COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..1699754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1362 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1535..2665 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2820..3104 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene yaaA CDS 3110..4222 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene recF CDS 4236..6200 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene gyrB CDS 6211..8682 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene gyrA CDS 8877..9173 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene rpsF CDS 9216..9731 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene ssb CDS 9762..9998 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rpsR CDS 10146..12167 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 12180..12635 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene rplI CDS 12660..14042 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene dnaB CDS 14169..15047 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254003.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 15256..15435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 15437..15697 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(15796..17022) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17133..17843) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 tRNA 18016..18090 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(18351..19121) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254183.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(19501..20649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 20871..21710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 22118..22438 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22582..23232) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23733..24536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(24652..25341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(25717..26541) product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 26719..27564 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 27629..28429 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 28496..29329 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29413..30174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 30178..30912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 31065..31628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 31795..32274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476598.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(32301..33626) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33941..34987 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 34962..35552 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(35565..35747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(35870..36214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(36500..36850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(36967..37728) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(37725..38624) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(38621..39613) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene trpX CDS 39982..40689 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(40686..41567) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 41757..42614 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254321.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 42706..44622 product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 44691..44954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(45031..46044) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 46404..46670 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 46790..47617 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 47709..49151 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 49205..52021 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(52045..53172) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 53284..53697 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 rRNA 54113..55676 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 55887..58784 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 58858..58967 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(59305..59835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 note possible pseudo, frameshifted CDS complement(59889..60023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 60133..60672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(60691..61095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(61101..61568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(61852..62097) product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(62190..63056) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(63053..64000) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(64012..64962) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(64987..65817) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254021.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(65836..66591) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(67326..68609) product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 68935..70350 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044382744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 70560..72401 product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044382741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene tdc tRNA complement(72686..72761) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(73285..73509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 tRNA complement(73617..73691) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 73822..74538 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene yycF CDS 74605..76461 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene walK CDS 76451..77797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 77800..78627 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 78642..79439 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 79513..80754 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 81237..81716 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rlmH CDS 81802..82221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(82257..83138) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(83147..83800) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(83811..85163) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 85416..86357 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 86408..87232 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 87392..87511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 87567..88775 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 88778..89833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 89833..90933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 90926..91228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(91280..92170) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene htpX CDS complement(92173..92733) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(92835..93935) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 94124..94516 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 94578..96377 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 96454..96594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 96759..97409 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 97437..98327 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(98359..99321) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(99400..100155) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(100155..101729) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(102089..102718) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 102744..103109 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(103185..103973) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(103960..104478) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004039686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(104556..105272) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 105351..105836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(105862..107319) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene cls CDS complement(107338..108039) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(108053..108982) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 109060..109779 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(109879..110343) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene tnpA CDS 110443..111774 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(111916..112923) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896839.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene ribD CDS 113094..113264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(113294..114247) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 114403..115227 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 115211..115867 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 115943..116581 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 116691..117353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 117395..117838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 117966..118952 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 119091..119777 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 119792..120628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 120736..122217 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 122210..122947 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(122997..124256) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 124407..125489 product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 125520..126260 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 126339..127448 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 127445..128233 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 128205..129020 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(129050..132076) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 132231..133385 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene nagA CDS complement(133797..134273) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 134394..134873 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(134904..135707) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 135848..136339 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 136652..137587 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 137601..138368 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene phnC CDS 138361..139158 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene phnE CDS 139158..139970 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene phnE CDS 140042..140527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 140582..141979 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 142104..144053 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene asnB CDS 144067..145347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 145545..147746 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene nrdD CDS 147746..148459 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene nrdG CDS 148516..149085 product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 149072..150271 product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 150416..151702 product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042680609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 151776..152996 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 153075..155015 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(155198..156529) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 156629..157093 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene tnpA CDS complement(157241..159277) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087236515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(160043..160465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(160662..161816) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(162063..162635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 162822..163046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 163098..163346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 163859..165565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(166142..167893) product pore-forming S-layer protein SlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene slpA CDS complement(168285..168437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(169591..171093) product pore-forming S-layer protein SlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene slpA CDS 171643..172851 product beta-N-acetylglucosaminidase AcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene acmB CDS 172895..173995 product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 174078..175916 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(175965..176930) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(176931..177731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(177814..178578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548800.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(178653..179078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 179260..179952 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 180099..180386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 180649..181218 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 181321..182427 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 182427..183041 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 183082..186060 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 186352..187614 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene tyrS CDS 187805..188149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 tRNA 188226..188298 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 188472..190094 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 190191..191828 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 191991..193133 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 193319..194248 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 194253..195377 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 195391..196440 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 196464..197405 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 197491..198804 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 198809..199465 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 199551..200360 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 200563..201489 product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 201508..202182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(202352..203668) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(203821..204249) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 204380..204841 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene greA CDS 204960..206312 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 206415..207077 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 tRNA complement(207124..207194) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(207237..207839) product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 207961..208989 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene trpS CDS 209005..209490 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 209471..210076 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548872.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 210379..213060 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene mgtA CDS 213149..215125 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene metG CDS 215125..215892 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 215885..216448 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene rnmV CDS 216438..217325 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene rsmA CDS 217399..217656 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 217760..218590 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene purR CDS 218638..220023 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene glmU CDS 220273..221139 product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 221230..221955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 222049..223263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 223401..225470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 225592..226617 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 226797..227141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 227299..228273 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(228324..229685) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 229790..230191 product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 230239..230793 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rpoE CDS 230915..232534 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 232655..233956 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 234089..234772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 234798..235451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 235502..235648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(235856..237280) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(237359..238186) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 238404..238757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 note possible pseudo, internal stop codon CDS 238770..240368 product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 note possible pseudo, internal stop codon CDS 240352..242550 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(242772..243821) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 note possible pseudo, frameshifted CDS complement(243788..244093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 note possible pseudo, frameshifted CDS complement(244095..244673) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 245013..246566 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene guaA CDS complement(246811..247146) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 247294..248319 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(248793..249185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 249392..250024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(250039..250203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 250169..250678 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(250829..250999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(251121..251600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 251858..252703 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 252703..253569 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 253559..254008 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 254010..254402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 254427..254930 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 