH CDS 39720..40415 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096513.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene narW CDS 40412..41092 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene narI CDS complement(41178..41627) product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene yidI CDS complement(41722..42567) product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene nhoA sequence097 source 1..170611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..634) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095680.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene gmhB CDS 823..1854 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene metN CDS 1847..2500 product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 2541..3356 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene metQ CDS 3463..3867 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene rcsF CDS 3864..4571 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene tsaA CDS 4684..6402 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095675.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene proS CDS complement(6450..7148) product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095674.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene nlpE CDS complement(7183..7605) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene arfB CDS complement(7602..8147) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 8344..8544 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501889.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 8531..8791 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene rof CDS complement(8820..10109) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene tilS CDS complement(10168..10557) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095668.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(10623..12755) product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(12856..13815) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095666.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene accA CDS complement(13828..17310) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene dnaE CDS complement(17349..17945) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene rnhB CDS complement(17942..19090) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene lpxB CDS complement(19090..19878) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene lpxA CDS complement(19882..20337) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene fabZ CDS complement(20440..21465) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095661.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene lpxD CDS complement(21469..21963) product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene skp CDS complement(22086..24503) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene bamA CDS complement(24535..25887) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene rseP CDS complement(25899..26756) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene cdsA CDS complement(26769..27458) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene ispU CDS complement(27714..28913) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095654.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene ispC CDS complement(29007..29564) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501909.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene frr CDS complement(29732..30457) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene pyrH CDS complement(30608..31459) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene tsf CDS complement(31577..32302) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene rpsB CDS 32624..33418 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene map CDS 33481..36156 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene glnD CDS 36189..37013 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene dapD CDS 37125..37514 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501916.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(37604..38761) product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095649.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene cdaR CDS complement(38909..40345) product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095648.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene degP CDS complement(40476..41990) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene dgt CDS 42073..42771 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene mtnN CDS 42764..43564 product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095645.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene btuF CDS 43592..44215 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(44274..44618) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095643.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene erpA CDS complement(44698..46098) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418710.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene clcA CDS 46275..47555 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene hemL CDS complement(47640..49622) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095640.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene fhuB CDS complement(49619..50509) product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095639.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene fhuD CDS complement(50509..51306) product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene fhuC CDS complement(51357..53567) product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene fhuA CDS complement(53798..56323) product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene mrcB CDS complement(56466..58826) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095635.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene hrpB CDS 58969..59523 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene thpR CDS 59513..60217 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095633.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene sfsA CDS 60394..60849 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155232.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene dksA CDS 60909..61799 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene gluQRS CDS 61896..63239 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095630.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene pcnB CDS 63236..63715 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095629.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene folK CDS 63839..64630 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095628.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene panB CDS 64642..65493 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095627.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene panC CDS 65528..65908 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856284.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene panD CDS complement(65912..67159) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(67224..67664) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095618.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(67769..68539) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095617.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(68536..69462) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095616.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 69618..70232 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene can CDS complement(70324..70860) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095614.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene hpt CDS 71069..73459 product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095613.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(73547..75115) product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene cueO CDS 75285..75608 product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830675.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 75724..76593 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095610.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene speE CDS 76594..77388 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene speD CDS complement(77420..77782) product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene yacL CDS complement(77990..80587) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene acnB CDS 80986..82539 product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095601.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 82502..83341 product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095600.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(83395..84819) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368220.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene lpdA CDS complement(84995..86890) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene aceF CDS complement(86905..89568) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene aceE CDS complement(89692..90456) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene pdhR CDS 90720..90947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080474218.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 90994..92364 product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095594.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene aroP CDS 92529..93926 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 93937..94887 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(94906..95760) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene ampE CDS complement(95770..96321) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene ampD CDS 96409..97302 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095589.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene nadC CDS 97477..97914 product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095588.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene ppdD CDS 97925..99307 product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095587.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene gspE CDS 99297..100481 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene hofC CDS complement(100523..101566) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 101795..102415 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095584.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene coaE CDS 102415..103158 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene zapD CDS 103168..103362 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene yacG CDS complement(103388..103789) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095582.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene mutT CDS complement(103847..106552) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095581.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene secA CDS complement(106611..107126) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095579.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene secM CDS complement(107394..108311) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene lpxC CDS complement(108413..109564) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene ftsZ CDS complement(109628..110884) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene ftsA CDS complement(110881..111723) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene ftsQ CDS complement(111725..112645) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095576.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(112638..114113) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095575.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene murC CDS complement(114170..115234) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene murG CDS complement(115231..116475) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene ftsW CDS complement(116475..117791) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095572.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene murD CDS complement(117794..118876) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501985.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene mraY CDS complement(118870..120228) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095571.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene murF CDS complement(120225..121640) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene murE CDS complement(121699..123465) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095569.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(123481..123846) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene ftsL CDS complement(123843..124784) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene rsmH CDS complement(124787..125245) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene mraZ CDS complement(125846..126853) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095565.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 gene cra CDS complement(127033..127524) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501994.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene ilvN CDS complement(127526..129250) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095564.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene ilvI CDS complement(129631..130593) product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene leuO CDS 131360..132931 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene leuA CDS 132931..134022 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene leuB CDS 134025..135425 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene leuC CDS 135436..136041 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene leuD CDS complement(136100..137278) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(137399..137551) product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene sgrT CDS 137640..139295 product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene sgrR CDS 139464..140447 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095555.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene thiB CDS 140423..142033 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095554.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene thiP CDS 142017..142715 product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene thiQ CDS complement(142744..143511) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(143640..144485) product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095551.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene araC CDS 144823..146532 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene araB CDS 146543..148045 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene araA CDS 148134..148829 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095548.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene araD CDS 148946..151303 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene polB CDS 151432..154338 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418667.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene rapA CDS 154351..155010 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095545.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene rluA CDS 155319..158831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(158892..159707) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095544.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene djlA CDS 159947..162322 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene lptD CDS 162376..163662 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene surA CDS 163662..164648 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene pdxA CDS 164645..165466 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene rsmA CDS 165470..165847 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene apaG CDS 165852..166700 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene apaH CDS complement(166742..167221) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene folA CDS complement(167336..169201) product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095537.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene kefC CDS complement(169194..169724) product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095536.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene kefF sequence098 source 1..42499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(742..1302) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 1750..2670 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene speB CDS complement(2722..3990) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098639.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(4200..4958) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098638.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 5231..7222 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene tkt CDS 7549..8568 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098636.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene epd CDS 8618..9781 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene pgk CDS 9874..10953 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene fbaA CDS 11140..11994 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098633.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 12186..12779 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene argO CDS 12872..13603 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(13647..14540) product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene argP CDS 14668..15327 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098630.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene rpiA CDS 15594..16826 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene serA CDS complement(16929..17405) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(17775..18104) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811891.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene zapA CDS 18267..18851 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098627.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 18877..20196 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098626.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene pepP CDS 20193..21371 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098625.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene ubiH CDS 21384..22586 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098624.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene ubiI CDS 22927..24078 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028158.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene gcvT CDS 24102..24491 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene gcvH CDS 24619..27492 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene gcvP CDS 27563..28306 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098620.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(28372..29805) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(29922..30659) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 30919..31578 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(31663..32643) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098616.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene ygfZ CDS 32938..33204 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098615.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene sdhE CDS 33185..33595 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244777.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(33602..34123) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene fldB CDS 34225..35121 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene xerD CDS 35150..35863 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098611.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene dsbC CDS 35869..37602 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene recJ CDS 37910..38791 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene prfB note possible pseudo, frameshifted CDS 38801..40318 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene lysS CDS complement(40357..40899) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098607.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene idi CDS 41063..41806 product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene actS tRNA 41887..41960 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 sequence099 source 1..40607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..537 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097610.1:ParB/RepB/Spo0J family partition protein locus_tag LOCUS_30550 CDS complement(538..1698) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 1822..2436 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 2433..3122 product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene mtnC CDS 3119..3661 product 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097614.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(3715..4185) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097615.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(4228..5244) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097616.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene mtnA CDS 5349..6548 product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene mtnK CDS complement(6636..7877) product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(7961..9025) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(9045..10040) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(10037..11539) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097622.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 11699..12787 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097623.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 12845..13588 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704716.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 13772..14068 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097625.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 14049..14453 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097626.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(14450..14701) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097627.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(14707..16812) product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097628.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene cstA CDS complement(16962..17375) product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097630.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene entH CDS complement(17376..18128) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097631.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene entA CDS complement(18128..18982) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(18993..20603) product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097633.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene entE CDS complement(20613..21788) product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097634.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene entC CDS 21977..22936 product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene fepB CDS complement(23014..24252) product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097636.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene entS CDS 24361..25365 product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097637.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene fepD CDS 25362..26354 product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418881.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene fepG CDS 26351..27145 product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097639.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene fepC CDS complement(27233..31090) product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene entF CDS complement(31087..31299) product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097641.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(31310..32509) product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097642.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene fes CDS 32654..34903 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097643.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 34989..35642 product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097644.