COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..132340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..575 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029732907.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_00010 CDS complement(602..895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 890..1093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1011..1706) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(1703..3274) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3402..4946) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5056..7230) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene glgB CDS complement(7361..8815) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8985..10691) product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene treS CDS complement(10678..12723) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 12981..14657 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 14761..15765 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 15765..16715 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 16721..17731 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 17800..18861 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 18930..21494 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(21595..23457) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(23454..25340) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 25412..25795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(25815..26288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(26600..27349) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(27454..28665) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 28937..31159 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene glgX CDS 31202..31822 product ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 31966..33774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 33782..36016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 36094..37986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 38000..39628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 39979..42693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 42693..43733 product thiopeptide-type bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 43730..44842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 44854..45759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 45779..46534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 46547..48409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(48416..49159) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(49297..49473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 49689..50981 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 50971..51234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(51255..52250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(52530..52727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 52841..53011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(53070..53372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 53388..54398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 54599..55654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 56024..56683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 57581..58276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(58283..59206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(59270..60544) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 60843..61850 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 61843..62628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 62834..64003 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 64069..64515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 64512..65528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 65614..66606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 66717..67214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 67327..68589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(68576..69958) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(70036..71307) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(71321..71701) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene gcvH CDS complement(71826..72938) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene gcvT CDS 73296..74066 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973524.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 74063..74773 product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(74758..75312) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 75409..75882 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 76109..77191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(77219..77431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(77450..78067) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(78130..78798) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973511.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 78887..80056 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 80182..81351 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene mnmA CDS complement(81332..81562) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(81562..82290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(82326..83156) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 83209..83898 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 83942..84994 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 85011..87254 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene ligA CDS 87448..89604 product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene rmdB CDS 89746..90045 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene gatC CDS 90042..91535 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene gatA CDS 91532..91801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 91788..93299 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene gatB CDS 93470..93745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 93796..96867 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(96833..97024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 97279..97488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 97485..100571 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(100636..101595) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 101486..101758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 101769..102740 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 102941..106006 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 106235..108112 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 108154..108678 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene ilvN CDS 108787..109785 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene ilvC CDS 110064..111653 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene serA CDS complement(111750..112790) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(113527..114555) product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 114834..115541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(115590..116240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(116487..117602) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 117788..118717 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 118749..120380 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene pruA CDS 120638..120826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 120908..121960 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 122366..123475 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 123873..125492 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene cimA CDS 125677..127260 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 127293..127529 product acyl-CoA carboxylase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(127636..127815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(127914..128216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 128344..132222 product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 sequence02 source 1..3535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..3166 product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030300.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 sequence03 source 1..848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence04 source 1..449750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(769..1653) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 1736..2245 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(2280..3563) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(3560..5035) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974843.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(5084..6634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(6631..7923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(7913..8749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029454.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(8887..9078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(9065..9967) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 10195..10644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 10641..11216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(11210..13309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(13600..13719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(14117..14671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(14712..15425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 15648..16022 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(15950..16432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(16627..17223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(17254..19620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(19617..20030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 19938..20144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 20180..20554 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(20538..21470) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 21525..21809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 21850..22494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(22448..23077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 23209..24810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(24793..25704) product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(25769..26422) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(26443..27111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(27214..28200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 28548..29255 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 29325..29792 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 29828..30994 product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene mqnE CDS 31000..31518 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 31613..31924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 32231..33607 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(33691..35259) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene dacB CDS 35258..36139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 36426..38273 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(38310..38681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(38852..39055) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 39216..40130 product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 40145..41749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 note possible pseudo, frameshifted CDS 41815..43011 product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene mqnC CDS complement(43068..43457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(43608..44456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 44602..45258 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 45337..46632 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(46748..47626) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(47630..50329) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(50447..51292) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(51534..52313) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 52638..52997 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 53057..53611 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 53608..54321 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 54444..55679 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 55676..56506 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene nuoE CDS 56506..57870 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene nuoF CDS 57867..60398 product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 60398..61792 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene nuoH CDS 61785..62441 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene nuoI CDS 62531..63349 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 63346..63645 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene nuoK CDS 63658..65553 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene nuoL CDS 65555..67180 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 67173..68777 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene nuoN CDS complement(68878..69420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(69556..70806) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene fahA CDS 70964..71974 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 72234..73118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(73170..73640) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 73689..74273 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(74299..74478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(74750..75664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(75675..76652) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene rarD CDS complement(76747..77337) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(77462..78529) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(78519..80459) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(80619..81278) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(81344..82627) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(82657..83832) product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 83971..84342 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 84333..84878 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 note possible pseudo, frameshifted CDS 84875..86068 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 note possible pseudo, internal stop codon, frameshifted CDS 86068..87027 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 87024..87548 product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 87560..88042 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 88042..88371 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene nuoK CDS 88368..90272 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 90283..91836 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 91833..93323 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 93459..94319 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene htpX CDS 94332..94739 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(94764..95252) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 tRNA 95403..95485 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(95589..95870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(96415..97317) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(97364..98098) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(98363..98812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(98838..99734) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(100278..100694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(101118..102371) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(102368..102925) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(102922..104880) product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(104880..105314) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974730.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(105379..107202) product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(107226..107948) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(108025..108447) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(108538..109461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 109402..109623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 109853..110704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 110795..112048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 112109..112333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(112654..112830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(112827..113333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(113333..113779) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(113928..115535) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 115845..117230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 117422..118786 product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(118811..120964) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(120961..121674) product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(121830..122543) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 122913..123515 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(123584..124246) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 124297..125103 product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(125082..126323) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 tRNA 126480..126553 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 126600..126673 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 126763..126927 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene rpmG CDS 127001..127456 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 127453..127887 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 127974..128528 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 128616..130070 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 130137..131201 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 131383..132237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(132278..133288) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(133369..134613) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 tRNA 134751..134824 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 134922..135194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 135271..136155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 136227..136916 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 136923..138317 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(138330..139259) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 139363..140766 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 140918..141352 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene rplK CDS 141428..142144 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene rplA CDS 142284..143192 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 143444..144004 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene rplJ CDS 144093..144485 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene rplL CDS 144964..148449 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene rpoB CDS 148542..152441 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 152803..153177 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene rpsL CDS 153181..153651 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene rpsG CDS 153688..155811 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene fusA CDS 155980..157173 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene tuf CDS 157374..157739 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 157736..159436 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 159637..160593 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 160590..161414 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 161435..162823 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(162886..163803) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(163864..165039) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(165108..165425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 165550..166551 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 166548..167291 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 167288..167626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 167623..169098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 169443..169751 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene rpsJ CDS 169766..170410 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene rplC CDS 170420..171085 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rplD CDS 171085..171417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 171458..172294 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene rplB CDS 172309..172590 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene rpsS CDS 172602..172979 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene rplV CDS 172979..173818 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene rpsC CDS 173824..174243 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene rplP CDS 174243..174479 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene rpmC CDS 174479..174775 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rpsQ CDS 174778..175146 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene rplN CDS 175150..175473 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rplX CDS 175473..176039 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene rplE CDS 176043..176228 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 176331..176723 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene rpsH CDS 176743..177282 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene rplF CDS 177286..177669 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rplR CDS 177707..178309 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene rpsE CDS 178309..178491 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rpmD CDS 178493..178960 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rplO CDS 179174..180496 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene secY CDS 180496..181155 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 181287..182123 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene map CDS 182259..182480 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene infA CDS 182845..183225 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rpsM CDS 183293..183697 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene rpsK CDS 183726..184352 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene rpsD CDS 184465..185487 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 185581..186087 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rplQ CDS 186172..187011 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene truA CDS complement(187008..187886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(187961..191002) product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 191518..197751 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 198381..198542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 198548..198841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 note possible pseudo, frameshifted CDS 200245..200484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 200599..200853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 200992..202611 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 202831..203274 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene rplM CDS 203317..203832 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene rpsI CDS 203934..205289 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene glmM CDS complement(205312..206322) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene coaA CDS 206213..206635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 206668..207174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 207171..207539 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(207706..209271) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 209340..210497 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene alr CDS 210562..211002 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene tsaE CDS complement(211122..211685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 211819..212484 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene tsaB CDS 212481..212978 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rimI CDS 212990..214138 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene tsaD CDS 214135..214383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 214380..215558 product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 215576..216064 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 tRNA complement(216228..216301) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 216520..217830 product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(217803..218543) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 218656..219054 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(219127..220140) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 220523..221782 product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 221857..223338 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 223341..224576 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(224757..225551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 225763..226413 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 226520..228058 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 228230..228991 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 228988..229935 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene pfkB CDS 229932..232001 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(232002..232874) product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(232871..233491) product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(233537..234703) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 234794..235492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(235517..236020) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 236136..236546 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(236573..237124) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene mscL CDS complement(237206..237997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(238096..238929) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(238926..239312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 239593..242334 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(242438..243055) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 243110..244024 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene galU CDS 244017..245327 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 245324..245803 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene moaC CDS 245800..246294 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 246291..246917 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 247013..247969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 tRNA 248022..248096 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 248325..248756 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 249112..249804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(249868..250815) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(250809..251390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(251466..252086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(252343..253500) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(253497..254243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(254343..255428) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 255567..257921 product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 257985..259499 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(259554..260924) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(260988..261638) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(261635..263662) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene tkt CDS 263907..264635 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 264670..265125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 265122..265403 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 265527..266933 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162861356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(267015..268031) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(268053..268856) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(268971..270014) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(270011..271048) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(271115..271654) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(271704..271955) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(272036..272359) product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene wblA CDS 272578..273450 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(273401..276376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(276510..278177) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179748936.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(278195..279133) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(279130..280119) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(280324..281124) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 281279..281773 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(281778..282806) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 282867..283466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 283511..283885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 283869..286541 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene mgtA CDS 286630..288024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(288109..288303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(288376..291687) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 291866..294100 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 294262..295035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(295057..296652) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134111963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(296759..298486) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 298519..299409 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene rsmI CDS 299447..299728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 299774..300616 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 300609..301472 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rsmA CDS 301586..302521 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 302524..304362 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 304496..306412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 note possible pseudo, frameshifted CDS 306409..307101 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 307944..309038 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene galT CDS 309035..310012 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene galE CDS 310009..311175 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene galK CDS 311211..311486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(311456..312349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 312697..313326 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(313368..313835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(313840..314265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(314380..315345) product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(315511..316446) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(316494..316985) product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene tamR CDS 317074..317880 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 317992..319890 product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 320030..320434 product rodlin RdlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene rdlB CDS complement(320621..321307) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(321315..322343) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 322599..325352 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene ppc CDS 325474..326163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(326174..326875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(327070..327282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 327469..328443 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(328504..329079) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene pth CDS complement(329130..329720) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(329893..330870) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(331004..332416) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene glmU CDS complement(332600..334996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 note possible pseudo, internal stop codon, frameshifted CDS complement(335004..335915) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 336143..337123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(337154..337954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(337962..338915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(339000..339239) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(339236..340051) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(340264..341244) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(341241..341900) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(342029..343351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(343356..344582) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 344859..345509 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(345535..346290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(346297..347085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 347280..348212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 note possible pseudo, frameshifted CDS 348212..348364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 note possible pseudo, frameshifted CDS 348433..349053 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 349151..349789 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(349737..350240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 350469..354020 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene mfd CDS complement(354235..354897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 355084..356961 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 357040..357681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 357678..358943 product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene pkaE tRNA complement(359041..359114) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 359251..360639 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 360650..361900 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 362015..363049 product resuscitation-promoting factor protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpfC CDS 363518..364210 product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene rpfA CDS 364477..365757 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene eno CDS 365851..366360 product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene divIC CDS 366366..366938 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 366935..367864 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(367871..368011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 368321..369709 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(369767..370426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(370423..370830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(370891..371376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(371628..372170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 372233..373546 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(373533..376073) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(376174..376953) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 tRNA 377353..377435 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 377886..378395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 378392..378799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 378796..379764 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 379761..380708 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 380942..382165 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230488.