254987..255127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(255192..256190) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(256168..256617) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(256720..257235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(257427..258776) product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene frc CDS complement(258792..260522) product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044304031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene oxc CDS 260715..261899 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(261945..262481) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(262610..263149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 263332..264927 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 265051..265296 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 265426..266793 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 266808..268286 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 268368..268724 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene acpS CDS 268725..269858 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene alr CDS complement(269895..270590) product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene cbpA CDS complement(270726..271697) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 271859..272416 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene pth CDS 272418..275912 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene mfd CDS 275924..276166 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 276232..276609 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 276610..276969 product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 277013..278263 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene tilS CDS 278380..280524 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene ftsH CDS 280576..281463 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene hslO CDS 281545..282570 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene dusB CDS 282589..284130 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene lysS CDS 284491..284625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 284893..285729 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 285893..286180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 286236..286853 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 286854..288005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 tRNA 288163..288235 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 288356..288428 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 288466..288539 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 288675..289127 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 289197..291686 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 291902..295531 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 295547..299206 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene rpoC CDS complement(299258..299941) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254110.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 300121..300528 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene rpsL CDS 300543..301013 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene rpsG CDS 301050..303143 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene fusA CDS 303425..303733 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene rpsJ CDS 303757..304395 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene rplC CDS 304410..305027 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene rplD CDS 305027..305332 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene rplW CDS 305348..306184 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254111.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rplB CDS 306203..306487 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene rpsS CDS 306507..306860 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rplV CDS 306874..307548 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene rpsC CDS 307548..307988 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene rplP CDS 307978..308175 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene rpmC CDS 308194..308460 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rpsQ CDS 308493..308861 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rplN CDS 308881..309117 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 309132..309674 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rplE CDS 309687..309872 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 309898..310296 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rpsH CDS 310321..310851 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene rplF CDS 310878..311237 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene rplR CDS 311254..311763 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rpsE CDS 311775..311960 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rpmD CDS 311984..312424 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene rplO CDS 312424..313719 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene secY CDS 313730..314386 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 314459..314680 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene infA CDS 314835..315185 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene rpsM CDS 315208..315591 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene rpsK CDS 315633..316571 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 316601..316984 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene rplQ CDS 317157..318014 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 317990..318835 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 318840..319637 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 319640..320428 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene truA CDS 320533..320976 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene rplM CDS 320988..321383 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene rpsI CDS 321540..321767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(322052..323293) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 323632..324003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 324212..324391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 note possible pseudo, frameshifted CDS 324592..324831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 note possible pseudo, frameshifted CDS 324816..325091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 note possible pseudo, frameshifted CDS complement(326201..326785) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 326917..327681 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 327742..328422 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 328486..329382 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 329392..329577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 329579..330256 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 330391..331326 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 332058..332270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 332304..332507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 332532..332798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 332927..333070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 333084..334406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 334399..335202 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 335323..335727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 335826..337619 product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 337630..338214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(338359..339705) product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene pepC CDS complement(339759..340055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 340191..340742 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 340742..342118 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene radA CDS 342193..343692 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene gltX CDS 343786..345219 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene cysS CDS 345212..345655 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 345642..346397 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rlmB CDS 346554..347117 product DNA-directed RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 347187..347405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 347551..349038 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(349081..350823) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 351008..351766 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 351913..352407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 352484..353566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 353809..353979 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene secE CDS 354086..354643 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene nusG CDS 354772..355197 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rplK CDS 355276..355968 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene rplA CDS 356075..356947 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 356944..357942 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene pstC CDS 357943..358830 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene pstA CDS 358840..359631 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene pstB CDS 359635..360393 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene pstB CDS 360410..361087 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene phoU CDS complement(361105..361488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 361779..362291 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene rplJ CDS 362335..362697 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rplL CDS 362778..364244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 364373..364555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613299.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 364651..365139 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene tadA CDS 365336..367102 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene dnaX CDS 367124..367453 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 367454..368053 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene recR CDS 368053..368286 product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 368391..369029 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene tmk CDS 369040..369360 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 369474..370217 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 370227..370571 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene yabA CDS 370573..371427 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rsmI CDS 371430..372167 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 372219..372737 product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 372762..373505 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene tsaB CDS 373471..374070 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene rimI CDS 374067..375116 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene tsaD CDS complement(375253..376119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 376235..376537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 376549..378744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 378741..379388 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 379474..380295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 380295..380876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 380886..381488 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(381988..383913) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 384104..384748 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 384954..385802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 385953..386276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 386613..387074 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 387064..387804 product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 387869..388855 product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 389010..389588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 389610..389927 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549725.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 390100..390273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 390284..391684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 391688..392497 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 392494..394656 product peptide cleavage/export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 394668..395306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 395495..395674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 395700..395861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 396042..396209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 396223..397029 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 397192..399093 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 399113..399343 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 399344..399895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 399913..400551 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254180.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(401282..402268) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(402280..403731) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 403974..405920 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(406007..406483) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057799316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(406517..407635) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 408311..410170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 410172..410462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(410585..411826) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 411987..412322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 412544..412828 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene groES CDS 412880..414511 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene groL CDS 414663..415616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 415807..416793 product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 416869..418263 product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 418442..418705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 418814..421399 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene mutS CDS 421399..423255 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene mutL CDS 423261..423848 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene ruvA CDS 423898..424914 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene ruvB CDS 424978..425442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 425546..426997 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene zwf CDS 426990..428126 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene dinB CDS 428185..429138 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 429131..430492 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 430735..433374 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene alaS CDS 433427..433684 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 433684..434112 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene ruvX CDS 434115..434426 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 434482..436836 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 436914..437225 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene trxA CDS complement(437270..437635) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene mscL CDS complement(437700..438110) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 438196..438996 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene murI CDS 438996..439616 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(439651..440499) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 440618..441046 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 441068..441436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(441495..442601) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 442753..443754 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(443800..445200) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene pepV CDS complement(445263..446636) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 446712..447044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 447060..448442 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 448443..449048 product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 449032..449808 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 449811..450413 product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(450426..451076) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(451086..451961) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 rRNA 452521..454084 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 454295..457192 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 457266..457375 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA 457394..457467 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 457471..457563 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 457593..457667 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 458128..458200 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 458204..458279 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 458431..459630 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene metK CDS 459643..461112 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(461158..461817) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 462115..464529 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene leuS CDS 464625..466295 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(466729..467115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 467447..470932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 note possible pseudo, frameshifted CDS 470911..475881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 note possible pseudo, frameshifted CDS 476320..477174 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 477485..486979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 487356..500498 product YSIRK-type signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 500886..512813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 512980..518991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 519399..530042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 530242..535860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 536169..538424 product mucus-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 538608..549524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(549657..549983) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 550112..551134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(551311..551799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(552022..552825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 553264..559749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 559944..560600 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 560701..562059 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 562163..562729 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene hpt CDS 562853..563101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 563102..563503 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 563611..564318 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 564318..565562 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 565559..566887 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 tRNA 566938..567013 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 567099..567275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 567287..568429 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene wecB CDS 568597..569526 product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 569546..569827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 570034..570552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 note possible pseudo, internal stop codon, frameshifted CDS complement(570591..571151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(571272..571790) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(571783..572229) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 572375..573202 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene map CDS 573209..574120 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 574179..575054 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene galU CDS complement(575108..575365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 note possible pseudo, frameshifted CDS 575309..576115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 576118..577344 product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 577344..578507 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(578778..578918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(579016..579246) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548471.