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene entD CDS 35990..36208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 36349..36591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 36890..37999 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188470843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 37992..40124 product microcin export transporter peptidase/ATP-binding subunit MchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene mchF sequence100 source 1..38301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(449..4495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(4499..7210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(7210..9366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(9363..12797) product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104752311.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(12794..14290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(15008..15553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(15591..17291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(17318..19465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(19468..21039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(21049..21750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 22472..22735 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 22762..23592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 note possible pseudo, frameshifted CDS 23810..25447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 25440..26507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 26943..27932 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 28181..28345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(28542..28877) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215068.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(28904..29131) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004853132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(29289..30077) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087230.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(30105..35606) product conjugative transfer relaxase/helicase TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene traI CDS complement(35603..38194) product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087228.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene traD sequence101 source 1..37630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..301) product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097283.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(285..656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047371030.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(659..1402) product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099210.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(1448..2275) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755958.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(2272..2466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(2466..2873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097279.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(2870..3091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(3091..3444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097278.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(3437..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811079.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(3765..4154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(4220..4525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(4726..5403) product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705908.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 5502..5759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 5761..5958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 5955..6887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 6991..8862 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058461124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 8866..9681 product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 9902..10306 product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816186.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 10303..10584 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 10581..11123 product putative peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 11120..11389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096313.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 11399..12019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 12012..12260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 12356..12664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 12661..12927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 13098..13679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 13691..15148 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096315.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 15130..15327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(15281..15613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 15961..16548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296472.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 16545..16886 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072872.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 16886..17122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 17272..17757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 17764..19278 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 19278..20552 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 20557..21246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 21249..22406 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 22440..22766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 22766..23104 product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201245.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 23101..23550 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573391.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 23547..23894 product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 23949..24419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 24473..24874 product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710952.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 24898..25161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 25196..28534 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 28537..28875 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072856.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 28872..29630 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 29632..30342 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 30372..30713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 30757..31362 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419708.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 31416..34604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 34647..34961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 34962..35633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 35750..35974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 36037..37254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31670 sequence102 source 1..34199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 395..1231 product IS3-like element ISEcl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082767983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 1663..2526 product GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065553.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 2618..3439 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197389.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 3656..4357 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 4398..4634 product protein YpjK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144029.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene ypjK CDS 4634..5077 product lipoprotein YafY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824223.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene yafY CDS 5100..5567 product protein YkfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001547765.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene ykfB CDS 5644..5883 product DUF905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194654.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 5981..6439 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 6455..6931 product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 6940..7161 product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 7180..7497 product type IV toxin-antitoxin system antitoxin YafW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070395.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 gene yafW CDS 7518..7859 product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene ykfI CDS complement(8425..8880) product tail fiber assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(8883..9977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(9959..10639) product DUF2612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(10636..11835) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(11836..12189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(12189..12941) product Gp138 family membrane-puncturing spike protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301087.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(13007..13402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(13389..14159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(14280..14612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758867.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(14612..15676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081737.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(15679..15981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(15981..16568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(16568..18577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990884.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(18755..19207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(19211..19651) product DUF3277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257259.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(19663..20823) product DUF3383 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(20827..21375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077064290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(21365..21754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142488.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(21741..22328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008731.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(22325..22732) product DUF4054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125675.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(22698..23087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040702.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(23129..24070) product DUF2184 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627464.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(24082..24585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066732.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(24590..25822) product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873166.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(25837..26445) product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224761.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(26459..27928) product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113499.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(27928..29556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(29553..30026) product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211724.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(30058..30612) product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211725.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(30739..31263) product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109019.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(31461..31871) product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097723.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(31922..32416) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095971.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(32394..32618) product class II holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705890.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(32910..33410) product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816486.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(33513..33713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 sequence103 source 1..32357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(253..1698) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098980.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene tldD CDS complement(1783..5580) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098981.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene yhdP CDS complement(5622..7091) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene rng CDS complement(7081..7674) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(7684..8172) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene mreD CDS complement(8172..9176) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene mreC CDS complement(9239..10282) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene mreB CDS complement(10565..12505) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene csrD CDS 12688..13662 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098988.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 13725..14741 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098989.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene msrP CDS 14742..15341 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene msrQ CDS 15576..16028 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098991.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene aroQ CDS 16050..16514 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene accB CDS 16525..17874 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860388.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene accC CDS 17983..18225 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 18215..19666 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene panF CDS 19678..20559 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098995.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene prmA CDS 20687..21427 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 21806..22723 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098996.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene dusB CDS 22747..23043 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene fis CDS complement(23390..23989) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014072014.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(24003..25664) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127900.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(25648..26004) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113645.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(26134..26286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174068.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(26279..26722) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145903.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(26722..27015) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123184.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(27012..27350) product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201245.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(27347..28582) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267612.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(28584..29144) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504050.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(29196..30362) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137336.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(30594..31715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142732.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(31717..32217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 sequence104 source 1..31374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..2193 product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419551.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 2331..3566 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096449.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 3999..4562 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096447.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(4652..6268) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 6454..7167 product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096425.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene mpaA CDS complement(7158..8123) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene ycjG CDS 8231..8737 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene tpx CDS 9013..10221 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(10266..11807) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096421.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene tyrR CDS complement(11920..12972) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096420.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(12969..14366) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096419.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 14522..15532 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(15567..16481) product OmpG family monomeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419574.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(16547..17629) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096416.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(17643..18308) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096415.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene pgmB CDS complement(18298..20577) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(20571..21626) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(21641..22429) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420918.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(22447..23049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 note possible pseudo, frameshifted CDS complement(22934..23500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 note possible pseudo, frameshifted CDS complement(23575..24372) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(24359..25240) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096409.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(25263..26555) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096408.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(26570..28255) product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(28464..28688) product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096406.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene pspD CDS complement(28701..29060) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene pspC CDS complement(29060..29284) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096404.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene pspB CDS complement(29334..30002) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096403.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene pspA CDS 30169..31146 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096402.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene pspF sequence105 source 1..31184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..1766) product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene pcoS CDS complement(1763..2443) product copper response regulator transcription factor PcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188930.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene pcoR CDS complement(2498..3427) product copper resistance inner membrane protein PcoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998778.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene pcoD CDS complement(3432..3812) product copper resistance system metallochaperone PcoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene pcoC CDS complement(3852..4748) product copper resistance outer membrane transporter PcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378118.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene pcoB CDS complement(4748..6571) product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925242.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene pcoA CDS 6800..7249 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 7538..8275 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287501.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(8309..8506) product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843494.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(8547..10535) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 10692..10940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(11121..11561) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758228.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(11648..14794) product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene silA CDS complement(14805..16097) product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene silB CDS complement(16211..16564) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene cusF CDS complement(16593..17867) product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001507116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene silC CDS 18165..18848 product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene silR CDS 18841..20316 product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555736.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene silS CDS 20567..20998 product silver-binding protein SilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790485.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene silE CDS 21142..21492 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS complement(21880..22794) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007374408.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 23196..24164 product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096391.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 24885..25625 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066952.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(26322..27332) product RepB family plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014063948.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 28073..29239 product plasmid-partitioning protein SopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772446.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene sopA CDS 29239..30210 product ParB/RepB/Spo0J family plasmid partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817031.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 sequence106 source 1..31017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..989) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096857.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 1133..2593 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(2621..3184) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096859.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene smrA CDS complement(3541..4452) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 4628..5938 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096861.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 5938..7383 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 7500..8951 product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096863.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene abgT CDS 8962..9477 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene ogt CDS 9661..10413 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174991.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene fnr CDS 10561..10743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096865.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 10853..11803 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene uspE CDS complement(11927..13315) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene pntB CDS complement(13326..14855) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene pntA CDS 15391..16335 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096870.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene ydgH CDS 16520..17902 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 17942..18664 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene folM CDS complement(18661..18996) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096873.