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 382282..382776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 382773..383018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 383015..383398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 383515..384516 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(384539..384754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(384859..385797) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 385891..386535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 386682..387545 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(387638..387955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(387982..388455) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(388642..388956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(389030..389902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(390156..391376) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(391461..392621) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 392829..394226 product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(394487..394897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 394979..395866 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(395887..397251) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 397361..399022 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 399147..400355 product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 400346..401698 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 401716..402894 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene hutI CDS 402940..404238 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(404235..404966) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(405013..405936) product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 406184..406564 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 406833..407357 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 407426..408103 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 408114..409373 product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene draK CDS complement(409349..409819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 410023..411150 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 411147..411671 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene purE CDS 411668..412855 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 413392..414186 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(414282..415082) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(415079..416041) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 416158..416907 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(416957..418117) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 418221..419564 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(419664..420938) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 421038..421568 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(421622..422542) product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(422581..423852) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 423963..424730 product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 424770..424985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 425102..426931 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486660.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 426921..428771 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(428759..429790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 429872..430867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(430831..431022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(431076..432386) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(432383..433348) product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene cofD CDS complement(433361..433942) product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 434338..434601 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 434803..438450 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 438447..439991 product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(440010..440384) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 440712..441053 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 441085..442455 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 442565..442756 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 442753..443943 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 443961..445226 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene manA CDS 445452..446870 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene ahcY CDS 446928..447602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(447586..448434) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 note possible pseudo, internal stop codon CDS 448491..449480 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 sequence05 source 1..292813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 374..913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 935..2011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(2035..2259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(2262..3134) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 3370..3789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 3807..4244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 4370..5161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 5182..5706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 5703..6665 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene era CDS complement(6706..7482) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 7738..9498 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene leuA CDS 9661..10248 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(10348..11682) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene hemL CDS 11782..12531 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(12555..13088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(13085..13882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(13924..14976) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 15074..15652 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(15649..16053) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 16169..16576 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 16690..17439 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene recO CDS 17488..18348 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(18338..19906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(20029..20628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(20662..21102) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(21155..22027) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(22027..22752) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(22775..23815) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 24000..25382 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(25448..26032) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(26153..26737) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(26819..27406) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(27441..28475) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 28568..29716 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene dusB CDS complement(29778..31013) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(31258..31770) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(31811..33775) product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(33720..35177) product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 35328..36542 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(36758..37792) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(37821..38312) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(38342..38962) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 39068..39670 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 39892..42624 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene ppdK CDS 42941..43900 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145736531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(44091..44774) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(44771..46438) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 46518..47549 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(47571..48515) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976313.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(48579..50870) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(50924..51760) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972114.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(51757..52653) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(52669..53964) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 54216..54521 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(54616..55653) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 55790..57217 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 57423..57956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 58029..58715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 58784..59551 product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 59557..62049 product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(62065..62421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(62421..65018) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene nirB CDS complement(65018..66163) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 66586..67122 product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene aac(2')-Ic CDS complement(67133..67897) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 68082..68537 product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(68524..68847) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(69010..69393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(69454..71523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 71408..71752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 71749..72540 product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 73181..74428 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 74438..75736 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 75795..77066 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 77222..78292 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 78333..78833 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 78876..80624 product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 80747..81355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 81422..83314 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene dnaG CDS 83470..84477 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(84514..85590) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484788.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(85885..87327) product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(87395..88210) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(88302..89699) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(89765..91183) product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 91363..92637 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 92630..93343 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(93419..94384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(94477..95844) product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene mrx(A) CDS complement(95841..96494) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 96614..97093 product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 97100..98338 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 98461..98757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(98761..99861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(99869..100441) product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(100447..102507) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene kdpB CDS complement(102504..104165) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene kdpA CDS complement(104383..105186) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 105282..106637 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 106785..108107 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 108112..109119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(109319..110038) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(110047..111003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(110991..112121) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(112121..112663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 112827..113885 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 113937..114272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 114269..115150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 115239..116210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(116239..117126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 note possible pseudo, frameshifted CDS 117022..117216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 117437..117715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 117712..119478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 119577..121151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 121148..123007 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 122994..123890 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 123932..125047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 125085..126590 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 126789..129518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 129603..129794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 129859..130770 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 130841..131434 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(131530..132705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 133074..134153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 134050..134430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 134564..134719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 134795..135037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(135181..135936) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 135985..136389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 136670..137125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 137290..137538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 137547..137939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 tRNA complement(138093..138170) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(138359..138432) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 138583..138873 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 139055..139786 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 139820..140668 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 140782..141801 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 142009..143529 product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(143735..144838) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 145164..145349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 145534..147270 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 147267..147842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(147900..148745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(148842..151412) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(151479..152579) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(152596..153852) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene gguB CDS complement(153849..155486) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene gguA CDS complement(155539..156663) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene chvE CDS complement(156805..157791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(157891..158913) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(158910..160085) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(160172..160900) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 160794..161114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 161288..161782 product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 161784..162680 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(162847..163836) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 163931..164296 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(164349..165074) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(165083..166471) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(166486..167703) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 167794..168456 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 168447..169646 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(169678..170040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(170040..170261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(170246..170650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 170856..171731 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 171728..171964 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(172016..172759) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 172995..173603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(173648..174277) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 174371..175123 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(175248..175838) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(176031..176930) product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 176978..177226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 177304..177462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(177415..178377) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 178453..179121 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(179253..179741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 179680..180585 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(180569..181156) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 181252..181974 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 181971..182567 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 182642..183244 product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(183420..184688) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(184783..185031) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(185117..186151) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(186174..187127) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(187240..188418) product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fasR CDS 188492..189172 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 189307..190845 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006718507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(190857..191675) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 191789..192283 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 192280..193302 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(193320..193490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(193466..193984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 note possible pseudo, frameshifted CDS complement(194136..195368) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(195352..196452) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029218.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(196603..197298) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(197295..198635) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(198804..199676) product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(199764..200990) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(201090..203822) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene aceE CDS 204221..204649 product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 204746..205204 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 205302..205886 product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 205934..207091 product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 207192..207944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 208058..208390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 208504..210183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 210207..210836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(210859..211557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 211753..212847 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 212844..215294 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 215291..216118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(216063..216695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(216727..216960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(216987..218351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(218400..219167) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 tRNA 219311..219383 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 219476..220018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(220081..220821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 220919..221536 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(221992..223203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 223293..223841 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 223940..224758 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(224762..225397) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 225644..226246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 226473..227054 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(227033..227785) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(227953..229989) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 229898..230092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 230182..231111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(231240..231854) product SCO2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(231856..233415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 233479..234783 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 note possible pseudo, frameshifted CDS 234907..235641 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 235638..236738 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(236943..237773) product DUF5336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(237959..238618) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(238794..239984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107098776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 240166..241035 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 241170..241775 product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 241772..242983 product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(242990..243766) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene yaaA CDS complement(244398..245324) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 245477..246151 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026950.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(246190..246663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 246947..247126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(247241..247828) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(247846..249426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(249423..250025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 250121..251212 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 251480..252532 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 252721..255735 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 255728..256012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 256021..256653 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 256754..257032 product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 257284..258933 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 259013..260374 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 260506..261588 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 261697..262722 product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(262709..263035) product branched-chain amino acid exporter BrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013513.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene brnE CDS complement(263028..263813) product branched-chain amino acid exporter BrnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene brnF CDS 263887..264333 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(264317..264775) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(264820..264993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 265101..265766 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 265900..266607 product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(266590..267660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 267746..268456 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(268515..269336) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 tRNA 269266..269361 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 269499..270089 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 270337..270537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(270512..271486) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 271457..272332 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726969.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(272364..272822) product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 273006..274286 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139561.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 274283..276064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 276075..277349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(277408..278358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(278569..279501) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(279581..280942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 280827..281039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(281047..281967) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(281964..282362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 282262..283800 product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(283905..285560) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(285557..287332) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(287446..288627) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(288624..288821) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(288850..290073) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225331.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(290148..290972) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(291095..291616) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225820.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(291700..291939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 291899..292663 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 sequence06 source 1..880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..823 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 sequence07 source 1..941393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 120..193 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(322..2931) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 3169..8778 product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 9170..9847 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 10163..12676 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 12831..13652 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 13742..15259 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene rimO CDS 15256..15954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 15951..16505 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 16601..16981 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(17123..21793) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 21943..22110 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 22179..23435 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene recA CDS 23438..24058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 note possible pseudo, frameshifted CDS complement(24405..25952) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(26035..26955) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(26952..27626) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(27727..28575) product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(28655..29440) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 29704..30390 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 30406..31908 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(31818..34871) product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(34993..36003) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 36167..37615 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene miaB CDS 37605..37919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 37943..38659 product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(38736..38969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(39005..39247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 39365..40315 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene miaA CDS 40420..40902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327425.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 40955..41821 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene dapF CDS 42152..44281 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 44432..45907 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene hflX CDS 46114..46881 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(46939..48069) product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 48309..49340 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 49412..51016 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 51106..52377 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 52374..53282 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 53272..54177 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 54434..54856 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(54942..56132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 56432..58378 product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 58387..59007 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973221.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 59058..60803 product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 60854..62851 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(62892..63662) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene lexA CDS 64108..64620 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene nrdR CDS 64748..67645 product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 67721..68506 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 68537..69145 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 69181..69864 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 70002..70631 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(70644..72848) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 72990..74189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 74222..74962 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(74881..75225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 75331..76242 product sporulation transcriptional regulator WhiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene whiH CDS 76520..78136 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 78227..79054 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(79172..79402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 79817..81934 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(81941..82840) product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(82929..85403) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 85626..86969 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 86966..88402 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 88607..89284 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(89444..89725) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 89837..92557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 92637..93224 product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 93221..94426 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 94444..95115 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(95112..95855) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 96039..96857 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(97047..98030) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene sepH CDS 98501..99628 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 99621..100475 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(100570..100740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 101083..101736 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 101742..103052 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 103348..103644 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(103666..104184) product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 104173..104697 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene dut CDS 104699..105454 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 105527..105805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 105876..108473 product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 108448..109128 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 109160..109585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 109590..110345 product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973147.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(110353..111024) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(111021..111692) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(111756..111908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 111938..113296 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 113403..114077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 114450..114653 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973099.