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 tRNA complement(579327..579410) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 579522..580814 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 580816..581664 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 581762..582424 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 582686..584371 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene argS CDS 584478..585389 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene fba CDS complement(585426..586283) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 586367..588424 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 588446..588796 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 588802..590016 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 589997..592480 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 592485..593462 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(593509..594408) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(594519..594857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(594881..595318) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 595547..596290 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 596283..597494 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 597504..598166 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene trmB CDS 598224..598544 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 598568..599212 product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 599323..601230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 601307..602620 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene murC CDS complement(602693..603112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 603291..603929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 604028..606691 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene polA CDS 606700..607530 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene mutM CDS 607527..608129 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene coaE CDS 608132..608599 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene nrdR CDS 608602..609963 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 609973..610872 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene dnaI CDS 611163..613097 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene thrS CDS 613259..613693 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 613690..614130 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 614133..614897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 614913..615605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 615845..616366 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene infC CDS 616387..616587 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rpmI CDS 616626..616982 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rplT CDS 617086..617610 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 617603..618712 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene yqeH CDS 618724..619365 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 619358..619951 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene yqeK CDS 619963..620310 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rsfS CDS 620317..621468 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 621477..622037 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 622184..622897 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 622887..624440 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(624482..625450) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene yidC CDS complement(625491..625814) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 625904..626668 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 626766..627107 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 627389..628438 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene pheS CDS 628439..630853 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene pheT CDS 630929..631402 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene greA CDS 631461..632369 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 632516..633478 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 633632..634978 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 635008..637260 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 637270..637935 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene pgmB CDS complement(638040..642569) product BspA family leucine-rich repeat surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(642787..643710) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(643802..646372) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 646442..648538 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 648613..648762 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene rpmG CDS 648817..649383 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 649392..650072 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 650072..650281 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 650353..650754 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 650816..651736 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene miaA CDS 651729..652973 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 653182..654519 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene glnA CDS 654604..655416 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 655559..656974 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 657068..657514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(657581..658573) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene galE CDS 658763..659767 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 660290..661459 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 661477..662946 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 662948..663934 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 663962..665914 product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 665997..667172 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 667273..667689 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 667804..668013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 668178..669686 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene yjeM CDS complement(669726..670349) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene pyrE CDS complement(670351..671058) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene pyrF CDS 671306..672229 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 672383..672946 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene pyrR CDS 673089..674045 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 674045..675310 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 675315..676403 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene carA CDS 676396..679578 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene carB CDS 679702..679959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 680037..680900 product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(680948..683329) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(683350..683613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(683613..684500) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 tRNA 684664..684740 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 684858..685469 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 685516..685695 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 685746..686756 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 686889..687812 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene rbsK CDS 687814..688209 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene rbsD CDS 688267..689157 product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 690071..690298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 690440..691759 product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 691844..692683 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 692834..693145 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene rplU CDS 693162..693452 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene rpmA CDS 693540..694649 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 694721..695290 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene efp CDS 695310..695732 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 695735..696130 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene nusB CDS 696189..697040 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 697027..698376 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene xseA CDS 698378..698620 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 698623..699492 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 699493..700305 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 700315..702000 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene recN CDS 702058..702672 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene gmk CDS 702675..702899 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene rpoZ CDS 702956..705352 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene priA CDS 705365..706309 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene fmt CDS 706302..707615 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rsmB CDS 707619..708368 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 708365..710398 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene pknB CDS 710395..711288 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene rsgA CDS 711304..711960 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene rpe CDS 711957..712652 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 712755..713048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(713126..713311) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene rpmB CDS 713480..713842 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 713864..715522 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 715525..717561 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene recG CDS 717582..718592 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene plsX CDS 718595..718837 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene acpP CDS 718957..719991 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 719995..720210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 note possible pseudo, internal stop codon CDS 720226..720981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 note possible pseudo, internal stop codon CDS 720984..721943 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 721957..722880 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 723071..724837 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547891.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 725071..725424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 note possible pseudo, internal stop codon CDS 725515..726312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 note possible pseudo, internal stop codon CDS 726592..727278 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene rnc CDS 727290..730853 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene smc CDS 730854..732167 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene ftsY CDS 732204..733625 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 733712..734617 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 734633..735295 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(735326..736747) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 736905..737246 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 737252..738682 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene ffh CDS 738772..739044 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene rpsP CDS 739113..739628 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene rimM CDS 739618..740337 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene trmD CDS 740465..740812 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rplS CDS 741139..741561 product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 741607..742260 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 742253..743023 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(743052..743678) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene lexA CDS 743828..744076 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 744145..744363 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 744440..746203 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 746196..747989 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 747989..748219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(748276..749454) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 749610..750437 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(750464..751078) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 751138..752169 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 752329..753102 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rpsB CDS 753137..754162 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene tsf CDS 754307..755038 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene pyrH CDS 755031..755588 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene frr CDS 755588..756319 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 756331..757128 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 757139..758395 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene rseP CDS 758426..760123 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 760130..764446 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 764551..765027 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene rimP CDS 765046..766206 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene nusA CDS 766246..766521 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 766524..766835 product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 766840..769449 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene infB CDS 769473..769838 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 769898..770791 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene truB CDS 770811..771755 product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene ribF CDS 771999..772577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 772724..774079 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 774060..774191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 774301..775350 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene hrcA CDS 775363..775938 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene grpE CDS 775955..777805 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene dnaK CDS 777888..779036 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene dnaJ CDS 779153..780991 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene lepA CDS 780995..781684 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 781684..783945 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene recJ CDS 784049..784576 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 784649..785473 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene citG CDS 785558..786079 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(786120..787604) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene cls CDS complement(787692..789965) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 790089..790937 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(791003..792289) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene eno CDS 792520..793353 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(793385..793963) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(794060..795040) product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene bsh tRNA 795169..795257 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 795452..797344 product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 797334..800357 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 800417..801418 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 801549..802937 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 803007..803963 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 803972..804478 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 804562..806964 product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 807313..808167 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 808180..809238 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 809231..809932 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 810036..810677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(810734..811603) product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 812114..813520 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 813532..814926 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 815371..827667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 827880..828809 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 