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 19125..19841 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene rstA CDS 20086..20346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096875.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 20422..21720 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096876.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene rstB CDS 21793..22722 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096877.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene tus CDS complement(22723..24117) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene fumC CDS complement(24301..25947) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene fumA CDS 26147..27322 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene manA CDS 27422..28954 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096881.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(29069..30097) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 30277..30657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(30611..31000) product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125351949.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 sequence107 source 1..28421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..1204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 note possible pseudo, internal stop codon, frameshifted CDS complement(1220..1411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 note possible pseudo, internal stop codon, frameshifted CDS complement(1419..1769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 note possible pseudo, internal stop codon, frameshifted CDS 2231..3328 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269640.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 3464..4603 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883155.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 4539..5615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(5671..6063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(6072..6323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(6355..6780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(6799..7308) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(7325..8320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(8388..8735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(8895..9590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(9594..9833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(9846..10079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(10079..10642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(10639..10815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(10812..11021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(11018..11452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(11490..13334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(14594..15169) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188025301.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 15702..16040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 tRNA complement(16521..16605) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(16712..17434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(17465..18223) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095379.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene miaE CDS complement(18270..18695) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810300.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene rraB CDS 18860..19864 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095378.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene argF CDS 20175..20933 product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121657.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene xynR CDS complement(20938..22548) product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095376.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(22560..23942) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192863.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(24169..26136) product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151261.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene yagF CDS complement(26151..27059) product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095373.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene yagE CDS complement(27283..27735) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095372.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 sequence108 source 1..150694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 655..864 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene cspE CDS complement(1084..1365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 1535..2323 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097597.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 2449..2652 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097596.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene tatE CDS complement(2736..3701) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097595.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene lipA CDS complement(3909..4862) product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097594.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(5154..5795) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene lipB CDS complement(5890..6153) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene ybeD CDS complement(6260..7471) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097592.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene dacA CDS complement(7611..8723) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097591.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene rlpA CDS complement(8740..9852) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097590.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene mrdB CDS complement(9855..11756) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene mrdA CDS complement(11785..12252) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858701.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene rlmH CDS complement(12256..12573) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097588.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene rsfS CDS complement(12843..13499) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene nadD CDS complement(13501..14532) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097586.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene holA CDS complement(14532..15101) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097585.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene lptE CDS complement(15116..17698) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097584.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene leuS CDS 17910..18395 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(18450..19391) product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene rihA CDS complement(19512..20237) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(20234..20911) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097580.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene gltK CDS complement(20911..21651) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(21807..22712) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883004.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(23113..24651) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097577.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene lnt CDS complement(24657..25580) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097576.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 gene corC CDS complement(25625..26092) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene ybeY CDS complement(26089..27135) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097575.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(27299..28723) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097574.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene miaB CDS 28859..30034 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene ubiF tRNA complement(30140..30214) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(30251..30325) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(30368..30444) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(30462..30536) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(30569..30643) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(30667..30751) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA complement(30761..30837) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(31064..32728) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097572.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene asnB CDS complement(32978..33730) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097571.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene nagD CDS complement(33777..34997) product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(35006..36154) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene nagA CDS complement(36210..37010) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene nagB CDS 37337..39289 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097567.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene nagE CDS 39470..41137 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097566.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene glnS CDS 41584..42981 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene chiP CDS 43026..43355 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097564.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene chiQ CDS complement(43447..43893) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene fur CDS complement(44184..44714) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501067.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene fldA CDS complement(44870..45157) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene ybfE CDS complement(45286..46059) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097562.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene ybfF CDS 46243..46791 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097561.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene seqA CDS 46816..48456 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene pgm CDS complement(48547..49860) product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097559.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene potE CDS complement(49857..52055) product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097558.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene speF CDS complement(52694..53371) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097557.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene kdpE CDS complement(53368..56055) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097556.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene kdpD CDS complement(56056..56631) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097555.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene kdpC CDS complement(56644..58692) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883015.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene kdpB CDS complement(58711..60390) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097553.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene kdpA CDS 60789..60995 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097552.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 61336..62748 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene phrB CDS 62759..63502 product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 63556..64173 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097549.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene pxpB CDS 64167..65099 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097548.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 65086..65826 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097547.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene pxpA CDS 65845..66636 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene nei CDS complement(66722..68005) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 68645..69049 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 gene sdhC CDS 69043..69390 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene sdhD CDS 69390..71156 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097543.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene sdhA CDS 71172..71888 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene sdhB CDS 72137..74944 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene sucA CDS 74959..76179 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097540.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene odhB CDS 76275..77441 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809579.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene sucC CDS 77441..78310 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene sucD CDS complement(78394..79110) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 79281..81197 product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097538.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene mngA CDS 81221..83851 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097537.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene mngB CDS 84532..86100 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097536.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene cydA CDS 86116..87255 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene cydB CDS 87383..87673 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene ybgE CDS 87822..88226 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097533.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 gene ybgC CDS 88223..88915 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene tolQ CDS 88919..89347 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene tolR CDS 89376..90644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 90779..92071 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097529.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene tolB CDS 92107..92628 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177214.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene pal CDS 92638..93435 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097528.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene cpoB tRNA 93597..93672 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 93700..93775 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 93779..93854 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 93901..93976 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 94001..94076 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS 94268..95311 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene nadA CDS 95333..96052 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097526.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene pnuC CDS complement(96049..96981) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene zitB CDS complement(97088..97546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 97770..98822 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene aroG CDS complement(98884..99636) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene gpmA CDS complement(99843..100883) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene galM CDS complement(100877..102025) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene galK CDS complement(102029..103075) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene galT CDS complement(103085..104101) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene galE CDS complement(104303..105775) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene modF CDS complement(105843..106631) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene modE CDS 106759..106908 product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097516.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 107087..107860 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097515.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene modA CDS 107860..108549 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene modB CDS 108552..109610 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097513.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene modC CDS complement(109611..110429) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 110570..111565 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene pgl CDS complement(111689..112972) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 113197..114420 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene hutI CDS 114417..115355 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097508.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene hutG CDS 115375..116109 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097507.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 116236..117924 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097506.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene hutU CDS 117921..119441 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097505.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 gene hutH CDS complement(119527..120003) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(120052..121359) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene bioA CDS 121428..122468 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097502.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene bioB CDS 122465..123622 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene bioF CDS 123606..124361 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene bioC CDS 124354..125055 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097499.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene bioD CDS complement(125018..125740) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 126492..128507 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene uvrB CDS complement(128597..129505) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene yvcK CDS 129853..130842 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097494.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene moaA CDS 130867..131379 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097493.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene moaB CDS 131383..131868 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene moaC CDS 131861..132106 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene moaD CDS 132108..132560 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene moaE CDS 132625..133332 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(133422..134384) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097488.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(134384..135622) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097487.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene clsB CDS complement(135619..136380) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 136514..136924 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(136886..137992) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097484.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(138002..139135) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097483.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(139125..140864) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(140857..141852) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene hlyD CDS complement(141849..142526) product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097480.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene cecR CDS 142732..144111 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097479.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene rhlE CDS 144209..146386 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097478.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene dinG CDS complement(146373..146876) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(146882..147865) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097476.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(147894..150437) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 sequence109 source 1..27146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 588..977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 note possible pseudo, internal stop codon CDS 1029..1289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(1286..1513) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(1532..2128) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097202.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene wrbA CDS 2520..2690 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 2809..3726 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 3788..4057 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095428.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 4064..4585 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(4659..5981) product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097199.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene rutG CDS complement(6003..6497) product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097198.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene rutF CDS complement(6507..7097) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097197.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(7107..7907) product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097196.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene rutD CDS complement(7915..8301) product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097195.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene rutC CDS complement(8313..9002) product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097194.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene rutB CDS complement(9002..10093) product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene rutA CDS 10339..10977 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097192.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene rutR CDS complement(10974..11369) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882762.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(11471..15433) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097190.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene putA CDS 15857..17365 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882760.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene putP CDS 17482..17901 product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097188.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(17972..19156) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097187.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 19408..20241 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 20282..21409 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097185.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 21415..22698 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene efeB CDS 23199..23987 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene phoH tRNA complement(24209..24296) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS complement(24445..25122) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097181.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(25143..26003) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097180.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 26113..27018 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097179.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 sequence110 source 1..26995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 note possible pseudo, internal stop codon CDS 855..1082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 note possible pseudo, internal stop codon CDS 1290..1709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(1917..2420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(2703..3293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(3430..3885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418870.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(4115..4996) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 5099..5881 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene budA CDS 5895..7574 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097652.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 gene alsS CDS 7595..8365 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097651.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 8497..8970 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097650.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(9078..9782) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156927.