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 114983..116467 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 117147..117485 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 117631..120477 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 120644..120979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 121037..121342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 121390..121788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 121798..123342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 123339..123689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 123746..126439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 126439..130458 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 130455..131900 product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene eccD CDS 131912..133381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 133385..134776 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene eccB CDS 134773..135921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 135948..136655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 136742..137083 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 137099..138028 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 138028..138894 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene mmuM CDS complement(139182..139955) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 140027..140629 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(140626..140907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(141011..141592) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(141625..142623) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene argF CDS complement(142710..143942) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 144332..145306 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(145311..145601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 145771..146301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 146365..146925 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 146904..148112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(148115..149281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(149677..150306) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 150450..152780 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(153426..155114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 155319..156947 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(156989..159124) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(159218..160537) product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(160534..162099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(162714..163163) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 163344..164228 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 164225..164416 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(164459..164956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(165028..169212) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(169212..172178) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(172226..178627) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(178830..180359) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 180841..183558 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene acnA CDS 183771..185222 product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene ngcE CDS 185228..186214 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 186229..187089 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 187162..188331 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 188548..189663 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 189741..190547 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 190544..191770 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 191955..193859 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene dxs CDS complement(193954..194364) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(194565..195506) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(195615..197744) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(197741..198958) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(199120..200379) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(200516..201181) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(201371..201961) product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 202159..203184 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene hemE CDS 203187..204599 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene hemG CDS 204604..205320 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(205377..206219) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(206278..207375) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene zapE CDS 207439..208215 product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 208348..208815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 208925..210337 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene murC CDS 210364..210771 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene msrB CDS complement(210835..211791) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 211913..213019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 213016..213882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(213940..215733) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene treZ CDS complement(215762..216676) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 216901..217455 product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(217624..220110) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene treY CDS 220225..221463 product SAV2148 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 221526..222614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(222697..223332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 223375..224073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 224083..224679 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(224639..225892) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(225961..226362) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(226427..226894) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(226899..227381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 228005..228568 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene ssuE CDS 228648..229118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(229091..229840) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(229903..230802) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(230789..231592) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(231651..232763) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(232986..234314) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(234314..235225) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene cysD CDS complement(235222..235776) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene cysC CDS complement(235799..236521) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(236518..236703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(236734..238428) product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene sirA CDS complement(238794..239375) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(239405..241051) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 241070..242470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 242445..243344 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 243464..245860 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene lon CDS 245914..246384 product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 246479..247960 product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(247938..248315) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(248341..248823) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(248875..249879) product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(250035..250862) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 250998..251696 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(251761..252534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 252703..253800 product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(253831..255486) product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 255670..256551 product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 256542..257027 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 256943..259390 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 259396..260493 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(260531..261244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 261518..261877 product DUF5955 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 261918..262190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063646595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 262187..262561 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 262638..263540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 263548..264450 product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene pucL CDS 264465..265832 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 265877..267151 product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(267159..268109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(268385..269965) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene aceB CDS complement(270038..270634) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(270631..271254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(271463..272239) product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene allR CDS 272382..273776 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene allB CDS 273773..274831 product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene alc CDS 274934..275374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 275541..276770 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(276782..277366) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 277452..278039 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 278176..279225 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 279222..280292 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 280289..281089 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 281163..282260 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 282257..282805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 282910..283665 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 283653..284888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 284885..285472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(285504..286622) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 286791..288521 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(288571..289995) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(290066..290881) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 290989..292089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(292086..293309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(293391..295706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(295804..297600) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(297633..298655) product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(298656..300059) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene hydA CDS 300775..300912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 300999..302546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 302560..304398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(304443..305348) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 305538..306698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 note possible pseudo, frameshifted CDS complement(306777..307757) product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 308073..309083 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804930.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 309154..309957 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(310123..311082) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 311225..311836 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 311917..312795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 313041..313226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 313223..315478 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 315475..316002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(316072..316707) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(316793..317581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(317686..318453) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(318450..319439) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(319483..320544) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(320686..321153) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111481133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(321224..322111) product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(322111..322857) product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(322854..323912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(323988..325655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(325750..327549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 note possible pseudo, frameshifted CDS 328115..328963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(329013..330254) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene zigA CDS complement(330335..331066) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(331082..331873) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 332064..333290 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(333280..335268) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(335265..336407) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(336404..341872) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(341869..348525) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 348721..350361 product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 350443..350640 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 350706..352289 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031822.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 352286..353239 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 353236..354105 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 354098..355639 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(355710..357053) product salicylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 357433..357792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 358073..358468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975907.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(358542..359438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 359945..361093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(361164..362243) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(362332..363000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(363996..364571) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(364573..366567) product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(366564..366971) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(366979..367278) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(367311..369257) product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(369267..370037) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(370045..370479) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(370563..372179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(372192..372335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(372332..372811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(372811..373254) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(373279..374784) product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 375006..378317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 378370..379053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(379365..379745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(379776..381845) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(381842..382438) product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(382438..384477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(384683..385294) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 385572..386921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(386946..387764) product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(387911..388948) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(388959..390284) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(390281..391132) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 391383..392102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 392155..392928 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029353.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(393093..393587) product DUF6278 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(393627..394406) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(394429..395088) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(395227..396078) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene pssA CDS complement(396065..396697) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(397064..398044) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(398184..398978) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(399036..399542) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 399640..400278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(400245..401069) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 401186..401887 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(401892..402227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 402114..403067 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121436435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(403034..404038) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 404187..404636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(404608..405174) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(405171..405575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(405998..407059) product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 407168..407626 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(407720..407965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(408036..408824) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 409087..411519 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 411713..412537 product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 412530..413876 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(413937..414713) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 414806..415354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 415446..415820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 415986..417995 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 417992..418924 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(418985..419617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 419667..420206 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 420313..420735 product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene hrp1 CDS 420837..421082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 421181..423205 product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 423470..424231 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 424318..425682 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 425679..426617 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 426614..427525 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 427522..428511 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 428737..429345 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(429365..430237) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 430337..432259 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(432326..432973) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029778.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(433113..433925) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 434075..435112 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(435147..435845) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 435952..436260 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(436299..436931) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(436928..437716) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 437871..439973 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030989.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(440011..440217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(440294..440602) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(440750..441406) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031861.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 441615..442082 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 442215..442523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(442530..443204) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(443324..445084) product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 445152..446426 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 446423..448495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 448492..449784 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 449781..450590 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(450687..452048) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(452059..452802) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(452799..453377) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(453497..454330) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 454436..455539 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(455476..456348) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene fdhD CDS complement(456345..457289) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 457349..457951 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 458047..461061 product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(461076..461492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 461388..461816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 461826..462017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 462071..462262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 462287..462487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 462785..463867 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268532.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 464153..464998 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(464989..465189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 465219..465833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(465989..466837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 466945..467661 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031635.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(467690..468277) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031857.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 468402..468620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(468765..469151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 469335..471179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 471194..472651 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 472651..474354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 474351..476519 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 476516..476965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(477009..478466) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225386.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(478476..478976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(478973..479857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(480017..480280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 480803..481516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 481827..485279 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene dnaE CDS 485276..486280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 486347..486619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 note possible pseudo, frameshifted CDS 486757..486978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 note possible pseudo, frameshifted CDS complement(487263..489071) product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(489052..492153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(492234..493754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(493751..498436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(499563..500021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(500002..500772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(500769..501695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(501692..503632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157355235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(503629..504663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(504660..507287) product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(507614..508654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 note possible pseudo, internal stop codon, frameshifted CDS complement(508721..508918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(509201..509413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(509436..509795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(510551..510898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 510782..511108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(511130..511678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 511850..512767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 512764..513231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 513228..513749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 513746..514633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 514630..515553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 515895..517610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 517754..518812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(518713..519990) product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene aldO CDS 520143..521384 product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(521479..522198) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 522335..522934 product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(523012..524289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(524286..525353) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene rsgA CDS complement(525572..526669) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 526844..527785 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 527782..528705 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 528766..530133 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 530294..532324 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 532476..534461 product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031639.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(534533..535171) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(535254..535907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(536184..537572) product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(537697..537888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 537919..540360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(540426..540908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(540977..542467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(542464..543321) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(543318..544964) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(544961..546085) product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(546082..547221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 547666..559368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 559447..560700 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 560821..563010 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(562998..565592) product AfsR-like transcriptional regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030244.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene tcrA CDS complement(565652..566014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(566138..566974) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(567296..569620) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene metE CDS complement(570074..570235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(570232..570831) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031170.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 571015..572781 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(572835..573323) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(573346..574218) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132684406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 574452..575480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(575606..576856) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(576843..577604) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(577618..578703) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(578754..579395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 note possible pseudo, frameshifted CDS complement(579451..580491) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(580457..581971) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(581964..583460) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(583702..584493) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 584674..585996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(586106..586975) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(587341..587952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(588065..588433) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(588582..591308) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(591318..591683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 591579..592487 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 592511..593428 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 593773..594810 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 595513..596145 product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 note possible pseudo, internal stop codon CDS 596172..606428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 606451..614445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 614541..615416 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 615416..616222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(616294..617601) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 note possible pseudo, frameshifted tRNA 617877..617962 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(618064..619224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 619193..619573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 619581..620726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(620730..620957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 621353..621913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 621940..622239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 622236..622583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 622580..622966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(623121..623612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 623832..624554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 624584..624874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 624874..625287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 625301..629476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 629564..630469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 630594..631715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 631718..632794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 632803..633567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 633560..634390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 634390..634959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 635108..635545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 635542..636156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 636153..636395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 636446..637528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 637551..637793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(637837..638040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(638037..639035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(639220..640266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(640334..641452) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(641552..643135) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(643166..643765) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 643885..644625 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 644810..645607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 645930..647417 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189229593.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 647429..647755 product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 647752..649032 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 649029..650252 product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 650340..650609 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 650745..651530 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 651550..652485 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 652488..654467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 654476..655696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 655755..657047 product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 657076..658272 product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189188609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 658272..658853 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 658856..659989 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 660015..661082 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 661079..662062 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene rfbB CDS 662034..663113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 663110..664414 product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rfbH CDS 664487..665431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 665502..666902 product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 666899..667858 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 668039..669637 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 669757..670194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(670284..670994) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(671437..671694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 671693..671863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 672097..672387 product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 672410..672853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 672855..673622 product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 673624..673887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 673921..674445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 674445..675368 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 675365..675727 product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 675724..676590 product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 676580..676807 product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 676783..677085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 677343..678707 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(678738..679691) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(679721..680782) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 681000..681587 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893780.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(681651..683099) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(683325..684500) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(684536..685408) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 685537..686538 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 686593..688257 product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 688254..689288 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 689281..689910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 note possible pseudo, internal stop codon, frameshifted CDS 689907..691016 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 691013..691978 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 691978..693234 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 693354..693989 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 note possible pseudo, internal stop codon, frameshifted CDS 693986..695422 product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rfaE2 CDS 695419..696414 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(696468..697376) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(697360..698235) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 698234..698611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 note possible pseudo, frameshifted CDS complement(698640..699254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(699322..700470) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031648.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 700723..701046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 701043..704147 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 704308..706557 product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene catB CDS complement(706612..707025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 707297..708712 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 708805..710070 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 710146..711492 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 711479..711625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(711659..712630) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(712771..716034) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(716134..717099) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 717368..718198 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 718195..718992 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 718989..720020 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 720122..721210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 721214..722371 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(722451..723638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(723697..725043) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(725208..725453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 725341..726912 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 727155..728060 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene rbsK CDS complement(728076..729206) product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(729304..729897) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 730034..731062 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 731164..731385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 731442..732875 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 note possible pseudo, frameshifted CDS complement(732937..733734) product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 733992..734900 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(734974..735612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(735740..736489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 736757..737002 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 737111..738043 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 738134..738841 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(738937..739887) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(739915..740736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 740909..741826 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 742281..743393 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 743390..743791 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 743788..744165 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 744140..744730 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 744739..746115 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 746261..747526 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 747544..748326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(748331..748564) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 748764..750206 product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 750230..750916 product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(750921..752015) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107093947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 752391..754412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 754422..755066 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(755082..755492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(755782..756636) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 756736..757119 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(757121..757753) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 757868..758494 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 758623..760899 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 761003..763447 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 763637..764608 product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(764721..766487) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 766863..767243 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(767253..767897) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene idi CDS complement(767888..768829) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(768975..769946) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene galE CDS 770198..771997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 771994..772746 product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 772734..773795 product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 773809..774558 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 774606..775451 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 775536..776450 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 776437..777237 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 777307..778218 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene hpnC CDS 778260..779168 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene hpnD CDS 779165..780514 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene hpnE CDS 780723..781766 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 781763..782416 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 782729..784291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 note possible pseudo, internal stop codon, frameshifted CDS 784315..784734 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 784739..785113 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 785091..785717 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(785776..787506) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene metG CDS 787624..788832 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(788868..791027) product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene rmdA CDS complement(791024..791836) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(792023..793231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 793446..794639 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(794679..795566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 795843..797045 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 797154..798158 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 798269..800002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 800070..800588 product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(800646..801416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 801557..802792 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 802983..803756 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 803753..804772 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 804769..805620 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(805725..806027) product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(806114..806803) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(806902..809214) product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene yicI CDS complement(809303..810703) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(810765..811517) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 811399..811650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(811638..812609) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270459.