828832..829530 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 829551..831023 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(831471..831701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(831727..832305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 832411..832893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 833003..833800 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 833999..835057 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene citC CDS 835047..835340 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene citD CDS 835341..836255 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene citE CDS 836245..837786 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene citF CDS 837846..838385 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene citX CDS complement(838428..842054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(842373..843311) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 843485..844846 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 845006..845158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(845147..845653) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene ybaK CDS 845708..846652 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene prmA CDS 846706..847068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 847084..849324 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 849324..849761 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene dtd CDS 850051..851337 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene hisS CDS 851341..853197 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene aspS CDS 853410..854558 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(854596..855780) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 855898..856326 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene msrB CDS 856390..856785 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 857128..857304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 857587..857817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 note possible pseudo, frameshifted CDS 857889..858041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 858267..859520 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 859616..860158 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene msrA CDS 860240..861118 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(861155..861826) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 862347..862664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 862684..863643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(863854..864690) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 864891..865067 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene rpsU CDS 865200..865643 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 865666..866622 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 866622..867143 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene ybeY CDS 867145..868053 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene era CDS 868056..868808 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene recO CDS 869064..869981 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene glyQ CDS 869974..872040 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene glyS CDS 872062..873867 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene dnaG CDS 873882..874997 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rpoD CDS complement(875031..875687) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(875687..876130) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 876243..876926 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 876919..877716 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 877730..878971 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene pepT CDS 879266..879640 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 879633..880337 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 880341..881201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 881215..882042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254375.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 882053..882766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 882789..883598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(883722..883910) product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(883972..884541) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene lepB CDS 884627..885376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 885366..886343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 886324..887691 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(887740..889515) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(889626..890642) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene fni CDS complement(890654..891736) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(891776..892741) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene mvaD CDS complement(892741..893652) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene mvk CDS 893730..897200 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 897202..900801 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene addA CDS 900833..903634 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 903603..904100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 904152..905450 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene asnS CDS 905526..906164 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 906166..906795 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene nth CDS complement(906841..909165) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(909152..909784) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene recU CDS 909857..910420 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 910524..910922 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 911396..912517 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 912519..913751 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 913761..914126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(914147..914341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(914534..915019) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547331.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene tpx CDS 915279..916955 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 916959..917426 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene lspA CDS 917416..918333 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 918330..919385 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 919391..922570 product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(922601..924289) product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 924501..924902 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 924978..925850 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(925894..926892) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene add CDS complement(927016..928089) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene xerS CDS 928780..929136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(929204..929803) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(929867..930802) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(930830..931777) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(931908..934385) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene parC CDS complement(934402..936345) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene parE CDS 936446..937075 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene plsY CDS complement(937189..937803) product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(937854..938744) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(938899..940302) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene hslU CDS complement(940320..940844) product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene hslV CDS complement(940914..942233) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene trmFO CDS complement(942325..944430) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene topA CDS complement(944537..945388) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene dprA CDS complement(945438..946190) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(946187..947026) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene ylqF CDS complement(947065..948651) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(948702..948929) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(948931..949767) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 949903..950568 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 950685..952004 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(952061..953257) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 953343..954230 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(954298..955551) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(955739..956014) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(956151..957458) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene der CDS complement(957531..958736) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rpsA CDS complement(958807..959481) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene cmk CDS complement(959529..960056) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(960167..960853) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(961077..961796) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(961799..962386) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene scpB CDS complement(962376..963110) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(963103..963459) product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(963468..964358) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene xerD CDS complement(964351..965238) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(965352..967121) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene pyk CDS complement(967151..968113) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene pfkA CDS complement(968278..971394) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 971503..971709 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(971748..973301) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(973359..973547) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rpmF CDS complement(973661..973882) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(973889..974683) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(974683..975618) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene rnz CDS complement(975632..977548) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(977573..978874) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene obgE CDS complement(978948..980750) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene uvrC CDS 980888..981502 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 981527..982933 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(982974..983939) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(983952..984761) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene yidA CDS complement(984838..985653) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(986084..987271) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene coaBC CDS complement(987380..988096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(988238..988663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 988848..989714 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613346.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 989866..991248 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 991248..992693 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254281.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 992709..992957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 993077..993799 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 993809..995305 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(995468..996799) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 996899..997363 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene tnpA CDS 997518..999137 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 999212..999619 product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254279.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(999753..1000118) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(1000145..1000477) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 1000778..1001482 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(1001510..1001713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(1001856..1002011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(1002048..1002695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 note possible pseudo, frameshifted CDS 1002968..1003891 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(1003920..1004435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 1004618..1004761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(1004783..1006405) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 1006817..1008427 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(1008558..1009256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(1009661..1010719) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1010716..1011897) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1011913..1012692) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene dapB CDS complement(1012685..1013629) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene dapA CDS complement(1013626..1014774) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1014777..1015487) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene dapD CDS complement(1015506..1016810) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene lysA CDS 1017239..1018591 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 1018606..1019607 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene dapF CDS complement(1019637..1020227) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene yihA CDS complement(1020217..1021485) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene clpX CDS complement(1021615..1022940) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene tig CDS complement(1023086..1024276) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene tuf CDS complement(1024463..1025296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1025265..1027058) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1027217..1027486) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene rpsO CDS 1027691..1027942 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene rpsT CDS complement(1027993..1028979) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene holA CDS complement(1028976..1031258) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1031227..1031913) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(1031973..1033004) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1032994..1033488) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene coaD CDS complement(1033488..1034039) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene rsmD CDS complement(1034036..1034377) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1034374..1035327) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1035669..1037510) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene typA CDS 1037762..1038316 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene def CDS 1038657..1038881 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1038888..1040567 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1040619..1040987) product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1041173..1041379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1041410..1041550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1041710..1041835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1041847..1042515) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1042642..1044969) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(1044966..1045610) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1045610..1046269) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1046477..1047604) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene mnmA CDS complement(1047609..1047950) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1048028..1048723) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1048741..1049070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1049063..1049635) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1049650..1049853) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1049853..1052639) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene ileS CDS complement(1052860..1053657) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(1053633..1054433) product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1054433..1054735) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1054735..1055181) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene sepF CDS complement(1055204..1056559) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene ftsZ CDS complement(1056574..1057932) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene ftsA CDS complement(1057995..1058846) product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1058865..1059971) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene murG CDS complement(1059973..1061352) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene murD CDS complement(1061362..1062321) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene mraY CDS complement(1062326..1064290) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1064491..1064853) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene ftsL CDS complement(1064867..1065814) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene rsmH CDS complement(1065818..1066249) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene mraZ CDS complement(1066388..1066720) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1066827..1066961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1067001..1067540) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene mreD CDS complement(1067540..1068304) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene mreC CDS complement(1068438..1069442) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1069536..1070159) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene radC CDS