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(9769..10605) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(10598..11431) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131974.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(11431..12444) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(12543..14111) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 14313..15011 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(15045..16739) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(16773..17513) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(17788..18435) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(18432..18986) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(19030..19524) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(19737..21401) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097649.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene betA CDS complement(21415..22887) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097648.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene betB CDS complement(22901..23488) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097647.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene betI CDS 23617..25650 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene betT misc_feature complement(25697..>26995) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986774.1:prolyl oligopeptidase family serine peptidase locus_tag LOCUS_35520 sequence111 source 1..24426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..1256 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098346.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene dgcN CDS 1269..1754 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098347.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(1757..3127) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(3165..3569) product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098349.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(3702..4049) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 gene rplS CDS complement(4093..4860) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene trmD CDS complement(4892..5428) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene rimM CDS complement(5447..5695) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863133.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 gene rpsP CDS complement(5812..7173) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene ffh CDS 7265..8131 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832951.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 8195..9436 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(9489..10106) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098354.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene grpE CDS 10277..11083 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098356.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene nadK CDS 11169..12830 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098357.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene recN CDS 12969..13307 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863121.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene bamE CDS complement(13416..13703) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863119.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(13693..14169) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 14287..14769 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502505.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 gene smpB tmRNA 14859..15221 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(15624..16724) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098779.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(16721..17206) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098780.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(17206..20649) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282796.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(20776..21078) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848877.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(21133..21648) product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007848874.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(21658..22830) product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098782.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(22911..23663) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938397.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(23722..24366) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905027.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 sequence112 source 1..23828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 104..763 product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705915.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 760..1725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 1722..1940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705916.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 2029..2298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 2301..2519 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 2516..3208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 3435..3665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705919.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 3773..3964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(3945..5123) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218286.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 5305..6729 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645258.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene sbcB CDS complement(6852..8210) product putrescine/proton symporter PlaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365827.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 gene plaP CDS complement(8482..9411) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097841.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(9453..10277) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097842.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 10648..11547 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886595.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene hisG CDS 11547..12857 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097843.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene hisD CDS 12854..13915 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097844.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene hisC CDS 13912..14979 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097845.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene hisB CDS 14979..15569 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103580.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene hisH CDS 15569..16306 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097846.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene hisA CDS 16288..17064 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097847.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene hisF CDS 17058..17669 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene hisIE CDS complement(17708..18592) product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097848.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene wzzB CDS 18883..19887 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS complement(19935..21101) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene ugd CDS complement(21329..22735) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene gndA sequence113 source 1..23458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 818..1693 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096536.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(1713..2672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 2788..3216 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096537.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(3240..4145) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 4262..5011 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(5008..5937) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096540.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(5930..6916) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096541.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(6916..7809) product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096542.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(7806..8828) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(8851..10383) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(10399..10974) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096545.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene ddpX CDS complement(10987..11841) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096546.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 12108..13589 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096548.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 13685..14896 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 14985..15875 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096549.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 16048..17565 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096550.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 17632..19002 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096551.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 19002..20408 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096552.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 20437..21444 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096553.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 21543..23093 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096554.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 sequence114 source 1..21782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..1531) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene apbC CDS 1669..3702 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097928.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene metG CDS complement(3814..4284) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097929.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(4331..5050) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene btsR CDS complement(5044..6729) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 6948..7688 product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420186.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene mlrA CDS complement(7846..8583) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097933.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(8567..9517) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097934.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(9510..10667) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097935.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(10680..11597) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(11745..14042) product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097937.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene bglX CDS 14232..15980 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene dld CDS 16092..16646 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(16730..17653) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097940.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene pbpG CDS complement(17821..18408) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097942.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 18566..19138 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097943.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(19221..19985) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097944.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(20036..21340) product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097945.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene mdtQ sequence115 source 1..21390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1410) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096487.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(1476..2051) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096486.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 2200..2718 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096485.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 2715..3164 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(3168..3401) product YdcY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096483.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(3502..5100) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705554.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 5492..6733 product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 6738..9719 product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096481.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 9716..11893 product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419532.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(11964..12179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 note possible pseudo, frameshifted CDS complement(12122..12718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 note possible pseudo, frameshifted CDS complement(12805..12939) product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(13161..14585) product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene patD CDS complement(14610..15416) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096476.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(15406..16350) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096475.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(16352..17365) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419536.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(17383..18528) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419537.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(18800..20209) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(20292..20480) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096470.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 sequence116 source 1..20861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(671..2803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(2805..4154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(4151..5032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(5047..6966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(7043..20422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 sequence117 source 1..18467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1113) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844806.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(1117..1908) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816336.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(1921..2772) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434149.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 2945..4315 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409401.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 4384..5850 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020644771.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 5847..7169 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970057.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(7407..8237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 note possible pseudo, frameshifted CDS complement(8264..8527) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(8813..9022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 note possible pseudo, frameshifted CDS 9606..9860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(9840..10151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 note possible pseudo, internal stop codon CDS complement(10390..12123) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528531.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(12131..13078) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530745.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(13123..14730) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528533.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(14740..15660) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528534.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(15660..16508) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723883.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(16505..17098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(17095..18222) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969594.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 sequence118 source 1..17744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(917..1702) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097739.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene fliR CDS complement(1710..1979) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene fliQ CDS complement(1989..2726) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene fliP CDS complement(2726..3100) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097737.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene fliO CDS complement(3103..3516) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500318.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene fliN CDS complement(3513..4517) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene fliM CDS complement(4522..4992) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832480.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene fliL CDS complement(5099..6331) product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097734.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene fliK CDS complement(6328..6771) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene fliJ CDS complement(6793..8163) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene fliI CDS complement(8163..8870) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097731.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene fliH CDS complement(8863..9861) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500327.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene fliG CDS complement(9854..11533) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene fliF CDS 11762..12076 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene fliE CDS 12151..12564 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene yedD CDS complement(12658..14148) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096005.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene amyA CDS complement(14197..14571) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096006.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene fliT CDS complement(14577..14981) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096007.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene fliS CDS complement(15003..16427) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096008.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene fliD CDS 16829..17668 product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 sequence119 source 1..145127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..2467 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096172.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 2489..3385 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366507.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(3364..4122) product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419874.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(4115..5086) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096170.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 5235..6215 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 6294..7304 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene gap CDS complement(7346..8533) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096167.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 8649..9605 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096166.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 9708..11393 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(11458..13560) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419884.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(13673..13927) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096161.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 14135..14866 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096160.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(14906..15517) product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096159.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene emtA CDS 15624..16538 product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096158.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene ldcA CDS 16762..18369 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096157.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(18465..19535) product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096156.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene dadX CDS complement(19545..20843) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096155.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 21164..22696 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096153.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS complement(22806..23525) product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096152.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene fadR CDS 23727..25265 product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020690847.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene nhaB CDS 25460..25939 product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene dsbB CDS complement(26055..26495) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832353.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(26589..27248) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(27296..27571) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096146.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 27695..28402 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096145.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene minC CDS 28426..29238 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096144.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene minD CDS 29242..29511 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500504.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene minE CDS complement(29585..30739) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645255.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene rnd CDS complement(30784..32337) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene fadD CDS complement(32673..33254) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(33292..33987) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096140.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene tsaB CDS complement(34054..35964) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096139.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 36098..36442 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096138.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(36449..36631) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 36693..38018 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096137.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene pabB CDS 38025..38603 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096136.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 38789..40153 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene sdaA CDS 40284..41882 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096134.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(41889..43448) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096133.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene yoaE CDS 43911..44876 product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096132.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene manX CDS 44923..45723 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene manY CDS 45736..46587 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 46643..47101 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(47263..47430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 47464..48066 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096130.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene mntP CDS complement(48063..48878) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene rlmA CDS complement(48944..50509) product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096128.