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(812617..813849) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(813917..814954) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(815151..815846) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene bioD CDS complement(815899..817209) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(817202..818305) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene bioB CDS 818457..819674 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(819692..820843) product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene ligD CDS 820935..821993 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(821971..822396) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406366.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 822453..823523 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 823650..824804 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 824955..826175 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 826313..826879 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(826958..828079) product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(828160..829365) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(829605..830834) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225591.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 831093..832751 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043792085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 832783..833772 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 833789..835627 product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 835624..836499 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 836630..839137 product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 839138..839986 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(840002..840568) product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(840685..841686) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(841855..843288) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 843446..844213 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 844661..845212 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene ssuE CDS complement(845268..846425) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(846864..847100) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115899.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene tatA CDS 847285..847698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(847910..849007) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 849147..850451 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 850484..851410 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 851407..852267 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 852264..854291 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 854415..855185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 855316..857220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(857282..859396) product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 859564..860565 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 860633..861880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 861880..862929 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 862926..863879 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(863869..864831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 864908..865183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(865253..866689) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene gndA CDS 866820..868064 product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971841.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(868132..872088) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(872571..872852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 873401..874288 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(874323..875750) product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 876074..877372 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene aceA CDS complement(877431..879686) product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(879822..880646) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(880643..881734) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene fepG CDS complement(881731..882771) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(882792..883847) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 884158..885246 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene hppD CDS 885243..886511 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 886471..887445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 note possible pseudo, frameshifted CDS 887442..888488 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene idsA1 CDS 888506..890194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 890191..891444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(891635..892474) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(892492..893301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 893729..894502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(894605..895546) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(895747..895896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(895928..896674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(896640..897209) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(897230..897775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 898028..898468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 898533..899045 product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(899555..899971) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(900184..900711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 901228..902781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 902781..903377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 903570..904421 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 904414..904977 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(905166..906638) product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 906703..907329 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 907446..908117 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 908121..909125 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(909172..909621) product SUKH-4 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223346.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 909963..911186 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(911087..911362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(911479..911958) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 912129..912362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 912359..912640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(912688..913212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 913174..913779 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 913946..914491 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 914520..916679 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019547503.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(916785..917117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 917296..919779 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 919776..920267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 920327..921430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 921464..921988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 922181..924541 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(924596..925051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(925048..925305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(925305..925664) product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(925790..926563) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene fabG CDS complement(926794..928059) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(928126..928833) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(928995..929303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(929563..930012) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 930147..931454 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene eno CDS 931511..931699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(931735..932964) product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(933054..933875) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 933974..934426 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972358.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 934506..934955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 935157..935498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(935597..935791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(935776..936372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 936434..937339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(937466..938032) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 938110..939165 product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 939298..939552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(939921..940268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 note possible pseudo, frameshifted CDS 940809..941006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 sequence08 source 1..732097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(222..1862) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1930..3297) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 3521..4270 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 4400..6400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(6369..9749) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(9835..11838) product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 12353..13762 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 13889..14632 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene trmB CDS 14784..15827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 15887..16975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(17099..17548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(17619..18548) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(18621..19622) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(20001..21266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(21321..21443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(21756..22874) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 tRNA complement(22933..23008) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(23173..25008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 note possible pseudo, frameshifted tRNA 25394..25468 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 25820..26170 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 tRNA 26256..26331 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 26401..26874 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene aroQ tRNA 26919..26994 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 26998..27073 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 27215..27535 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 27532..28491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 28508..29350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(29347..30366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 30542..30721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(30760..31740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977778.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 31818..35774 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene hrpA tRNA 35869..35944 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(36445..36651) product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene bldC CDS complement(37104..38057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 38156..39298 product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 39594..39899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(40003..41079) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene purM CDS complement(41173..42771) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene purF CDS complement(42817..43602) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 43751..44236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(44266..45039) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(45029..45742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 45922..46866 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 46863..47582 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 47594..48121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(48158..48625) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(48684..49097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 49132..49887 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 49945..50640 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 50686..51051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 51238..51432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(51427..52116) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 52181..52954 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(53031..55286) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene purL CDS complement(55283..55963) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene purQ CDS complement(55960..56226) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene purS CDS 56603..56920 product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 tRNA 57138..57210 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 57298..57371 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 57520..58440 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 58437..59312 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 59363..60661 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 60768..61373 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 61508..61627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(61649..62128) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 62324..63895 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(64051..64842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(64966..65871) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(65970..67478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(67615..68397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(68684..70276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(70671..71939) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene purD CDS 72131..72862 product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(72865..73512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975315.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(73568..74242) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 74320..74946 product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 74943..75512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 76044..77879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 note possible pseudo, frameshifted CDS 77962..79956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 80140..82446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(82518..83801) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 83909..84658 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(84730..86241) product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 86331..86972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(87016..87501) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 87589..88536 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 88533..90200 product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 90424..91023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 91035..91862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 91894..92730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 92732..93100 product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975421.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 93110..93712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 93844..94101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 94098..94487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164272942.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 94568..95299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(95286..97262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(97255..98076) product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(98219..98632) product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(98674..99696) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene fbaA CDS complement(99856..100392) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene pyrE CDS complement(100404..101258) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(101281..102342) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(102445..103167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(103263..103820) product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 104265..106022 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 106213..107724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 107736..108761 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 108761..109903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 note possible pseudo, frameshifted CDS 109903..110940 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(111010..111306) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(111303..111938) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(112032..114617) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene clpB CDS 114678..114926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 114983..115795 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112421.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(115792..116625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 116929..117561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(117667..119214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(119201..119884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(119881..120654) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(120762..121247) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(121252..122454) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene dnaJ CDS complement(122509..123267) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene grpE CDS complement(123264..125138) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene dnaK CDS complement(125250..126131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(126139..126783) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 127083..129239 product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 129287..129991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 130009..130584 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene dcd tRNA 130834..130907 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(131048..132514) product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 133541..135064 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 135165..136487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 136652..136888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(136863..137282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(137292..137711) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(137704..138762) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene arsB CDS complement(138759..139133) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 139207..139632 product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 139845..140423 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 140690..141856 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775807.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 141891..142967 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 142974..144065 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 144062..144835 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 144832..146889 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(146792..147214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 147271..148086 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(148208..148993) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 149248..150138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 150507..151592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(151612..153039) product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 153105..154085 product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(154110..154577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(154651..157926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(158033..159010) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 159197..159418 product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(159393..160589) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 160688..161773 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143051171.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 note possible pseudo, frameshifted CDS 161770..162456 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(162488..163312) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 163385..163972 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059191192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(164041..165720) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 165763..168825 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(168810..169673) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(169670..170626) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(170659..170898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(171115..171444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(171452..172327) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(172571..173650) product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene paaK CDS complement(173652..174188) product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene paaJ CDS complement(174185..174877) product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene paaC CDS complement(174874..175167) product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene paaB CDS complement(175164..176147) product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223463.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene paaA CDS 176290..177012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 177009..178271 product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 178268..179011 product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(179138..179410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(179410..179547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(179641..180855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 181003..181215 product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 181306..181761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(181762..183228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(183295..184530) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978379.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 184454..184651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 184676..185191 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(185334..186311) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(186320..188017) product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene paaN CDS 188073..188699 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 188832..190031 product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(190068..190700) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(190792..191310) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 191460..192602 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene pdhA CDS 192599..193597 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 193603..194862 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(194936..197035) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(197032..198036) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(198033..198620) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(198908..199210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 199411..200241 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 200238..201530 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 201527..202678 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 202732..203700 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 203787..204053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 204114..204797 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 204794..205543 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 205540..208380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 208402..208971 product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(209043..210470) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(210495..211490) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(211492..212817) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene pdhA CDS 213238..213870 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 213923..214312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 214386..215147 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 215144..216346 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 216343..217254 product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(217341..218396) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(218430..220133) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 220326..221951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(221980..222804) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(223046..224287) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(224426..225889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(225912..229952) product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(229949..231079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(231101..232411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(232405..232620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 232763..233101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 233113..233421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 233447..233842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 233845..235995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 235992..236357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(236789..238618) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908958.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 238726..239223 product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 239306..240280 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 240382..242154 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene aspS CDS complement(242231..242788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(242900..243355) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 243454..245022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(244982..245326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(245519..245656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 245612..245863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(246008..248332) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 248499..248897 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene trxA CDS 248908..250104 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(250061..250573) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229200.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 250835..251845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(251919..252257) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(252274..253140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(253168..253545) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 253673..254314 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(254396..255880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(255865..257160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 257271..258314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(258311..258925) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 259053..260057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037665946.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(260085..261251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(264860..265948) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(265945..266805) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(266802..268433) product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866257.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(268430..269857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(269860..271044) product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028528.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 270979..271161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(271436..272725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(272774..274939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(274951..276045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(276173..277351) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 tRNA complement(277490..277576) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 277922..278734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 278745..279257 product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene fhaB CDS 279337..280830 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 280904..282298 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 282307..283758 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(283786..283995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 283994..285988 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene pknB CDS complement(286069..286644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 286816..287337 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 287428..288312 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(288496..288756) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene crgA CDS 288866..289603 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 289695..289877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174256084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 289877..290530 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 290527..291705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 note possible pseudo, internal stop codon, frameshifted CDS 291689..292465 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 292570..293850 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 tRNA complement(293857..293930) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 294073..294633 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(294789..294932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 tRNA complement(295095..295170) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(295240..295785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(295899..298511) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene gyrA CDS complement(298562..300619) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene gyrB CDS complement(300900..301472) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(301465..302595) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene recF CDS complement(302623..303498) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene gnd CDS complement(303705..304835) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene dnaN CDS 305314..305634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(305644..307431) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene dnaA CDS 307843..307980 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene rpmH CDS 308009..308377 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rnpA CDS 308374..308688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 308692..309771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 309918..310295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 310292..311071 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene rsmG CDS 311397..312392 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 312389..313492 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(313594..313941) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene trxA CDS complement(313979..314941) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene trxB CDS complement(315053..315886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(315883..316605) product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene sigM CDS complement(316673..318382) product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(318483..320570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(320607..322889) product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 323035..324534 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(324506..325843) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(325856..327292) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(327354..330035) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 330447..331055 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 331127..332209 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(332313..333344) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(333399..334517) product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene femX CDS complement(334659..334961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 335167..335457 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene rpsF CDS 335560..336123 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029303.