complement(1070198..1070875) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1070856..1072133) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1072135..1074774) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1075289..1075864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1075948..1076733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(1076889..1078094) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1078145..1078552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1078650..1079384) product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1079396..1079689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(1079793..1079987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1080082..1081323) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1081470..1081841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1081910..1082275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1082395..1082748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1082888..1083094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1082998..1083783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1083815..1084246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1084269..1085348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1085367..1085771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1085784..1086167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1086179..1086982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1087111..1087881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1087891..1088703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1088930..1089637) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1089741..1090961) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene thiI CDS complement(1090962..1092122) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1092225..1093946) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene ezrA CDS 1094231..1094842 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rpsD CDS 1094917..1095387 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1095390..1096688 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1096994..1097275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1097324..1097791 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1097845..1099038) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1099062..1099289) product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1099479..1100636) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1100800..1101093) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene yidD CDS complement(1101116..1102102) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1102185..1102415) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1102486..1102923) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1102935..1104374) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene atpD CDS complement(1104397..1105359) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1105370..1106881) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene atpA CDS complement(1106896..1107444) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1107444..1107953) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene atpF CDS complement(1108006..1108230) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene atpE CDS complement(1108249..1108962) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene atpB CDS complement(1109083..1109712) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene upp CDS complement(1109805..1110800) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1110800..1111642) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene prmC CDS complement(1111635..1112720) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene prfA CDS complement(1112745..1113344) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1113486..1114838 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 tRNA complement(1114912..1114984) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(1114989..1115062) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 1115159..1116169 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1116247..1117230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1117244..1117477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1117757..1119094) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1119177..1119791) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1119942..1122119 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1122131..1123591) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1123594..1124322) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1124322..1124714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1124746..1125711) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene manA CDS complement(1125771..1125962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1125922..1126596) product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 tmRNA complement(1126882..1127245) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1127300..1128484) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1128527..1129537) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1129710..1130276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1130233..1130496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1130489..1130920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1130895..1131251) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene comGC CDS complement(1131260..1132261) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1132230..1133204) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene comGA CDS complement(1133316..1134044) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1134133..1134645) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1134750..1134935) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1135344..1136993 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1137033..1137488) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1137619..1138437 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1138481..1139470) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1139488..1139775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1140029..1140472) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1140472..1141188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546642.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(1141189..1141563) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene crcB CDS complement(1141560..1141952) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1141971..1142456) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1142462..1143277) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1143370..1144539) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1144542..1144988) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1145004..1146785) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1146909..1148969) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1149067..1150878) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene glmS CDS complement(1151067..1152419) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene glmM CDS complement(1152451..1153422) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1153419..1154261) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene cdaA CDS complement(1154307..1155380) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1155377..1156186) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1156183..1156992) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1156994..1158082) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1158133..1159035) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene murB CDS 1159132..1159665 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1159696..1160172) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene tsaE CDS complement(1160177..1161160) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene pta CDS complement(1161174..1161869) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1161939..1162811 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1162826..1163347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1163344..1163910) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1164242..1164997) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene tpiA CDS complement(1165019..1166230) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1166347..1167363) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene gap CDS complement(1167417..1168448) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 tRNA 1168700..1168773 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1168804..1169640) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1169737..1170147) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1170222..1171718) product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1171794..1173293) product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1173478..1174914 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1175004..1175450 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1175483..1176841) product C45 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1176855..1178180) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1178215..1179864) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1180114..1181796) product SH3-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1181989..1182573 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene clpP CDS complement(1182618..1183553) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene whiA CDS complement(1183546..1184589) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1184600..1185475) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene rapZ CDS complement(1185565..1186110) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546590.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1186171..1189020) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene uvrA CDS complement(1189020..1191053) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene uvrB CDS complement(1191158..1192882) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1192951..1193214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1193232..1194104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1194262..1195182) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene trxB CDS complement(1195258..1196277) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1196311..1197147) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene lgt CDS complement(1197156..1198106) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene hprK CDS complement(1198121..1198396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1198400..1199398) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene prfB CDS complement(1199576..1201975) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene secA CDS complement(1202111..1202656) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene raiA CDS complement(1202737..1203432) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1203429..1204712) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1204755..1205417 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1205440..1206603) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1206709..1208340) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene rny CDS complement(1208454..1209536) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene recA CDS complement(1209685..1211256) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1211256..1212125) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1212237..1212698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1212699..1213181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1213194..1214009) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene recX CDS 1214133..1215512 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene rlmD CDS complement(1215866..1216606) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1216890..1217174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1217166..1217411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1217414..1218265) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1218347..1220746) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1221020..1221784 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1221790..1222155 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1222208..1222933) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1222933..1223856) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1223960..1224655) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene rpiA CDS complement(1224657..1225577) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene rbsK CDS complement(1225676..1226143) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1226247..1226825) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene pgsA CDS complement(1226838..1228028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1228083..1228811) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1228816..1230060) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1230057..1231325) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1231327..1233780) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1233799..1234191) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1234191..1234754) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1234812..1236005) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1236017..1236397) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1236561..1237589 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1237610..1238440 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1238522..1239214 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1239249..1241024) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1241151..1242050) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1242028..1242831) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1242828..1243460) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1243539..1244153 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 1244273..1244902 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1244894..1245739) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1245803..1246561) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1246645..1247043) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene spxA CDS complement(1247292..1249025) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene ptsP CDS complement(1249025..1249291) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1249406..1249588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1249933..1252005 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1252144..1252425 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1252450..1252929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1252919..1253848) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546370.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1253914..1254567) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1254589..1255230) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1255230..1256045) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1256057..1256797) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1257412..1258056 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene udk CDS complement(1258091..1258669) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1258863..1260632) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1260632..1262368) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1262369..1262806) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254192.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1262933..1263718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1263827..1264438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1264653..1266311) product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene aspT CDS complement(1266331..1267935) product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1268399..1268551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1268706..1269083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 note possible pseudo, frameshifted CDS 1269194..1269676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 note possible pseudo, frameshifted CDS 1269843..1270370 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546345.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene pyrR CDS 1270388..1271713 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1271764..1272321) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(1272398..1274170) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1274297..1275760) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546350.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1275865..1277334) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1277430..1278107) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 1278257..1279009 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254508.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1279058..1279693) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1279772..1279966) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1279963..1280454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1280576..1281109) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene hpt CDS complement(1281222..1282040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 note possible pseudo, internal stop codon CDS complement(1282050..1282613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 note possible pseudo, internal stop codon CDS complement(1282712..1283068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1283179..1283361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1283513..1284703 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1284777..1288319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1288517..1289545) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1289836..1290645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1290527..1291453 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1291440..1291958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1292026..1293636) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1293651..1294796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1294819..1298010) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1298007..1298576) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1298797..1300149) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene rlmD CDS 1300513..1301886 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene nhaC CDS 1301976..1302680 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1302740..1303660) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1303685..1305115) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene gatB CDS complement(1305120..1306559) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene gatA CDS complement(1306559..1306861) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene gatC CDS complement(1306873..1308012) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1308027..1310033) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene ligA CDS complement(1310073..1312307) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene pcrA CDS complement(1312394..1313032) product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 tRNA complement(1313117..1313203) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(1313716..1314417) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1314420..1315850) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1315860..1317008) product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1317096..1319765) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1319943..1320773) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene nadE CDS complement(1320770..1322248) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1322326..1323423) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1323420..1324151) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1324274..1324660 product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene tagD CDS complement(1324689..1325387) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1325473..1326588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1326748..1327470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 tRNA complement(1327632..1327703) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(1327757..1327838) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1327964..1329715) product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1329953..1330258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1331094..1331426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1331455..1332693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1332690..1333439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 note possible pseudo, frameshifted CDS complement(1333423..1334667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1334672..1335721) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1335726..1336469) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 tRNA complement(1336765..1336836) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1336946..1337605) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1337860..1338858) product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1338934..1339746) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1339721..1340530) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1340541..1341452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1341657..1342472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1342544..1343728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1343810..1344550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1344696..1345514 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254202.