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene ftsI CDS complement(50882..51091) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene cspE CDS complement(51774..52763) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(52788..53078) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 53456..53695 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096123.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(53762..54553) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene kdgR CDS 54732..55691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 note possible pseudo, frameshifted CDS 55655..56107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 note possible pseudo, frameshifted CDS complement(56158..57039) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096120.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene htpX CDS complement(57233..59281) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene prc CDS complement(59301..59987) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096118.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene proQ CDS complement(60084..60581) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 60927..61997 product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene yebS CDS 62059..64599 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419908.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 64722..66119 product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene rsmF CDS 66226..66465 product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096113.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(66500..67144) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096112.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene pphA CDS 67310..68251 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096111.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(68657..68995) product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(69012..69881) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene copD CDS complement(69883..70254) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096103.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene yobA CDS 70392..70622 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 70733..70882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 note possible pseudo, internal stop codon CDS complement(70895..71116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 71078..71383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 note possible pseudo, internal stop codon CDS 71408..72070 product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096100.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene exoX CDS complement(72067..74127) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096099.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene ptrB CDS complement(74213..74863) product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096098.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 75035..76213 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419918.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene purT CDS complement(76255..76896) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS complement(76935..78746) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096095.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 gene edd CDS complement(78980..80455) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096094.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene zwf CDS 80812..81681 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882312.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 81819..83261 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096092.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene pyk CDS complement(83307..84278) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419920.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene lpxM CDS complement(84399..85718) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene mepM CDS complement(85734..86765) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096089.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene znuA CDS 86756..87511 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene znuC CDS 87508..88293 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene znuB CDS complement(88346..89356) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene ruvB CDS complement(89365..89979) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene ruvA CDS complement(90060..90581) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096083.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene ruvC CDS complement(90616..91356) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(91384..91827) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620451.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene nudB CDS complement(91829..93601) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene aspS CDS 93865..94431 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 94428..95246 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096078.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 95298..95693 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 95734..96477 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene cmoA CDS 96474..97445 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096075.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene cmoB CDS complement(97621..98364) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene cutC CDS complement(98434..99003) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 99243..100976 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096072.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene argS CDS complement(101035..101427) product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096068.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(101427..103505) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene flhA CDS complement(103498..104646) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096066.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene flhB CDS complement(104795..105424) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene cheZ CDS complement(105450..105839) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500431.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene cheY CDS complement(105857..106906) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(106903..107769) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500429.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene cheR CDS complement(107789..109390) product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096062.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene tap CDS complement(109435..111102) product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene tar CDS complement(111187..112149) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(112146..114530) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(114506..115264) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(115281..115784) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(115842..116414) product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 116887..118110 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096055.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(118329..118832) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene cheW CDS complement(118852..120882) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene cheA CDS complement(120893..121822) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096052.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene motB CDS complement(121819..122706) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500417.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene motA CDS complement(122830..123408) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene flhC CDS complement(123411..123761) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene flhD CDS 124557..124985 product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419943.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene uspC CDS complement(125001..126425) product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096048.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene otsA CDS complement(126400..127203) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene otsB CDS complement(127380..128366) product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene araH CDS complement(128381..129895) product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096045.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene araG CDS complement(129967..130956) product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 gene araF CDS 131744..132247 product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096043.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 132404..133747 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096042.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(133790..134041) product DUF2766 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096041.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 134468..134806 product YecR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096039.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene yecR CDS 135010..135507 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096038.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene ftnA CDS complement(135544..135885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 136184..137326 product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096036.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 gene tyrP CDS complement(137360..138028) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096035.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 138453..139574 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096034.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 139674..140588 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096033.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 140600..141874 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096032.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene livM CDS 141871..142746 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 142743..143459 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096030.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 143461..143619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS complement(143738..144415) product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704545.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 sequence120 source 1..17711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1562 product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061709144.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(1595..2299) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817076.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene arsH CDS 2386..2706 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418999.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 2752..4041 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209408.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 4054..4479 product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065769.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene arsC CDS complement(4539..5366) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS complement(5385..6863) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(7359..8195) product IS3-like element ISEcl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082767983.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(8198..8593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 note possible pseudo, frameshifted CDS complement(8655..8948) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(8935..9195) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 9370..9861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087105.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 10229..10999 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087103.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 11130..11456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(11431..12237) product DUF4225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087100.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(13117..14130) product plasmid replication initiator RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087098.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene repA CDS 14783..15049 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869691.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 15037..15522 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087269.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 15717..17072 product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 misc_feature complement(17143..>17711) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087268.1:abortive infection family protein locus_tag LOCUS_38640 sequence121 source 1..16130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(600..1367) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728526.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene thyX CDS complement(1364..2155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(2182..3195) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(3198..3830) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052560.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 3947..4189 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102106.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 4222..4731 product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460852.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 4739..4939 product DUF2724 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956189.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 4903..5244 product DUF5347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098807.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 5312..5539 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098806.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 5539..5766 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098805.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 5786..8176 product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098803.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 8158..8364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 8321..8488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154444.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 8872..9342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 note possible pseudo, internal stop codon CDS 9343..9924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 note possible pseudo, internal stop codon CDS 9902..10273 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(10283..10819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 10882..11262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 11273..12049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(12621..13670) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040233361.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(13670..15433) product terminase ATPase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150344844.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 sequence122 source 1..14644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 333..848 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939756.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(882..1292) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 1582..1791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 1994..3517 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246475.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 3571..3966 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281194.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 4144..4593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096458.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS 4633..4830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096459.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 4833..5255 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419542.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(5740..6849) product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096462.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(7238..10762) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096463.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene nifJ CDS 11135..11302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(11303..11740) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096466.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene hslJ CDS complement(11867..11995) product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096467.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(11995..13005) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096468.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene cydB CDS complement(13005..14405) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096469.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 sequence123 source 1..14339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(700..927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(1144..1377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(1298..1570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096313.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(1567..1791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(1788..2414) product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(2414..2695) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226307.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(2682..3077) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 3735..4556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 4582..5073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(5087..5512) product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205470.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(5509..5820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(5822..7693) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058461124.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS complement(7797..8819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(8812..9021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(9023..9310) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705720.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 9392..10084 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133087235.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 10256..10549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 10631..11017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS 11187..11345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 note possible pseudo, internal stop codon CDS 11338..11745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097278.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 11935..12348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097279.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 12348..12926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097280.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 12938..13681 product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099210.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 13684..14055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047371030.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 14039..14296 product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097283.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 sequence124 source 1..14300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 505..2178 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097329.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(2175..3131) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 3291..4406 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene macA CDS 4403..6343 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097326.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 gene macB CDS complement(6414..6635) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499993.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 gene cspD CDS 6903..7223 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 gene clpS CDS 7251..9530 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097325.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene clpA CDS 9948..10388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 repeat_region 10565..11192 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtacaggcagcttagaaa CDS 11315..11503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 note possible pseudo, internal stop codon, frameshifted sequence125 source 1..14153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..523) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095417.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS 612..1214 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 1351..2472 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095420.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(2563..3978) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 4155..4316 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095422.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(4403..5791) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095423.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 5893..6372 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095424.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(6359..7261) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095425.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 7362..8777 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095426.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 8929..9258 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095429.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 9382..10041 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095431.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 10187..10657 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095432.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 10657..11721 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095433.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 11711..12787 product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095434.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(12784..14055) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095435.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 sequence126 source 1..13978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..1148) product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400076.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(1161..2135) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS complement(2140..2925) product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748259.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 gene argT CDS 3223..3915 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(4016..4555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(4675..5943) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(5948..9205) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(9206..10513) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(10510..12537) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(12649..12921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(12918..13442) product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674233.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 misc_feature complement(13466..>13978) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263652.1:amino acid ABC transporter substrate-binding protein locus_tag LOCUS_39630 sequence127 source 1..13697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(540..974) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096287.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 gene uspF CDS complement(946..1137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(1220..1891) product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392697.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 2346..2837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 note possible pseudo, frameshifted CDS 2804..3550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 note possible pseudo, frameshifted CDS complement(3571..4560) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 5428..8061 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096772.