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 336196..336432 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene rpsR CDS 336451..336903 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene rplI CDS complement(337026..338360) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 338761..340215 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene dnaB CDS complement(340179..340568) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(340574..340972) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 341054..342109 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037683496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 342099..342527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(342520..343269) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 343268..344029 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(344022..344414) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 344562..345866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(346104..346598) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 346716..348023 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(347983..348849) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 348933..350306 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(350347..350799) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 351039..352238 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 352272..353303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(353310..353819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(353867..355012) product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(355009..355542) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(355553..355924) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 355976..356293 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 356443..356655 product DUF5326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(356621..357877) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 358058..359644 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene thiC CDS complement(359664..360647) product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 360880..361539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 361671..362471 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(362487..363254) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(363272..364939) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(364954..368559) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene cydD CDS complement(368593..369597) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene cydB CDS complement(369621..371183) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(371325..372656) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene hisC CDS 372798..373964 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 374164..375144 product Ser/Thr/Tyr protein phosphatase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029328.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene sppA CDS 375396..376517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(376545..377438) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 377537..378466 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 378544..379521 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 379518..380444 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 380441..381358 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 381372..382094 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(382223..382903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(383111..383950) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(383947..385188) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene serS CDS complement(385684..386616) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene pheA CDS complement(386651..387910) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene efeB CDS complement(387922..389748) product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(389757..390191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(390188..390850) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(390915..391676) product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(391770..392522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 392745..393185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 393367..394575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 394707..395216 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 395236..396516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029991.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 396579..397292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(397511..398533) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(398530..399909) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(400187..401659) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(401795..403252) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 403692..404414 product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974971.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(404629..405606) product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(405682..406110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(406253..407041) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 407152..408588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 tRNA 408648..408737 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 408998..409570 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 409575..410270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 410430..410750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 411031..411585 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 411696..413354 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(413348..416497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 note possible pseudo, internal stop codon, frameshifted CDS complement(416591..416980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 tRNA 417124..417216 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 417344..417417 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 417478..417717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 417755..418342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 note possible pseudo, frameshifted CDS complement(418725..419597) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(419617..420030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(420056..421363) product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 421493..421696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007451180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(421744..422598) product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(422800..423582) product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 tRNA complement(423803..423890) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(423901..424389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(424399..424947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 425096..425731 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene upp CDS complement(425841..426524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(426615..426911) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(426969..428381) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 428493..429416 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 429474..430397 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(430360..430665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(430767..431639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(431651..434326) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(434332..444258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 444583..445512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 445548..445853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 445896..446228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(446325..450980) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(451016..452212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(452209..452766) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(452859..453062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(453059..454069) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417957.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene idsA1 CDS complement(454066..455109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(455226..457727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(458010..458558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(458555..459679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(459723..460454) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 460639..462888 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(463011..463958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(464059..465015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 465217..466161 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(466229..466387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(466492..469794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(469854..470318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(470327..470839) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 471026..471469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(471518..472876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 473390..473593 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(473729..474946) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 475020..476660 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 476657..477697 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(477694..477894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 477788..478816 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 478832..480040 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 480124..481110 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 481251..483395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 483533..484753 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 484750..485700 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 485697..486542 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 486539..487045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 487045..487920 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 487917..489074 product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene eboE CDS 489071..490462 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(490443..491585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(491680..492909) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 492921..493847 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 493947..495050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(495080..496774) product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 497089..497817 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(497946..498116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(498242..499069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 499487..500278 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 500275..501714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(501729..502295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(502414..504288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(504272..504547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 504476..504709 product type II toxin-antitoxin system antitoxin RelJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene relJ CDS 505193..506863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 506863..507852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 tRNA complement(507901..507975) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(508485..508574) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 508756..510924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 511033..511365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 511472..512071 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene recR CDS 512102..512845 product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 512845..513600 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226990.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(513667..514089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 514257..514877 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 515031..515501 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247583.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 515514..515813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 515881..516909 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026882.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(516878..517174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(517224..517454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(517468..517935) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 518011..518598 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(518537..519001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 519183..519998 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 519995..520231 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(520241..520675) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(520728..521180) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 521313..522188 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 522491..523633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 523623..523922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 note possible pseudo, internal stop codon, frameshifted CDS 524042..525112 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 525404..526699 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 527043..527786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 527783..529165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029120.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 529196..530092 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(530043..531878) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(531871..532359) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(532356..532535) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(532689..533015) product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene wblA CDS 533374..535647 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(535710..536174) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 536216..537145 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 tRNA 537203..537277 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(537498..537761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 537914..538270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(538309..539610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(539607..540374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 540763..540921 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene rpmF CDS complement(541004..541969) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 542272..542451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 542441..543913 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 543910..544833 product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(544857..545288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(545338..545505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 545575..546408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 546405..547256 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(547338..548051) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 548385..549134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 549373..550071 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 550100..551299 product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(551338..551697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(551627..552115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(552167..552370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 552548..553795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 553915..554475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(554631..554834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(554923..555861) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(555858..556298) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(556548..558521) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene acs CDS complement(558760..561099) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 561370..562668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(562653..563648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 563701..564549 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(564892..565734) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 566150..567220 product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 567295..568386 product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 568442..569320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 569317..570009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 570011..570193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 570180..570551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 570577..571014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(570968..573256) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 573222..573404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 573448..573813 product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene bldG CDS 573932..574351 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 574625..576985 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(577156..577641) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030689.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 577955..578575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 578614..579279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 579300..580814 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(580911..581168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(581296..581664) product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(581743..582213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 582488..585403 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene topA CDS 585542..588472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 note possible pseudo, internal stop codon, frameshifted CDS complement(588570..589601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 589742..590953 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 591006..592625 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 tRNA 592857..592931 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(592947..593204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(593236..594084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(594081..596027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(596024..596875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225294.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(597029..597658) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(597805..598848) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(598866..599636) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 599779..600531 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 600640..601047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(601053..603494) product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467386.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 603563..604876 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(604945..605496) product type VII secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230749.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(605489..605674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(605836..606852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(606849..609260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(609402..610097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 610366..610755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 610739..614803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837825.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 614875..616986 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(616958..617584) product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene aztA CDS 617636..618478 product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene aztB CDS 618468..619529 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 619526..620443 product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731003.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene aztC CDS 620473..621660 product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027144.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene aztD CDS 621770..622816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 622813..624885 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 624969..625664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 625691..626092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(626107..626691) product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 626779..627270 product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(627260..628495) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(628521..629363) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(629463..630029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(630129..631523) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(631520..632059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 632186..633043 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 633110..633970 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 634080..634277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(634338..635129) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(635126..636118) product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 636265..636888 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(636893..637780) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 638054..638500 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 638514..638813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 638886..639425 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 639477..640676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 640673..641830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(641873..642109) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(642262..642507) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028969.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene rpsR CDS complement(642504..643688) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(643685..643933) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(643953..644117) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene rpmG CDS 644167..644403 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene rpmB CDS 644403..644708 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene rpsN CDS 644875..645441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 645432..646343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(646417..647187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(647218..648726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(648730..649041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 649185..650135 product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 650284..651306 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 651351..651779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 651776..652108 product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 652105..652476 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene crcB CDS complement(652503..653591) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029334.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 653745..654293 product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene aac(2')-Ic CDS 654357..655778 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene lpdA CDS 655979..656242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(656191..656676) product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(656967..657185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(657338..658195) product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 658459..658872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 658951..660144 product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(660141..660821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 661090..661761 product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(661832..662830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 662867..663739 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 663818..664258 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(664343..665302) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 665493..667250 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(667279..667773) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 667883..669313 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene dacB CDS 669450..670577 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 670766..671839 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene tilS CDS 671858..672421 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene hpt CDS 672664..674652 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene ftsH CDS 674768..675370 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene folE CDS complement(675395..675793) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028904.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(675858..676679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(676774..677760) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(677793..678560) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(678557..679213) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 679269..680438 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(680457..680960) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(681006..681617) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene folK CDS complement(681614..681973) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene folB CDS 682240..683121 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene folP CDS 683118..683612 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(683689..685071) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(685089..685568) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 685630..686778 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(686698..687786) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 687906..689120 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 689134..689844 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 689923..690831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 690828..691829 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene panC CDS 691826..693619 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 693616..694659 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene nadC CDS 694662..695459 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 695562..695807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 695892..696080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 696178..696561 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 696571..697125 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 697285..697626 product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 698351..700816 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(700893..704054) product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 704139..704372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 704419..705000 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(705029..705238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(705365..706783) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 706904..707467 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(707472..708356) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 708535..709020 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(708984..709367) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222780.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 709476..710150 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(710126..711037) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 711253..712029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(712061..713227) product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene disA CDS complement(713268..714713) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene radA CDS 714798..716525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172595308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 note possible pseudo, internal stop codon, frameshifted CDS complement(716561..717253) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(717240..718064) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 718131..718970 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028919.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 718967..719704 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(719701..720696) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 720833..721642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 721684..723528 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene ilvD CDS complement(723855..725987) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 726059..726562 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 726579..726725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 726756..727562 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene proC CDS complement(727630..728706) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(728712..729524) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(729517..730326) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(730391..730594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 730694..731803 product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 731862..732077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 sequence09 source 1..51517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..873) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(870..1568) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977599.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene ureG CDS complement(1581..2258) product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2258..3982) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(3975..4286) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(4311..4613) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 4834..5865 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(5950..7152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(7280..8353) product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(8773..9690) product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(9835..10059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 10058..10498 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977077.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(10550..11737) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(11779..13383) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 13722..14708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(14671..14898) product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 15340..16152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977068.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 16231..16614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(16665..18134) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene der CDS complement(18240..18899) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(18896..19597) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene cmk CDS complement(19744..20829) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(20859..21842) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(21842..22465) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene scpB CDS complement(22458..23681) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(23916..24431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495132.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(24416..25423) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(25826..26950) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene ald CDS complement(27057..29093) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868162.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(29415..30047) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(30055..31710) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 31930..33735 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(33813..34985) product glycoside hydrolase family 64 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 35188..36231 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(36243..36521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 36748..37551 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(37568..38674) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(38784..40547) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene recN CDS complement(40613..41536) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(41533..42357) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(42365..42817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 note possible pseudo, internal stop codon, frameshifted CDS 42914..43822 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(43893..44357) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028935.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(44354..45445) product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 45525..46847 product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 46896..47480 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 47496..49370 product desferrioxamine E synthetase DesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene desD CDS complement(49457..50098) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(50098..51075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 rRNA complement(51205..51315) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence10 source 1..670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence11 source 1..1448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..1426 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 sequence12 source 1..706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..649 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 sequence13 source 1..168703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(303..1988) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2185..3084) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene dapA CDS complement(3276..3998) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene thyX CDS 4158..4313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 4373..4921 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(4987..5430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(5433..6188) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene dapB CDS complement(6225..7625) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(7622..9844) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(10165..10455) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rpsO CDS complement(10773..12236) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene eccD CDS 12368..16291 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(16296..16886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(16924..19203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(19215..19652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(19736..20035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(20082..20438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(20486..20911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 21160..21384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 21456..21719 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030415.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(21736..23154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(23174..24385) product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene mycP CDS complement(24418..25926) product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene eccB CDS 26049..27431 product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487445.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene eccE CDS 27431..28114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030411.