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1345547..1346122) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1346186..1347259) product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1347350..1348057) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 1348731..1349138 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene psiE tRNA complement(1349220..1349293) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(1349348..1350190) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1350308..1351066) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1351191..1352183 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene galE CDS 1352399..1354057 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1354130..1354543) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548490.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1354559..1355092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 note possible pseudo, internal stop codon CDS complement(1355461..1358085) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene adhE CDS 1358436..1359812 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1360165..1360332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1360447..1361340 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1361379..1361762) product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1361769..1362689) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1362718..1363524) product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1363535..1364548) product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 tRNA complement(1364757..1364830) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 rRNA complement(1364849..1364958) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(1365032..1367929) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(1368056..1368130) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(1368186..1368260) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 rRNA complement(1368384..1369947) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(1370169..1370345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1370407..1370940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1371149..1371604) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene smpB CDS complement(1371616..1373937) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rnr CDS complement(1374013..1374246) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene secG CDS complement(1374302..1376374) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1376446..1377471) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1377471..1378514) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1378507..1379679) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 tRNA complement(1379805..1379891) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(1379922..1379992) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(1380016..1380090) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(1380096..1380169) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(1380181..1380253) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(1380258..1380341) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(1380346..1380421) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1380426..1380501) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(1380503..1380578) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(1380585..1380674) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(1380715..1380788) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(1381005..1381715) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 tRNA complement(1382108..1382197) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(1382200..1382276) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(1382280..1382350) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(1382369..1382443) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1382448..1382523) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1382525..1382600) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1382629..1382704) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1382714..1382789) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(1382815..1382888) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(1382893..1382968) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(1382977..1383062) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1383075..1383146) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(1383157..1383231) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(1383256..1383339) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(1383352..1383424) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(1383425..1383500) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 rRNA complement(1383508..1383617) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(1383691..1386588) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(1386715..1386789) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(1386845..1386919) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 rRNA complement(1387043..1388606) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(1388828..1389055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1389078..1390385) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene serS CDS complement(1390604..1391155) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1391155..1391760) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1391930..1392724 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1392727..1393596 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1393612..1394115) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1394306..1395463) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1395762..1397144 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1397204..1397872) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702140.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1397994..1399322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1399322..1399441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1399510..1399659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1399662..1402187) product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene lanKC CDS complement(1402189..1403904) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1403907..1404065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1404218..1404358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1404550..1405557) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1405763..1409668) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1409685..1410248) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1410350..1411288) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1411300..1412217) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1412355..1413656) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1413707..1415008) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1414992..1415816) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1415820..1416686) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1416686..1417771) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1418074..1419501) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1419550..1420380) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1420478..1421434) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1421450..1422271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1422275..1422922) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1422924..1423373) product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1423378..1424646) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene pepT CDS complement(1424733..1425494) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene pnuC CDS complement(1425660..1426406) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1426526..1428130) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1428259..1429173 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1429232..1430182) product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene bsh CDS complement(1430185..1431543) product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1431569..1432924) product conjugated bile salt MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861900.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1433162..1433779 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933281.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1433811..1434332) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1434332..1434787) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1434900..1435283 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1435366..1435959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1435995..1436570) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene efp CDS complement(1436690..1437604) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene coaA CDS 1437658..1438227 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1438238..1438693) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1438695..1439507) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1439511..1440131) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1440144..1440785) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1441213..1443510) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene helD CDS 1443666..1444361 product matrixin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1444423..1445073 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1445101..1446945) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1446963..1447709) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1447851..1448468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1448475..1449767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1449871..1450713) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1450713..1451405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1451424..1451750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1451847..1454012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1454133..1454870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1455008..1456054) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1456326..1457276) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1457474..1458355) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene galU CDS complement(1458458..1459393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1459519..1460139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1460632..1463049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1463237..1464220) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rfbD CDS complement(1464237..1464845) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene rfbC CDS complement(1464870..1465754) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene rfbA CDS complement(1465761..1466798) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene rfbB CDS complement(1467026..1468168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1468349..1468561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1468824..1469954) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1470730..1471830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1471987..1472766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1473022..1473531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1474017..1474694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1474966..1476393) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1476399..1477520) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene glf CDS complement(1477513..1478913) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1478915..1480210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1480211..1481215) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1481205..1482203) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1482268..1483392) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1483403..1484056) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1484090..1484860) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1484863..1485657) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1485673..1486536) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1486548..1487597) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1487812..1489089 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene hflX CDS complement(1489420..1490661) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1490967..1492022 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1492150..1492872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 note possible pseudo, frameshifted CDS 1492886..1493377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 note possible pseudo, frameshifted CDS complement(1493430..1494434) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1494684..1495541) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1495741..1496301) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1496506..1497057) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1497148..1497450 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1497549..1499075 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1499110..1499736) product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1499853..1500296 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene nrdI CDS 1500299..1501231 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254563.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1501367..1501876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1502166..1502723 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1502917..1503387) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1503390..1504163) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549818.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1504180..1505721) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549817.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1505769..1506128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1506245..1507465) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013853658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1507487..1508386) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1508452..1509444 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476124.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1509441..1511189) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene cydC CDS complement(1511179..1512897) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene cydD CDS complement(1512897..1513913) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene cydB CDS complement(1513914..1515341) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1515715..1516992) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1517149..1518948 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene pepF CDS 1519042..1519422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1519558..1520787) product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1520919..1521716) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1521716..1522369) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1522409..1523311) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1523550..1523828) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1524126..1526114) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1526147..1527061) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene pfkB CDS complement(1527058..1527816) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1527969..1528325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1528338..1528532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1528618..1528917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1528893..1529129) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1529142..1529675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549769.