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 8064..8255 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 8263..8580 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028066.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS complement(8581..9489) product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096769.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene feaR CDS 9731..11230 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096768.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(11319..12425) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 misc_feature complement(12544..>13697) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038419319.1:primary-amine oxidase locus_tag LOCUS_39760 sequence128 source 1..13237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 666..1565 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097331.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 1710..3362 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097332.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene hcp CDS 3373..4341 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097333.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene hcr repeat_region 4428..4695 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtacggcagtgaac CDS complement(4861..5295) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097334.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 5447..7165 product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097335.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene poxB CDS 7204..8205 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097336.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 gene ltaE CDS 8216..9652 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 9745..10758 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097338.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(10918..12729) product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097339.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 sequence129 source 1..12567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 273..2525 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537646.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(2630..2884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39870 note possible pseudo, internal stop codon CDS complement(2881..3567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 note possible pseudo, frameshifted CDS complement(3647..4090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 4176..5048 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS complement(5045..6205) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene pheA CDS complement(6472..6813) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502470.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene raiA CDS complement(7082..7819) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene bamD CDS 7951..8931 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882082.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene rluD CDS 8928..9659 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098337.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene yfiH CDS 9789..12362 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098336.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene clpB sequence130 source 1..141949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..1063 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095021.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene metA CDS 1334..2935 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095022.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene aceB CDS 2952..4271 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095023.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 gene aceA CDS 4323..6059 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095024.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene aceK CDS complement(6097..6927) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 gene iclR CDS 7121..10804 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095026.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene metH CDS 11022..12653 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095027.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(12650..12943) product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095028.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS complement(12944..13246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 note possible pseudo, internal stop codon CDS 13444..14316 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene rluF CDS complement(14317..14589) product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(14640..15584) product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 gene panS CDS complement(15690..17249) product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704028.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene rtcR CDS 17706..18833 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS 18838..20064 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 20068..20856 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(20898..22247) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095032.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene lysC CDS 22622..24271 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene pgi CDS complement(24710..24874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 24945..25583 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095035.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 25580..26317 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 26317..28413 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 28576..28986 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene psiE CDS complement(29084..29974) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095043.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene malG CDS complement(29989..31533) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene malF CDS complement(31655..32845) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene malE CDS 33216..34325 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500080.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene malK CDS 34397..35722 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 35970..36788 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095048.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene malM CDS 36969..37466 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 gene ubiC CDS 37479..38348 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095050.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene ubiA CDS complement(38438..40609) product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099146.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 gene zntA CDS complement(40686..41312) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099145.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 41442..41801 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420764.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(41884..42165) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(42149..42751) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene rsmD CDS 42879..44339 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene ftsY CDS 44342..45013 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene ftsE CDS 45000..46055 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099139.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene ftsX CDS 46307..47164 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene rpoH CDS 47301..48566 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 48770..49864 product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833593.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene livJ CDS complement(50042..50425) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene panM CDS 50790..51959 product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099132.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene livK CDS 52006..52932 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene livH CDS 52929..54206 product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099130.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene livM CDS 54203..54970 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099129.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene livG CDS 54972..55685 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene livF CDS 55932..57248 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene ugpB CDS 57406..58293 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene ugpA CDS 58290..59135 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099125.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene ugpE CDS 59137..60207 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 60204..60950 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099123.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene ugpQ CDS complement(60934..61311) product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099122.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 61435..63180 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene ggt CDS complement(63267..63755) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099120.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene yhhY CDS 64012..65049 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 65173..65868 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639796.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 65913..66965 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833579.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene gntR CDS 67092..67619 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene gntK CDS 67698..68963 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene gntU CDS complement(69066..71486) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095051.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene plsB CDS 71641..72009 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095052.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 72118..72726 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095053.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene lexA CDS 72790..74127 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418457.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene dinF CDS 74146..74457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(74527..75039) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095057.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene zur CDS 75155..75643 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620296.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 75921..77126 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 77209..78204 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 gene dusA CDS 78341..78583 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene pspG CDS complement(78768..79751) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095062.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 79812..81224 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene dnaB CDS 81241..82320 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene alr CDS complement(82352..82558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 82652..82900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 82897..83907 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 83983..85176 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095065.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene tyrB CDS 85430..86143 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095066.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene aphA CDS 86257..86673 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095067.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 86676..87029 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095068.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(87033..89855) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095069.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene uvrA CDS 90107..90631 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860284.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene ssb1 CDS complement(90694..90975) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503385.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 91644..93176 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(93183..93509) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 gene soxS CDS 93608..94066 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095072.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene soxR CDS 94441..95112 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 95407..96756 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 gene ghxP CDS 96907..98553 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095075.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(98635..99522) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 99625..100035 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095077.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS 100028..100717 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095078.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(100750..102399) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 gene actP CDS complement(102396..102710) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095080.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(102793..104751) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095081.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene acs CDS 105175..106488 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095082.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene gltP CDS complement(106572..107246) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095083.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(107368..107520) product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095084.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(107842..110025) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077681898.1 transl_table 11 codon_start 1 transl_except (pos:109570..109572,aa:Sec) note codon on position 152 is selenocysteine opal codon. locus_tag LOCUS_40960 gene fdhF CDS 110246..110977 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(110981..111889) product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095089.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene lpxO CDS complement(112033..113037) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095090.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(113037..113897) product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(113908..114594) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS complement(114644..115585) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(115616..116611) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(116608..118128) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 118310..120586 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095097.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 120708..121334 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095098.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS 121410..121733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(121816..122574) product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095100.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene phnP CDS complement(122584..123018) product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095101.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 gene phnO CDS complement(123011..123559) product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528220.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene phnN CDS complement(123559..124695) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095103.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene phnM CDS complement(124692..125372) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095104.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 gene phnL CDS complement(125479..126234) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095105.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene phnK CDS complement(126231..127076) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095106.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene phnJ CDS complement(127069..128133) product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095107.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(128133..128717) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095108.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene phnH CDS complement(128714..129166) product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095109.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene phnG CDS complement(129167..129892) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095110.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene phnF CDS complement(129913..130692) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095111.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene phnE CDS complement(130795..131811) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095112.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 gene phnD CDS complement(131836..132624) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095113.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene phnC CDS complement(132798..133238) product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095114.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene yjdN CDS complement(133362..133697) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095115.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 134292..136637 product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095116.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene crfC CDS 136634..137509 product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS complement(137567..138559) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene kdgT CDS 139210..140712 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095119.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene proP CDS complement(140745..141647) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418498.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 sequence131 source 1..12565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 204..407 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096785.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene ydfZ CDS complement(451..1914) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS complement(2136..3503) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(3577..4596) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(4611..5825) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096791.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 gene rspA CDS complement(5936..6262) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096792.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 6415..6753 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096793.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 6753..7313 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096794.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene speG CDS complement(7457..8167) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096795.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 8272..8541 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 8673..11102 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096797.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 11196..11810 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096800.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene dmsD CDS 12054..12533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 sequence132 source 1..12459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..2977) product Tn3-like element ISPa38 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100881.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 3091..3342 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 3339..3740 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 3730..4086 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465043.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 4341..4655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100858.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(5082..6263) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095215.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene nhaA CDS complement(6923..7528) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 7623..10520 product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138082.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS complement(10678..11271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 misc_feature complement(11268..>12459) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001209044.1:HNH endonuclease signature motif containing protein locus_tag LOCUS_41510 sequence133 source 1..11601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 558..1925 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097601.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene dcuC CDS 2020..2829 product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene rna CDS complement(2823..3440) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097603.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 3687..4097 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene rnk CDS complement(4207..4362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(4337..5575) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097605.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 5756..6184 product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097606.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene uspG CDS complement(6246..7811) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene ahpF CDS complement(7999..8562) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene ahpC CDS 9238..10137 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 10295..11518 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882127.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 sequence134 source 1..10860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..1234) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(1197..4577) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 4792..6072 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965210.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene urtA CDS 6129..7055 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene urtB CDS 7065..8180 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 gene urtC CDS 8177..8926 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene urtD CDS 8937..9626 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene urtE CDS 9662..10669 product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938461.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 sequence135 source 1..10806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1278..2285 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420170.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 2621..3994 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097916.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 4013..5479 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(5516..6031) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097918.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(6108..8288) product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097922.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene etk CDS complement(8306..8737) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097923.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(8740..9789) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420177.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 10364..10696 product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097925.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 sequence136 source 1..9986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..9947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 sequence137 source 1..9802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 9..84 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 rRNA 130..240 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(350..1108) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(1116..2219) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099004.