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 28143..29090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 29344..32088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 note possible pseudo, internal stop codon, frameshifted CDS complement(32185..33132) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(33225..34157) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene truB CDS complement(34154..34675) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene rbfA CDS complement(34714..35010) product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(35089..38127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(38281..38577) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(38682..39728) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene nusA CDS complement(39731..40276) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene rimP CDS 40520..41029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 41026..41505 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 note possible pseudo, frameshifted CDS 41502..42401 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(43315..44994) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(45113..45682) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973328.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(45707..46558) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(46896..48053) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene ispG CDS complement(48139..49443) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(49440..50717) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene dxr CDS 50888..51331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 51419..53575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 53572..54153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(54230..56170) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 56415..57512 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(57609..58325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(58339..60342) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(60399..61337) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(61334..62407) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(62563..64149) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 64549..67473 product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030390.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 67500..68555 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(68589..70043) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 70261..71637 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(71765..73348) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030383.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 tRNA complement(71937..72016) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(74170..76521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 76811..78169 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene gabT CDS 78418..79608 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 79605..81260 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(81543..82007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(82175..83170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 83278..84336 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 84351..85025 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 85086..86486 product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 86510..89242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(89310..90743) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 91132..91839 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973371.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 91821..93059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(93330..94904) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349984.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(94980..96053) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(96068..97828) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(97804..98892) product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(99184..100290) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene rlmN CDS complement(100326..101351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(101439..101960) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene frr CDS complement(102042..102812) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene pyrH CDS complement(103005..103850) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene tsf CDS complement(103900..104775) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene rpsB CDS 105154..105561 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 105561..107174 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223857.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 107171..108337 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene dprA CDS 108492..109334 product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene whiG CDS 109390..110037 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 110104..110547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(110624..110959) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(110988..111728) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene lepB CDS complement(111786..112691) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene lepB CDS complement(112600..113718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 note possible pseudo, internal stop codon, frameshifted CDS complement(113792..114493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 note possible pseudo, internal stop codon, frameshifted CDS complement(114527..114877) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene rplS CDS complement(115016..115825) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene trmD CDS complement(115822..116385) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene rimM CDS complement(116489..116728) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(116730..117179) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111678.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene rpsP CDS complement(117418..118053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(118146..119561) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene proS CDS complement(119626..121179) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene ffh CDS complement(121258..123840) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(123923..124261) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(124258..125547) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(125871..127409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 127745..128434 product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030317.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(128591..129829) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene ftsY CDS complement(129875..131299) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(131423..135976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(136195..136401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(136739..137050) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 137185..138120 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(138149..139009) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene mutM CDS complement(139002..139733) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene rnc CDS complement(139795..139968) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene rpmF CDS complement(139971..140573) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(140742..141803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(141841..142314) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene coaD CDS complement(142350..142964) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rsmD CDS complement(143097..143522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(143632..144678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(144793..145320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(145440..147716) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene recG CDS complement(148208..149848) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 150071..150256 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene rpmB CDS complement(150406..151233) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene thiD CDS complement(151248..152216) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 152349..152582 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 152602..153159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(153226..154368) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(154404..155405) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(155402..156202) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 156317..157051 product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene cofC CDS complement(157023..157331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(157328..157900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(158026..158280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(158444..159037) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene leuD CDS complement(159041..160465) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene leuC CDS 160618..161352 product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene ndgR CDS complement(161357..161839) product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 note possible pseudo, internal stop codon CDS 161984..162619 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 tRNA complement(162672..162745) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(162769..162842) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(162864..162936) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(163006..164148) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978029.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(164163..165068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978028.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(165065..165805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027379.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(165843..166028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(166199..167683) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene gltX CDS complement(167680..168477) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 sequence14 source 1..73134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(633..1112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(1112..1441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 1491..1688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 1888..2682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(3219..3722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(4053..4418) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(4625..6115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(6508..6768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(6796..7140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(7230..7469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(7466..7753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 8258..8476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(8527..9369) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029383086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(9436..9855) product RacP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069931728.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(9858..10865) product DUF6192 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039380.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(11021..11332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(11382..12461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(12638..14035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 14247..14423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 14441..15634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 15631..16524 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902155.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 16544..17329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 17881..18408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 18408..19067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(19255..19977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 20331..21674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 21667..21960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 21961..22212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 23081..23791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 23788..24261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(24630..25619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(25616..26206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(26458..26706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(26792..28183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(28400..28645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(28642..28914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 29096..29539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 29557..29763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(30133..30279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(30323..30670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 30964..31710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(31761..31967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 32218..32694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 33008..33337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 33337..33807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(33898..35235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(35294..37990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(38948..40180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(40367..41104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 41504..42121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 42168..42350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 42356..42613 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 42768..43007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 43515..43889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107083113.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 44021..46840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 note possible pseudo, frameshifted CDS 47085..47315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 47438..47932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 47929..48234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 48375..50861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 50892..51281 product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 51372..53489 product chromosome segregation protein ParM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749524.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(53482..53649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 53588..54130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 54246..54422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 54520..54954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 54998..55408 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477102.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 55455..55937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 tRNA complement(56642..56722) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 57033..57560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 57547..57909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 57980..59116 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene dnaN CDS 59150..60523 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222300.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 60591..61319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 61336..61785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749536.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 61840..62325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 62420..62785 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 62911..63189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 63186..63431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 63650..64147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(64576..65559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(65556..66794) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064732171.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 67404..67601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 67598..68164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 68179..68949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(69066..69809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(70185..70406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 70585..70866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 70863..71387 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 71384..72007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 sequence15 source 1..488341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..560) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(645..1436) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 1611..2261 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 2369..2716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 2730..3890 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730916.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(3887..4720) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(4717..5316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(5316..8063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(8150..9163) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene gmd CDS 9211..10188 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(10221..11660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 11720..11869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(11982..12836) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(12833..13981) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(13978..15006) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 15111..16595 product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028240.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS 16592..18184 product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028239.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(18275..19282) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(19342..20934) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(20945..21604) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(21734..22600) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene map CDS 22658..22891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 23024..23206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 23196..23399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 23471..24181 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene npdG CDS 24196..24417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(24458..25294) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976554.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(25291..26292) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(26377..27240) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene panB CDS 27474..28478 product teicoplanin resistance protein VanJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029107.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene vanJ CDS 28640..29539 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene htpX CDS 29595..30179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 30397..31452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(31406..32971) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027891.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(32968..33597) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(33578..33976) product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977198.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(33973..34383) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(34408..35865) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 36147..36425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 36453..37814 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene glnA CDS 37811..40849 product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(40834..41652) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(41783..42817) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 43149..44420 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 44479..45441 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 45444..46406 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 46458..48122 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 48115..49128 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 49295..50695 product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(50763..52754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(52988..53635) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(53694..54776) product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230297.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(54868..55614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 note possible pseudo, frameshifted CDS complement(55503..56150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 note possible pseudo, frameshifted CDS complement(56383..57402) product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 57587..58498 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027311.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 58589..59434 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(59474..59905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(59925..60305) product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(60652..61035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 61262..61765 product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971883.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(61882..63297) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene glnA CDS 63532..64020 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(64287..64997) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(65067..66011) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene lipA CDS complement(66074..66847) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene lipB CDS 67050..68630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 repeat_region 68856..69123 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcgatcctcgaccgccccggagggcggtcgccac CDS complement(69420..70745) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(70944..71891) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(71902..72423) product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 72550..73530 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973098.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(73547..74230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 74385..76022 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS 76095..76775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 76772..77611 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929266.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(77668..78435) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene map CDS complement(78518..78991) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 79082..79582 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(79598..80248) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(80239..81441) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 81553..82998 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 83278..83751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(83782..84735) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(84814..87492) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene aceE CDS complement(87648..88322) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(88424..90178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 note possible pseudo, internal stop codon, frameshifted CDS complement(90245..91633) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene lpdA CDS complement(91861..93381) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(93444..94235) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 94281..95048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028179.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(95110..96240) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene cobT CDS complement(96723..97199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(97460..98656) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 98808..99023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 99213..100040 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(100198..101250) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(101343..101891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 102168..102950 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 103006..103284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 103358..104680 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 104693..105367 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(105424..106620) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene nadA CDS 106858..107211 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(107311..108954) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028170.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 109080..110054 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(110064..111431) product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 111721..112698 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene coxB CDS 112695..114437 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene ctaD CDS 114434..114832 product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(114981..115121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 115072..116268 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(116356..116757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(116854..117120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 117038..117544 product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 117620..118429 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 118426..119502 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS 119499..121154 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 121275..122339 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene trpD CDS complement(122400..122681) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 122939..124288 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 124590..125642 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 125825..126901 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 126954..128093 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 128174..128629 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 128641..129717 product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 129761..130228 product carbon catabolit repression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028152.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 130282..131223 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(131253..131396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(131377..131754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(131783..134293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 note possible pseudo, frameshifted CDS 134713..136098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 136144..136956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 136953..137942 product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 137939..138712 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(138730..139314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(139301..140083) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 140194..140946 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 140963..142246 product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 142243..142926 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(142893..144833) product phenazine-specific anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 145081..146430 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 146561..146812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(146842..147324) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene bfr CDS 147497..148141 product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(148108..149094) product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 149180..150457 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(150432..151319) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(151369..152214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(152540..154522) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene pknB CDS complement(154610..155932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(156044..156904) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(156910..157128) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene thiS CDS complement(157125..158315) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene thiO CDS 158489..159709 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 159788..160153 product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 160261..160896 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene thiE CDS 161021..161935 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene metF CDS 161957..162883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(163083..164480) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028141.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(164762..165379) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 165550..166017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 166094..166885 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 167125..167520 product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(167644..170073) product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(170077..171405) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(171405..172418) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(172532..173047) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 173320..174297 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene rsmH CDS 174294..174983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 174980..176890 product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene ftsI CDS 176911..178626 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 178623..180062 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 180059..181123 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene mraY CDS 181105..182523 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene murD CDS 182759..184189 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene ftsW CDS 184196..185287 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene murG CDS 185315..186115 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene ftsQ CDS 186377..187615 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene ftsZ CDS 187628..188365 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene pgeF CDS 188358..189080 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 189205..189828 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene sepF CDS 189900..190184 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 190234..191520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(191668..194805) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene ileS CDS complement(194922..195512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 195514..195957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 195996..196643 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene lspA CDS 196668..197609 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 197706..199295 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(199467..200528) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976745.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 200653..201228 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(201266..202138) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(202182..202874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(202924..206475) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486830.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene dnaE CDS complement(206532..207116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 207104..207949 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 207979..208191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 note possible pseudo, internal stop codon CDS 208188..208394 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031056.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 208396..210006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 210003..211217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 211344..212012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 211999..214068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 214072..214602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 214827..215072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(215143..215301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 215500..216672 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 216809..217771 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 217768..218550 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031846.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 218631..219275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(219300..219803) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene ybaK CDS complement(219819..220568) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 220723..222045 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene hisD CDS 222042..223199 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 223196..223786 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene hisB CDS 223783..223947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 223944..224582 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976765.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene hisH CDS 224582..225307 product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene priA CDS 225304..225699 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 225696..226466 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene hisF CDS complement(226451..227185) product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(227210..227854) product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039544.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 228055..229005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 228990..229139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 229354..230424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(230345..231916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(231910..232590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(232614..234173) product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(234170..235156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(235153..235764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(235751..236899) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730569.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(236892..238070) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089023.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(238067..238327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(238329..239450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(239447..240814) product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(240811..241095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(241207..242535) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(242529..243278) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene fabG CDS complement(243275..244081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(244078..247233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 note possible pseudo, internal stop codon, frameshifted CDS complement(247230..247490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 247770..250274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 250347..251678 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 251735..253135 product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 253132..254415 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(254478..255227) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(255224..257194) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(257196..257897) product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 257994..258884 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(258911..259546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(259553..260494) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977289.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(260491..261453) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871104.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(261503..262807) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852588.