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1529812..1530108) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1530191..1543183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1543348..1544097) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1544129..1545700) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1545752..1546906) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1546912..1547598) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1547787..1548125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1548189..1550051) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1550063..1551697) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1551904..1552689) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1552698..1553798) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene ychF CDS complement(1553836..1554102) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1554095..1554979) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1554957..1555736) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1555751..1556596) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene noc CDS complement(1556620..1557342) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rsmG CDS 1557506..1558042 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1558524..1559282 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1559326..1560270) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1560273..1561064) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1561158..1561706) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1561719..1562258) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1562422..1563045) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1563171..1563413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1563493..1564902 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1564959..1565633) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1565636..1566697) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1566697..1567227) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1567338..1567937) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1568038..1568793 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1568790..1569551) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene yaaA CDS 1569612..1570250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1570262..1571077) product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1571221..1572432 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1572579..1572731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1572760..1574013) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1574096..1575589) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1575735..1578266) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1578462..1578821 product aggregation promoting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1578880..1579860) product cytochrome C5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1580006..1581247 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044005378.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1581281..1582321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1582408..1582911) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1583030..1583650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549738.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1584358..1585215) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1585219..1586577) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1586647..1587864) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1587951..1589057) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1589108..1591381) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1591555..1593273) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1593264..1594940) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1595049..1595999) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1596009..1596782) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1596901..1598403) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549614.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene glpK CDS 1598541..1599347 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene thiD CDS 1599449..1600132 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1600200..1601123) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549601.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1601127..1602059) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1602142..1602483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1602501..1602863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1603049..1603924) product SEC10/PgrA surface exclusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1604463..1605758) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene purB CDS complement(1605762..1607051) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1607252..1608244 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 tRNA 1608338..1608412 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 1608421..1608494 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 1608861..1609871 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene asnA CDS complement(1609942..1610601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1610716..1612110) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549571.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1612120..1612848) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1612958..1614334) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1614388..1615737) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1615874..1616611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1616735..1618858) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1619187..1620077) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1620067..1621386) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1621502..1621735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1621763..1622032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1622208..1622924) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1623184..1624128) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1624128..1625417) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene dltD CDS complement(1625410..1625649) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene dltC CDS complement(1625681..1626916) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene dltB CDS complement(1626916..1628430) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene dltA CDS complement(1628446..1628598) product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1628793..1628933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1629067..1630203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1630390..1630566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1630585..1633095) product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene lanKC CDS complement(1633103..1634818) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1634820..1634963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1635368..1636678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1636679..1637452 product competence system response regulator transcription factor ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene comE CDS 1637964..1638467 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1638589..1640418 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1640563..1641726 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1641759..1642304) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1642482..1644056) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1644158..1645015 product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1645077..1645748) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1646034..1646927 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1647028..1649364 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1649572..1650390) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1650505..1651233 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene nagB CDS 1651393..1652058 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1652078..1652764 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1652813..1653925) product SLAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565478.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1654207..1655169) product class III bacteriocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1655197..1655520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1655849..1656205 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967401.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1656186..1656665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1656802..1658610 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1658643..1659506) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1659744..1661051 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1661118..1661828) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1662146..1663456 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1663702..1664043) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1664037..1664285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1664737..1666047 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1666402..1668036 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 1668150..1668527 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1668550..1668837 product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1668837..1670765 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1671322..1672278 product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1672315..1673799) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1674030..1676126 product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547166.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1676137..1677405 product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1677466..1677726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1677853..1678500) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 1678647..1679210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1679203..1679382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1679597..1680874 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1680947..1682572) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1682698..1683570 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547386.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1683575..1684540) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117118241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1684688..1686241) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1686362..1687765) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene gndA CDS complement(1687864..1689678) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene spxB CDS complement(1689993..1690652) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044665005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1690645..1692741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1692792..1693253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1693420..1694238) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1694451..1696346) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene mnmG CDS complement(1696356..1697741) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene mnmE CDS complement(1697848..1698714) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1698716..1699090) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rnpA CDS complement(1699142..1699282) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene rpmH sequence2 source 1..19578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(506..715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(697..1005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1380..1610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1730..2182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(2335..3210) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(3207..3797) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(3906..4517) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 5501..6400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 6360..7109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 7106..7411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 7404..8282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 8288..9214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 9208..10518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 10496..11089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(11587..12930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(13607..14221) product DUF6037 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 14369..14992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(15113..15418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(15411..16217) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 16732..16950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 16971..17192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 17257..17400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 17457..17786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 17979..18137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 18248..18820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 sequence3 source 1..319380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 615..938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1036..1881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 note possible pseudo, internal stop codon, frameshifted CDS complement(1913..2137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(2315..2743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 note possible pseudo, internal stop codon, frameshifted CDS complement(2849..3031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 note possible pseudo, internal stop codon, frameshifted CDS complement(3021..14525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 14666..15004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 note possible pseudo, frameshifted CDS 15251..15514 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(15558..15836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(15900..16217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 note possible pseudo, frameshifted CDS complement(16196..16561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 note possible pseudo, frameshifted CDS complement(16593..16934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 note possible pseudo, frameshifted CDS 17143..18009 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(18217..19458) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 repeat_region 19653..20273 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacattcctcttaagttaaataaaaac CDS complement(20457..20738) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene cas2 CDS complement(20744..21733) product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene cas1b CDS complement(21744..22235) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene cas4 CDS complement(22252..24681) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 repeat_region 25162..25381 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatttacattcctcttaagttagataaaaac CDS complement(25559..26272) product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene cas5b CDS complement(26259..27161) product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene cas7i CDS complement(27180..28934) product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene cas8a1 CDS complement(28952..29710) product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene cas6 CDS 29946..30095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(30169..31557) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(31569..32489) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene mmuM CDS 32909..34045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 34116..35051 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(35088..36263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(36256..37899) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(37913..41011) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775680.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(41210..41548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(41608..41847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 42145..42354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 42354..42500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(42623..43864) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 44148..44342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(44386..44538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(44525..45151) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(45281..45514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(45796..46461) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(47136..47498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 note possible pseudo, internal stop codon CDS complement(47643..47867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 48097..48870 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025006378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene proC CDS complement(48926..49621) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(49642..50619) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(50637..52172) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102223.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(52194..53378) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(53388..54125) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(54274..55134) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102225.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 55413..56288 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172399972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 56458..57294 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(57308..57490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(58075..58251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(58380..65414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 65701..67545 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 67646..68575 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 68627..69955 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254069.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(70042..70464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 70732..72075 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(72130..72996) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(73012..73752) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(73762..74433) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(74414..75073) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(75398..75841) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(76021..76308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 76364..77470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 77470..78027 product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548152.