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(2229..3410) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099003.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(3478..4503) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099002.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(4978..5199) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099001.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS complement(5504..8617) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099000.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(8629..9651) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098999.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 sequence138 source 1..9389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..433) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090135989.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(430..588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(585..842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(1003..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 1930..2151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 2570..2767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098072.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(2904..3851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(4132..4836) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 4948..5175 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184665.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 5216..5437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 5521..5730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 6152..6454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 6451..7230 product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070133977.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 7227..7526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094290.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 7523..7990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 7987..8208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 8205..8702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 8704..9012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42040 sequence139 source 1..9162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 305..1453 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742518.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 1457..2110 product terminase endonuclease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059191.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 2209..2676 product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010835209.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 2676..2879 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 2883..3098 product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171568.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS 3079..3594 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019077486.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS 3591..4019 product Rz-like lysis system protein LysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162926034.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene lysB CDS 4115..4546 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098790.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 4539..4985 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343944.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(4948..5838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 5916..6494 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098788.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 6491..6850 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098787.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 6837..7745 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098786.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 7738..8343 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098785.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 sequence140 source 1..8915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..892 product RNA polymerase sigma factor FecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283626.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene fecI CDS 889..1842 product fec operon regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068910.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene fecR CDS 1929..4253 product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188246.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene fecA CDS 4298..5200 product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879155.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene fecB CDS 5197..6195 product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene fecC CDS 6192..7148 product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684856.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene fecD CDS 7149..7916 product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175457.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 gene fecE CDS 8057..8308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 sequence141 source 1..141871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(363..1028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(1040..1606) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(1879..2313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(2806..3741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(3786..5363) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470631.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 tRNA complement(5493..5568) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(5696..6271) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(6321..8012) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095255.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(7988..8311) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095256.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 gene cutA CDS complement(8425..9726) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(9842..11278) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene aspA CDS 11613..12077 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095258.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene fxsA CDS complement(12114..13334) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418505.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene yjeH CDS 13514..13807 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855929.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS 13839..15482 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095260.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene groL CDS complement(15548..16711) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 gene iadA CDS complement(16722..17183) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418507.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(17164..17826) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095262.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 18061..18414 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095263.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(18480..19388) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095264.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene epmB CDS 19549..20115 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830362.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene efp CDS 20123..20305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 20414..20560 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025482.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene ecnB CDS complement(20598..21197) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095267.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS 21459..21776 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095268.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 gene sugE CDS complement(21773..22303) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095269.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(22434..23579) product class C beta-lactamase CMH-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095270.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene blaCMH CDS 23712..24587 product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095271.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene ampR CDS complement(24617..24976) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095272.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene frdD CDS complement(24987..25382) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095273.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene frdC CDS complement(25393..26127) product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095274.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 gene frdB CDS complement(26120..27787) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 gene frdA CDS 28221..29198 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 gene epmA CDS 29376..30875 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704158.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene yjeM CDS complement(30913..34236) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095277.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene mscM CDS complement(34256..35224) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene asd CDS complement(35322..36374) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095279.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene rsgA CDS 36482..37027 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene orn tRNA 37224..37299 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 37336..37411 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 37448..37523 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 CDS complement(37794..38933) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 gene queG CDS 38932..40455 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene nnr CDS 40448..40909 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095283.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene tsaE CDS 40926..42266 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene amiB CDS 42276..44120 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene mutL CDS 44113..45063 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095286.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene miaA CDS 45149..45460 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene hfq CDS 45535..46815 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene hflX CDS 46872..48131 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene hflK CDS 48134..49138 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095290.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene hflC CDS 49210..49407 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 49470..50810 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 50970..51428 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095292.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene nsrR CDS 51467..53908 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095293.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 gene rnr CDS 53975..54706 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095294.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene rlmB CDS complement(54798..56072) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095295.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 56267..57700 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(57886..59817) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(59990..60265) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139152684.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene yjfN CDS complement(60414..60722) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071843255.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene bsmA CDS 60881..61603 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095300.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene yjfP CDS complement(61600..62355) product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095301.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 gene ulaR CDS complement(62465..63529) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427455.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene ulaG CDS 63889..65289 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095302.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene ulaA CDS 65302..65607 product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004109091.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene ulaB CDS 65617..66084 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095304.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 gene ulaC CDS 66097..66747 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095305.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene ulaD CDS 66757..67617 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095306.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 67610..68296 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095307.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(68437..68712) product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095308.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 gene yjfY CDS 69054..69449 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856034.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene rpsF CDS 69456..69770 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856035.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene priB CDS 69775..70002 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene rpsR CDS 70044..70493 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502894.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene rplI CDS complement(70562..71206) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095310.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 71440..72060 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502892.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene fklB CDS 72373..73782 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095311.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene cycA CDS complement(73869..74531) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095312.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene ytfE CDS 74776..76425 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(76513..77478) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(77554..78378) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(78460..79308) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095319.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS 79393..79779 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095320.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(79871..81814) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095321.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS 82005..82745 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095322.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene cysQ CDS complement(82739..83296) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095323.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 83621..83827 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(83897..85234) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(85446..85982) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene msrA CDS 86312..88045 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095333.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene tamA CDS 88042..91818 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene tamB CDS 91821..92165 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027890.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(92211..92504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095336.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(92482..92952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095337.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(92949..93533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095338.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(93756..94286) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501423.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 gene ppa CDS 94638..95552 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014882271.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 gene ytfQ CDS 95658..97160 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095340.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 97171..98196 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 98207..99184 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 gene yjfF CDS 99269..100840 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095343.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(100812..101168) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095344.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(101319..102317) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene fbp CDS 102515..103894 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095346.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene mpl CDS complement(103972..104523) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene yjgA CDS 104631..105971 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095347.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene pmbA CDS 106010..106396 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095348.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 gene cybC CDS 106732..107052 product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 107063..107425 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006179053.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 107428..107727 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 107750..108526 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810337.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 108540..109181 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095350.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 109224..110357 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095351.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS 110341..111459 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095352.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 111456..112196 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 112222..113358 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095354.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS 113378..115288 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704203.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 115366..115608 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501400.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(115700..116164) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene nrdG CDS complement(116270..118408) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene nrdD CDS complement(118778..119350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(119352..121949) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990052.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(121960..123357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 123678..124196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(124205..124813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(125087..126742) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095358.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene treC CDS complement(126794..128215) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene treB CDS complement(128342..129289) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095360.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 gene treR CDS 129681..132389 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420864.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 gene mgtA CDS 132589..132804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 note possible pseudo, internal stop codon CDS 132877..134973 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095362.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS complement(135025..135411) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810315.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene ridA CDS complement(135485..135946) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095364.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene pyrI CDS complement(135959..136891) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095365.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene pyrB CDS complement(137131..137619) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(137691..139094) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS complement(139142..140146) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene argF CDS complement(140173..141084) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095370.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 misc_feature complement(141095..>141871) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095371.1:arginine deiminase locus_tag LOCUS_43620 sequence142 source 1..8565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 24..1025 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096503.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(1070..2755) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096504.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(2862..3041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 3171..4502 product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096505.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 4624..5265 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096506.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(5258..5557) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096507.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 5718..7817 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096508.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene fusA CDS complement(7853..8425) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 sequence143 source 1..8153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(351..842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(839..1159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(1156..1578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(1575..1919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(1919..3352) product DnaB-like helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131484.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(3342..4241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065666.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(4234..4380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(4461..4682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(4710..4943) product antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705907.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 4985..5737 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS 6378..6698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 6840..7349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 7346..7504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 7501..7713 product killing protein KilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560226.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 gene kilR CDS 7724..7933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43850 sequence144 source 1..7653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(63..2177) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene pqqU CDS 2419..3480 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096490.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(3573..4982) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 gene ansP CDS complement(5374..6288) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705545.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 6397..6795 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(6792..7652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 sequence145 source 1..7392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 824..1039 product phage lysis protein EssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839596.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 gene essD CDS 1039..1575 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087728.