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(263095..265074) product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene rhgX CDS complement(265183..266748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(266968..267462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(267502..268140) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 268210..268575 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene hisI CDS 268587..270113 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 270110..270736 product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 270865..271149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 271302..271733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 271806..272612 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene trpC CDS 272619..272816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 273062..274306 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene trpB CDS 274303..275121 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene trpA CDS 275187..276389 product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 276521..277270 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 277506..278072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 278207..279265 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene lgt CDS 279262..279966 product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 280304..284839 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene gltB CDS 284832..286295 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(286453..287031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 287204..288505 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776530.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 288495..289523 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 289520..290335 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776528.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(290360..291256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(291253..293355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(293407..293820) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 293819..294145 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 294096..294452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 294505..297027 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene pepN repeat_region 297182..297449 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acccccgcgcctgcggggaggac CDS 298963..300450 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 300447..301865 product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 302214..303566 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene pyk CDS 303703..304854 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 304851..305789 product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 305806..306555 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(306568..307335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 tRNA complement(307453..307526) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 307627..308286 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 308503..309744 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877617.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 309848..310771 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 310768..312099 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 312099..312992 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 312989..313753 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(313788..314321) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(314383..316674) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 316878..319586 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene polA CDS 319789..321318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 321715..323223 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene rpsA CDS 323437..324396 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976821.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 324423..325028 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene coaE CDS 325128..327158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(327140..328684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(328885..330096) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 330219..331358 product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974908.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 331530..332408 product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(332401..333384) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 333512..334789 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 334789..335607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 335760..338468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 338515..338883 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533306.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene queD CDS 338950..339957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 340298..341065 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(341217..341636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(341782..343218) product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 343311..343754 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027436.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 343880..344644 product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028070.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 345014..345655 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(345782..346687) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 346859..348979 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene uvrB CDS 349035..349616 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976854.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(349668..353192) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(353227..356160) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene uvrA CDS 356360..357052 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 357066..357722 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 357794..359839 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene uvrC CDS 359923..360864 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene rapZ note possible pseudo, frameshifted CDS 360866..361942 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene yvcK CDS 361933..362910 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene whiA CDS 363067..364071 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene gap CDS 364257..365459 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 365463..366236 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene tpiA CDS 366363..366593 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene secG CDS 366722..367057 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 367124..368800 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene pgi CDS complement(368825..369610) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene pgl CDS complement(369607..370536) product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene opcA CDS complement(370533..372101) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976881.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene zwf CDS complement(372108..373226) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene tal CDS complement(373262..375340) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 gene tkt CDS 375729..376670 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 376729..377058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534985.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 377085..378143 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(378131..379120) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(379175..380020) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(380017..380958) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 381194..382552 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 382549..383004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 383017..384009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 384058..386319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 386370..387701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 387782..388624 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene hisN CDS 388621..389229 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 389264..390316 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 390310..391821 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS complement(391878..393188) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(393276..394565) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(394620..395552) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776935.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(395542..396507) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 396727..397719 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 397821..398693 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 398690..400111 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene sufB CDS 400171..401340 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene sufD CDS 401337..401681 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 401689..402453 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene sufC CDS 402450..403730 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 403744..404199 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 404196..404531 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(404622..404858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 404963..405301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 405390..406391 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene dapD CDS 406435..407250 product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(407222..408124) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943917.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene dapA CDS complement(408150..410000) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976911.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 410213..411721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(411877..413415) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(413505..414149) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729354.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 414411..415625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 415800..416459 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 416456..417364 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 417361..419097 product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028032.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene araD CDS 419119..420279 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028031.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 420290..421606 product polysaccharide lyase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 421706..422848 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(422916..423785) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 423958..424887 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 424893..426068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028037.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 426201..427613 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(427681..429045) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 429114..429740 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729044.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(429786..430556) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 430680..432200 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 432451..434397 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(434470..435066) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(435080..436102) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804052.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(436105..436968) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(436965..437711) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804050.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 note possible pseudo, frameshifted CDS complement(437884..439176) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 439320..441338 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804048.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 441458..442567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(442651..443550) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene thpD CDS complement(443620..444024) product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(444094..445362) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene ectB CDS complement(445434..445892) product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene ectA CDS complement(446347..447009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(447006..447689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 447754..448875 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 449020..450117 product SCO1860 family LAETG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(450218..450448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976975.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(450468..451727) product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976976.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene pitH CDS 451956..453074 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 453158..454537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976980.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 454629..456293 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 456655..456876 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 456911..457696 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 457917..458396 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 458444..458641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 458648..459004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 459001..459729 product DUF6286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486046.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 459740..460336 product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene amaP CDS complement(460370..460684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(460716..461552) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(461578..462543) product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 462695..463681 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene moaA CDS complement(463682..463933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(464116..464484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(464526..465947) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene tyrS CDS complement(466006..467406) product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(467488..469017) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(469149..469790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(469964..470185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 470139..470624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 470733..471452 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene fabG CDS 471456..472226 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene fabI CDS complement(472304..472999) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 473071..474378 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 474395..474514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 474675..474884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 474959..475477 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(475508..476719) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 gene serB CDS 477007..479436 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 479625..480785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 480778..481419 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 481589..481828 product chaplin ChpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene chpE CDS complement(481903..482121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 482005..482250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(482340..483182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 483289..484080 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 484179..484601 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 484656..485621 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(485719..486255) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977027.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(486429..486971) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 487036..487347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 487350..488027 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 sequence16 source 1..588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..332768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..1712) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 tRNA 737..810 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(1712..2695) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(2692..4014) product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484831.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(4011..4703) product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247888.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(4743..5960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 6155..6832 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene mtrA CDS 6833..8638 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene mtrB note possible pseudo, internal stop codon, frameshifted CDS 8664..10493 product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 10537..11268 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 11426..12124 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene raiA CDS 12265..13053 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(13063..14283) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 14407..17187 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene secA CDS complement(17321..17830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 17948..18409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 18450..19139 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 19423..24396 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 24529..24927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 24927..26723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 26794..27270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(27318..28454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(28456..31239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(31236..32783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 32925..33962 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 33959..34363 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974096.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(34397..34984) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 35090..35671 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(35583..36425) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974890.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(36435..36917) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(36943..37917) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene galE CDS complement(37932..39521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(39518..41641) product bifunctional glycosyltransferase/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028696.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(41916..43091) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(43088..44056) product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene tgmB CDS complement(44060..44350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(44400..44765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(44762..45040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(45030..45365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 45394..46917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 46917..47510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(47574..48506) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(48503..49813) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(49838..51184) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(51473..55942) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028692.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 56292..58034 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975838.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 58163..59410 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028691.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 59598..60656 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene prfB CDS 60905..61639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(61754..61954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 62183..62872 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene ftsE CDS 62919..63830 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 gene ftsX CDS 63984..65051 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668732.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 65096..65602 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene smpB tmRNA 65697..66066 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 66267..68105 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(67994..69379) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484859.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 69470..70477 product LysR family transcriptional regulator StgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene stgR CDS complement(70598..71278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(71275..72114) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 72196..73140 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(73177..74166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(74167..75096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 75311..75439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 75494..76732 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101032.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 76884..77756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 77800..78741 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 78933..81143 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 81357..82673 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(82965..83183) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(83295..83483) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326277.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(83663..85156) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene mmsA CDS complement(85173..87053) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene iolD CDS complement(87050..87955) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene iolB CDS complement(87997..88884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(88881..89882) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene iolC CDS 90060..90956 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 90989..92035 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 92070..92810 product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 92889..94256 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805138.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 94231..95133 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805139.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 95130..95957 product maltodextrin ABC transporter permease MdxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242930.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene mdxG CDS 95957..97042 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 97197..98438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(98565..99788) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 gene nhaA CDS 100186..100836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 100958..102988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 103178..108028 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 108142..108798 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 108888..109607 product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 109673..110749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 note possible pseudo, frameshifted CDS 110755..111210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(111221..112267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974421.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(112264..112932) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030009.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(113153..114205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(114195..115091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 115275..115958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 116066..117460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(117444..117989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(118041..119048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(119140..119406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 119558..124069 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(124162..124422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(124574..125425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 125681..126406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029707.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 126432..127331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 127328..128629 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 128640..129569 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029709.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 129566..130522 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 130554..130790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 130873..131343 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867405.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 131349..131762 product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974410.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 131759..132211 product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974409.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 132236..135205 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228852.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 135296..136552 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene clpX CDS complement(136556..136894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(136937..138697) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(138742..140127) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 140302..141345 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(141437..143698) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 143881..145191 product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031613.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 145199..145648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 145702..147192 product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(147284..148300) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(148321..149964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 150400..152274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 152277..153002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(153050..154066) product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110699.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(154063..154659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(154667..156571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 156775..157026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 157023..157934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 157936..159264 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 159261..160268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 160273..161229 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 161274..162281 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257881.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 162374..163492 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257058.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene hisC CDS 163489..165285 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 165304..165930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 165927..166577 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022464.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(166648..167202) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864582.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(167266..167808) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026968.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(167852..168784) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971541.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(168846..169211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(169208..169474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(169471..169881) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 170128..170997 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 171006..171215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 171362..171598 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 171741..172289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(172308..172757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(172781..173488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(173532..175433) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 tRNA complement(175907..175980) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 176275..177867 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 177909..179942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(179849..180166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 180292..180924 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(181008..181871) product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 182238..183713 product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028511.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 183907..185571 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene ettA CDS 185585..186013 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 186013..186660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(186760..187614) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 187723..188127 product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(188173..189249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(189246..189974) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(189986..190957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 note possible pseudo, frameshifted CDS complement(191000..192208) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(192274..195279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(195282..197840) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028497.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(197837..199084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(199200..200456) product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028495.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(200529..201902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976138.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 202279..203358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 203457..204050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(204047..204685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(204716..205624) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(205663..206571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 206763..207302 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 207456..207746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 207808..208086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(208183..209061) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225028.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 209150..210136 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(210333..212906) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene pepN CDS complement(213026..216289) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(216689..219277) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene pepN CDS 219430..220059 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(220150..220806) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(220862..221221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(221218..221463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(221460..222587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 222693..224057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(224210..224479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228535.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 224661..225242 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 225276..225752 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 225752..226564 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(226549..227886) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 228548..230230 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538164.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 230227..231174 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400748.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 231204..232136 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 232136..233749 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(233877..235106) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 235235..236389 product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 236573..237295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(237361..238512) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 238712..238927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 tRNA complement(238972..239044) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 239184..239260 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 239408..240832 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene tig CDS 241071..241685 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 241743..242402 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 242603..243907 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene clpX CDS complement(244028..245125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(245238..246089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028456.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 246268..248901 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(248870..249325) product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229876.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(249364..251151) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(251148..251654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(251651..252181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(252235..253008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 253283..253483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 253514..256327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 256378..257145 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528821.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 257175..258767 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 258767..259114 product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 259216..259629 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976187.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene ndk CDS 260004..261002 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 261132..262238 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene mreC CDS 262242..262955 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene mreD CDS 262952..265273 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene mrdA CDS 265275..266465 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene rodA CDS 266751..268679 product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 268683..269240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 269364..270167 product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 270374..275233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 note possible pseudo, internal stop codon, frameshifted CDS 275484..275807 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene rplU CDS 275822..276085 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene rpmA CDS 276269..277726 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene obgE CDS 277985..279418 product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 279529..281550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(281632..283581) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776626.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 283694..284353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 284447..285955 product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030974.