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 78326..78538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 78513..78782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 78845..79234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(79476..80246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 repeat_region 80302..80757 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggatcacccccacccatgtggggaatac CDS complement(81054..81932) product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene cas2e CDS complement(81938..82876) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene cas1e CDS complement(82879..83526) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene cas6e CDS complement(83537..84247) product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene cas5e CDS complement(84228..85349) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene cas7e CDS complement(85353..85952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(85969..87669) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(87662..90412) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 91229..91384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 repeat_region 91806..92627 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggatcacccccacgtgtgtggggaatac CDS complement(92845..93678) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene coaA CDS complement(93653..93796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(93834..95405) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(95675..96613) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(96663..97457) product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 97828..98097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, internal stop codon CDS 98128..98583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 note possible pseudo, internal stop codon CDS complement(99283..99423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 note possible pseudo, internal stop codon CDS complement(99451..99660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 note possible pseudo, internal stop codon, frameshifted CDS complement(99698..99889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 note possible pseudo, internal stop codon, frameshifted CDS 100032..100430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(100462..100686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(100843..100977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(100977..101195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 101360..101803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 101824..102039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(102105..107201) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(107460..108125) product bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(108106..109083) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(109144..110481) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(110515..111342) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674968.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene kduD CDS 111497..112252 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(112356..113981) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(114546..116615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(116820..117182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(117175..117951) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 119352..120608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 120803..121243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 121908..125321 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 125305..127155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 127308..128537 product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene mtnK CDS 128549..129601 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 129618..130271 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(130276..130545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 130768..131112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 131245..131760 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 132042..132908 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 133064..134431 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254451.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(134491..135471) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(135468..136151) product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065989431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 136304..137143 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547578.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 137152..137808 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(137805..138254) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(138332..138697) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 138921..139958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 139958..140926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(140961..142109) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 142875..143840 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 143856..145475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 145554..146390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 146503..147558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 147565..148239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 148329..149474 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 149600..150730 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(150785..151741) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(151741..152895) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(152899..154425) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(154496..155581) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(155800..156081) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(156246..156656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(156837..157367) product hydrophobic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(157838..158068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 note possible pseudo, internal stop codon CDS complement(158214..158762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 note possible pseudo, frameshifted CDS 159080..159703 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547344.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 159850..160713 product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 160853..161002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(161148..161585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 163225..164586 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene brnQ CDS complement(164671..165636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 165819..166385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 166501..167142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 167142..167924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 167921..168802 product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene isdE CDS 168805..169737 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 169730..170476 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(170523..170867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 170819..170986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 171059..171670 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 171687..172115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(172171..173331) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(173412..176150) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene ppc CDS 176604..177983 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene brnQ CDS 178080..178274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 178275..178475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 178579..179526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 179543..180100 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(180131..181690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 182601..183344 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580891.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(183472..183699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(184009..184233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 184412..184654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 185142..185426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 note possible pseudo, internal stop codon, frameshifted repeat_region 185655..186355 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttctccacgtatgtggaggtgatcc CDS 186421..186804 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 186831..187142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 187211..187864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 188374..188496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 188798..189280 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(189351..189773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 note possible pseudo, frameshifted CDS complement(189760..190125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 note possible pseudo, frameshifted CDS complement(190053..190907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(190954..191529) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861425.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 191700..192017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 192014..192292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 192573..193718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 193733..194737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 194771..195985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(196362..199016) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(199355..200221) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 200524..202113 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 202116..203699 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(203779..204531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(204778..205959) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(206134..207141) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(207153..208163) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 208344..208826 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(208890..210467) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 210603..210938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 210938..211384 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 211389..212198 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 212210..212512 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 212505..212864 product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 212871..213080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 213089..213880 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 213983..214276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 214378..216576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 216628..217374 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 217523..218044 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 218062..218559 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 218549..219163 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 219209..220402 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135960404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(220619..220786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(220783..221052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 221131..221634 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034532906.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 221618..222439 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 222440..222904 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 222913..223674 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 223686..224468 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547366.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 224509..225282 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 225275..225724 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(226161..227012) product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(227071..228306) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(228485..228697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 note possible pseudo, internal stop codon, frameshifted CDS complement(228864..229139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 note possible pseudo, frameshifted CDS complement(229379..229615) product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 229796..231331 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 231331..233526 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 233519..234895 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 234941..236320 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 236402..237334 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene ppx CDS 237587..238261 product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 238399..239550 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 239749..240780 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 240921..241427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 241452..242528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 242645..243190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(243229..243507) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 243587..244717 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 244799..246082 product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548475.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 246530..252127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 252557..253066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(253412..253945) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254011.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(253942..254466) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(254466..254852) product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(254873..257110) product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene nrdJ CDS complement(257326..257871) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 257959..258198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 note possible pseudo, internal stop codon, frameshifted CDS 258698..259339 product temperature-sensitive replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547721.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(259457..260581) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 260712..260975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 261075..262238 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 262328..262615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 262781..263287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 263619..264284 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 264547..266196 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 266343..267266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(267439..267897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 268109..270439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 note possible pseudo, internal stop codon CDS 270578..273499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 273853..274464 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 274954..276576 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154881464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 276817..277698 product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 277766..278260 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 278307..278744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 278713..279354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(279503..279877) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene dhaM CDS complement(279874..280458) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548127.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene dhaL CDS complement(280471..281466) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548125.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene dhaK CDS 281841..282629 product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 282789..284720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(284784..285080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(285170..286084) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene htpX CDS 286237..287154 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(287126..287776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 288152..288280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(288355..290943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(290950..291714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 note possible pseudo, internal stop codon, frameshifted CDS complement(291729..292493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 note possible pseudo, internal stop codon, frameshifted CDS complement(292483..293934) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(293949..297164) product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene hsdR CDS 297293..298387 product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene xerS CDS 298936..300306 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(300394..300957) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 301219..302022 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547157.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 302037..302645 product DUF5052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 302867..304018 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(304264..304662) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(304856..305068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(305248..305697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(305715..305942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 306028..306354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(306530..307312) product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(307352..307561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 307724..308086 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 308095..308262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 308268..308540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 308563..308835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 308744..309496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 309520..309837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 309861..310577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 310612..311163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 311206..311976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(311957..312103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 312294..313460 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087235334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(313550..314431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(314610..315587) product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547395.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene bsh CDS complement(315666..316928) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(316940..317503) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 317632..317808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 318194..318814 product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531736.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810