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 1572..1961 product DUF2570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001688324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 1924..2103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(2143..2421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 2676..3035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS 3180..3383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 3810..4355 product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453564.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 4519..5625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS 5629..5976 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096342.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 5973..6728 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055651.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 6730..7386 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 sequence146 source 1..6143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 340..1422 product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851507.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene lacI CDS 1544..4618 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098161.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene lacZ CDS 4670..5923 product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003846917.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 gene lacY sequence147 source 1..5821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(751..837) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(849..922) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(969..1044) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 CDS complement(1197..1745) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096028.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 gene pgsA CDS complement(1802..3634) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096027.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 gene uvrC CDS complement(3631..4287) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096026.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 gene uvrY CDS 4752..4976 product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096025.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS complement(5043..5765) product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096024.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 gene sdiA sequence148 source 1..5664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 629..1564 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096454.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 gene ttcA CDS complement(1607..2980) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 gene dbpA CDS complement(3008..3190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(3464..4447) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096452.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 gene zntB misc_feature complement(4603..>5664) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062729484.1:methyl-accepting chemotaxis protein locus_tag LOCUS_44180 sequence149 source 1..5396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 709..1086 product DcrB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131636999.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 sequence150 source 1..5225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..920) product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 gene yecC CDS complement(917..1585) product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 gene tcyL CDS complement(1607..2593) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096021.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 gene dcyD CDS complement(2700..3500) product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 gene tcyJ CDS complement(3587..4138) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096019.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 gene fliZ CDS complement(4193..4882) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096018.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 sequence151 source 1..5118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 772..1047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(1089..2963) product KAP family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015265747.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(3350..3913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44290 misc_feature complement(3994..>5118) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA locus_tag LOCUS_44300 sequence152 source 1..137331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..519 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS 550..1668 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 1829..3520 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(3640..6021) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(6272..7195) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(7376..8260) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(8325..8714) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096672.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS 8901..9356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096671.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS 9366..9812 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 9824..10342 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420909.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS 10360..11346 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096668.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(11347..12972) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096667.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(12981..13991) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096666.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene cydB CDS complement(13991..15394) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096665.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(15462..16334) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096664.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(16352..16861) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096663.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(17111..17605) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096661.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(17700..17885) product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004150795.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 18414..19757 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096660.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 19801..21306 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS complement(21293..22135) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 22250..23419 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096656.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS 23430..24203 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096655.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(24221..24415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS 24446..26101 product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096654.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 26205..26744 product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096653.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene rimL CDS complement(26739..27719) product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 gene ydcK CDS 27842..28843 product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 gene tehA CDS 28843..29436 product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096650.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 gene tehB CDS complement(29433..30662) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 gene pepT CDS 30774..32369 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 32505..33179 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096647.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(33214..34110) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096646.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 34284..35156 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS complement(35136..36302) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 36392..36919 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096643.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 37000..38964 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096642.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(38965..39195) product DUF2554 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096641.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 39441..39803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096640.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS complement(39977..40513) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049077549.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(40554..41540) product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420910.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 gene ftrA CDS complement(41488..41688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 41635..42048 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 42205..43308 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 43509..44780 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 gene urtA CDS 44805..46379 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096635.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene urtB CDS 46379..47452 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096634.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 gene urtC CDS 47452..48249 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 gene urtD CDS 48259..48957 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 gene urtE CDS 49010..49651 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096631.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 gene zinT CDS complement(49701..50846) product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096630.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 gene ydeE CDS 51089..51994 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 gene eamA CDS complement(52027..52245) product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene marB CDS complement(52279..52659) product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502237.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 gene marA CDS complement(52681..53115) product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096627.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 gene marR CDS 53371..54036 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096626.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(54131..55285) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 55505..56293 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 56321..57112 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS 57205..57687 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096614.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(57641..58519) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096613.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 58618..60006 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096612.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 gene sad CDS 60119..61708 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 61771..62697 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096610.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 gene glsB CDS complement(62760..62918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS 62886..63053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 63167..64615 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096608.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 64726..65691 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096606.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(65783..66076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS 65966..66301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45000 note possible pseudo, internal stop codon CDS 66420..67871 product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854624.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 gene uxaB CDS 68072..68986 product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(68974..69522) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096602.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 69699..70661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705429.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 71260..71730 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096600.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS 71743..72183 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096599.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 72329..73066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45070 note possible pseudo, internal stop codon CDS 73369..74109 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096597.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS 74106..75407 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096596.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS 75545..76735 product cytochrome c biogenesis protein/redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096595.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(76741..77499) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096594.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 gene tam CDS 77938..78576 product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS complement(78591..79283) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815757.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(79570..80154) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096593.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 80241..81014 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(81195..81407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45160 note possible pseudo, frameshifted CDS complement(81502..81945) product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704110.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(82565..83188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS 83401..84309 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705386.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 84414..85001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096584.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(85030..86259) product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815521.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 gene yjjJ CDS complement(86379..89555) product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574029.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 gene silA CDS complement(89566..90813) product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 gene silB CDS complement(90825..91163) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096581.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 gene cusF CDS complement(91192..92577) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096580.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 92740..93423 product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 gene silR CDS 93413..94867 product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096578.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS complement(94871..95776) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096577.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 95894..97297 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096576.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS complement(97336..97821) product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138096472.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 gene tssD CDS complement(97843..98088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(98255..98800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(98876..99871) product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096575.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS complement(99881..100867) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096574.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS complement(100864..101586) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096573.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS 101787..102332 product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096572.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS complement(102333..104408) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 gene glgX CDS complement(104424..106892) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096570.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 gene treY CDS complement(106889..108676) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096569.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 gene treZ CDS 108809..109336 product streptothricin N-acetyltransferase SatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242546.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 gene satA CDS 109436..110185 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096568.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS 110327..111181 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096567.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 note possible pseudo, frameshifted CDS 111178..111312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45430 note possible pseudo, frameshifted CDS 111332..112225 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096566.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(112216..113100) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096565.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS 113214..114704 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096564.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(114730..115155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(115156..115494) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(115484..116698) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(116708..117607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS complement(117619..118836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 119118..120935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS 120932..122251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS 122248..123795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS 123780..124577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS 124614..125051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 125048..125473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS 125484..128150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS 128150..130321 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229242.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 130467..130703 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096563.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 130849..132003 product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419480.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(132043..132801) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096561.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 gene dsbG CDS complement(132843..133454) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096560.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(133462..135486) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419486.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(135535..135903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096558.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(135991..136560) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080292718.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(136557..136976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096556.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 sequence153 source 1..5058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..1147 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099225.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 gene murB CDS 1144..2106 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099224.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 gene birA CDS 2123..3115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(3170..4849) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099223.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 gene bcsG sequence154 source 1..4514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS 526..891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 note possible pseudo, internal stop codon CDS complement(1067..2188) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene tyrA CDS complement(2199..3269) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene aroF CDS 3484..3858 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098344.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 sequence155 source 1..4471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(216..2249) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096778.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene dcp CDS 2392..3138 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096779.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene ydfG CDS 3230..3916 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS complement(3952..4383) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366755.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 sequence156 source 1..4294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..975 product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097174.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 gene csgG CDS complement(1019..1501) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072200468.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(1598..2152) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097176.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS complement(2174..2911) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097177.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS complement(2996..3934) product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097178.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 gene ghrA tRNA 4167..4254 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 sequence157 source 1..4066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 13..474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(791..976) product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157167.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS 1175..1366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45890 note possible pseudo, internal stop codon, frameshifted CDS 1359..1553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS 1550..1768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS 1752..3503 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071081194.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS 3801..4061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45930 sequence158 source 1..3138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS complement(503..706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS complement(782..943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS complement(956..1747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS complement(1744..2313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 sequence159 source 1..2938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..514 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017693214.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 511..1440 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703658.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS complement(1552..1959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS 2624..2902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46020 sequence160 source 1..2796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..2198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS 2202..2630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047043.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 sequence161 source 1..2541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS 1296..2429 product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104138.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 sequence162 source 1..2458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(42..1580) product IS66-like element ISEc8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS complement(1629..1976) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612626.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 gene tnpB CDS complement(1973..2377) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839179.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090