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 286102..286395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 286590..287642 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene proB CDS 287762..288175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028437.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 288229..289503 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 289500..290093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326198.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 note possible pseudo, frameshifted CDS 290144..291220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028435.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(291171..292289) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 292442..292597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976223.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 292681..293274 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene nadD CDS 293305..295086 product polydiglycosylphosphate transferase PdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene pdtA CDS 295225..295674 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene rsfS CDS 295698..296315 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 296666..296899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976229.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 tRNA 297030..297103 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 297328..300186 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene leuS CDS 300308..300949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 300973..301818 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 301940..302824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 302811..305645 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(305687..305935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 305977..306978 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene holA CDS complement(306994..307746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(307972..308238) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene rpsT CDS 308457..310313 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene lepA CDS 310444..312333 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(312370..313611) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene hemW CDS complement(313628..314470) product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(314476..315156) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028425.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 315346..316362 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene hrcA CDS 316363..317508 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene dnaJ CDS 317527..318273 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(318461..320002) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 320152..323595 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 323529..323759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS 323767..324672 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 324728..326260 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(326322..327650) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 327703..328941 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS 329057..330067 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 330081..330578 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene ybeY CDS 330604..331920 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 misc_feature complement(332194..>332768) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029732907.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_33750 sequence18 source 1..550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..512) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 sequence19 source 1..1007495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..785) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(778..2079) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(2082..2840) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(2842..3750) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(3889..4551) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973863.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 4618..5058 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 5091..6728 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 tRNA complement(5104..5183) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 7226..9007 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene lnt CDS 9004..9765 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 9762..10394 product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977403.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(10506..10880) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(11049..11750) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 11866..13365 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 13362..13910 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(13927..15576) product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 15639..16772 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(16813..17652) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 17779..20079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027528.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(20112..22526) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 22822..24237 product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 24240..25643 product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(25807..26487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 26747..27973 product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027524.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 28004..28822 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(28738..29232) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(29271..29687) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(29677..30288) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene dhaL CDS complement(30311..31303) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene dhaK CDS 31472..32155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(32510..33298) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896947.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(33323..33952) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027391.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(33964..35169) product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 35371..35928 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene ssuE CDS 36057..37868 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031533.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 37897..38394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031540.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(38336..40213) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(40282..41397) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971893.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 41482..41637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 41639..43108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(43404..44867) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS 45103..46569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977413.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 46738..50358 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(50378..50845) product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 50964..53405 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 53444..55498 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 55646..57160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977417.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 57157..58062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027772.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 58129..62802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224660.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(62796..63068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 63304..65865 product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 65877..66317 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 66329..66727 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 66708..67313 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(67483..68211) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 68411..69319 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(69322..69954) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(70073..71128) product carbohydrate-binding protein CbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene cbcC CDS 71493..73031 product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene desA CDS 73024..74352 product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(74396..74797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(74926..75918) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(76035..76343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 76371..77072 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(77152..78135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 78193..78759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 78942..79955 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031381.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS complement(80028..80819) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(80864..81412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 81519..81992 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225198.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 82067..82450 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(82511..84196) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(84251..85426) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(85695..86315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486010.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 86490..87620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 87691..88659 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(89009..89440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(89595..91280) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 91331..91621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 91618..91797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(91874..92635) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224710.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(92845..93807) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916599.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(93804..94448) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027391.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(94524..95669) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene dgoD CDS complement(95724..96500) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(96632..96862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 96999..98009 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227818.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(98111..104428) product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036422.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(104569..108852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 109065..112652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(112619..113278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 113417..113770 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878203.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 113912..114817 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 114932..115630 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS 115727..116581 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(116642..117250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(117338..118576) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(118573..119673) product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(119679..120425) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 120864..121517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 121687..122370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 122474..123700 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(123754..124506) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 124898..126001 product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027499.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(126052..126687) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(126684..127769) product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 127926..128405 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975205.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 128389..129231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(129246..129914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(130023..130940) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 131006..131191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 131412..132701 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(132634..133191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 note possible pseudo, internal stop codon, frameshifted CDS complement(133196..134410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 134562..134828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977105.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(134872..135627) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(135650..137008) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 gene hmgA CDS complement(137083..138435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(138593..139057) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 139223..140341 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS 140427..142079 product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 142102..143196 product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420436.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(143258..143719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 143775..144869 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 145033..146283 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene urtA CDS 146283..147179 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene urtB CDS 147176..148267 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene urtC CDS 148264..149064 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene urtD CDS 149064..149753 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene urtE CDS complement(149772..151595) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(151681..152142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 152369..153226 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 153230..153487 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(153583..154308) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529496.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(154368..155657) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026863.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(155722..156660) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730689.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 156806..158281 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903314.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene nhaC CDS complement(158377..159906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 note possible pseudo, frameshifted CDS complement(160005..160487) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029397.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(160556..162034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(162050..162277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 162420..165188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 165185..166039 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 166154..166789 product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(166705..167028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 166913..169219 product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(169279..170373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(170719..170994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 170911..172044 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 note possible pseudo, frameshifted CDS complement(172064..172783) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019778.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(172870..173622) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(173666..174580) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 174694..175812 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene prpF CDS 175853..176950 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974519.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 176947..178656 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812769.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 178653..179768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(179828..180664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(180661..181929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(182013..182375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(182369..182989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(182980..183540) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 183647..184177 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 184174..184407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 184411..185709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(185764..186141) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(186143..187138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222520.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 187318..187578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(187615..189132) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(189319..190332) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224034.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(190329..191780) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031143.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 191945..193798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 193905..194387 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(194451..195494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(195519..196784) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 197125..197244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 note possible pseudo, internal stop codon CDS 197311..197988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35510 note possible pseudo, internal stop codon CDS 197955..198374 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393564.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(198480..198962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 199429..200904 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190163775.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 201062..202039 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776925.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 202072..202650 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 202710..203936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469364.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(203905..204465) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(204475..205089) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 205146..206072 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(206125..206922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 207048..207560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(207550..207804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 208028..208645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(208705..210363) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029615.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(210479..210604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(210667..210873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 note possible pseudo, internal stop codon, frameshifted CDS complement(210870..211076) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(211073..211279) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(211276..211479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(211476..212300) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 212430..212858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 212851..213120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 213117..213479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(213591..214244) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(214341..214844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 214756..215106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(215045..215470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(215457..217088) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777052.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 217330..217959 product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967417.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 217956..218507 product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531333.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 218515..219246 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246008.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 219239..220729 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525190.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 220732..220962 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 220962..222005 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267558.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(222094..223098) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(223095..223868) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(223868..224977) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(225061..226311) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 226653..227972 product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224121.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(227950..229038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 tRNA complement(229095..229182) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 229290..230615 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 230741..230974 product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene chpH CDS 231124..231951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(232013..232177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 232261..232908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(232939..234858) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027909.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(234855..235838) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 235914..236963 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 237084..237779 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 237856..238449 product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 238446..239306 product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 239373..240602 product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene mshC CDS complement(240664..241686) product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene parJ CDS complement(241879..243492) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(243499..245043) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene glpK CDS complement(245102..245914) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(246073..246837) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977167.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS 247093..250608 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene metH CDS 250752..251480 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(251489..252160) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(252219..253268) product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 note possible pseudo, internal stop codon CDS 253364..254605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 254665..255594 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 255754..256263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(256319..256648) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 256891..258663 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene arc CDS 258736..260247 product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene dop CDS 260371..260583 product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 260730..261575 product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene prcB CDS 261609..262382 product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 gene prcA CDS complement(262605..263588) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 263709..264974 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 264984..266345 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene pafA CDS 266426..267403 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 267469..267843 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 267934..268887 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 268903..269871 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 269937..270131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 270270..270566 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 gene tatA CDS 270641..271540 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene tatC CDS 271653..274463 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(274471..275403) product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(275442..276137) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(276134..277642) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112038.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene eat CDS complement(277754..278509) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027884.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 278583..279950 product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene glnA4 CDS 279971..281341 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495124.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 281345..282130 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 282177..283073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(283070..283381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(284273..284911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 284994..285878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283992.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 285875..287074 product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene mycP CDS complement(287043..287954) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027879.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 288198..288941 product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 289026..289862 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913203.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(289873..290244) product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 290527..291168 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene infC CDS 291285..291479 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene rpmI CDS 291590..291973 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene rplT CDS 292177..293025 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 293143..294222 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 294408..295544 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene pheS CDS 295544..298084 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 gene pheT CDS complement(298161..299156) product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973663.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene ligD CDS 299086..300066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(300080..300940) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(301074..303329) product xyloglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030999.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 303585..304844 product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027868.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 304937..305503 product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(305492..306550) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969394.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 306726..307202 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031629.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 307199..308836 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031630.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(308907..309938) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(309935..310195) product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(310239..312041) product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 312389..313225 product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(313278..313880) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228115.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 314032..314886 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(314931..315131) product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977235.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(315190..316146) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 316145..317593 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 317656..318216 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(318170..318958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(319017..319859) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026945.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 319999..321003 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728225.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 321105..321629 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 321766..322797 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene argC CDS 322794..323951 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene argJ CDS 323948..324874 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene argB CDS 324871..326076 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 326105..326638 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(326681..327724) product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 328068..329501 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene argH CDS complement(329565..330566) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 330724..331575 product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027634.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 331572..336605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 336602..337783 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 337787..341800 product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220451701.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 341860..343740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027637.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 343746..344717 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325827.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(344751..345431) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 345635..346810 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 347032..347547 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977261.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(347560..348021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977262.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(348014..348391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(348402..348713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 348939..349979 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 349979..350647 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 350733..351596 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 351718..352305 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 352371..353603 product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene cbiE CDS 353790..357509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 note possible pseudo, internal stop codon, frameshifted CDS 357623..358861 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene cobA CDS 358858..359694 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(359679..360779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 note possible pseudo, frameshifted CDS 360803..361108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 361096..361257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 tRNA complement(361449..361523) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(361548..361620) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(361643..361715) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(361716..361787) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(361809..361882) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 361997..363073 product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 363048..363875 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 363884..364726 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485797.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(364771..365280) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325815.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 365391..365792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 365878..366084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(366107..366679) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(366872..367285) product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 tRNA 367619..367691 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 367910..369838 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene thrS CDS 369899..370462 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(370511..372187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027832.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 372419..373081 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 373078..374010 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 374007..375203 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 375249..375797 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 375950..376864 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977304.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene pdxS CDS 376920..377489 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene pdxT CDS 377550..378302 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 378386..378952 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene ruvC CDS 378949..379575 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene ruvA CDS 379593..380663 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene ruvB CDS 380825..381289 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene yajC CDS 381406..383295 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene secD CDS 383297..384451 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene secF CDS 384457..385017 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 385189..387618 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene relA CDS complement(387714..389057) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(389235..390095) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 390215..390928 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 390941..392224 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene hisS CDS 392319..392933 product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 392972..394342 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(394377..395162) product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222102.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 395209..395829 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene rpsD CDS complement(395881..398055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 398335..398775 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 398790..399137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 399137..401803 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene alaS CDS 401817..402281 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene ruvX CDS 402407..404188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 404188..405027 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 405167..406351 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene aroC CDS 406348..406863 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 406860..407960 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene aroB CDS 408182..408874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 note possible pseudo, frameshifted CDS 408941..410053 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977334.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 410123..410689 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene efp CDS 410691..411116 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene nusB CDS complement(411228..411728) product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene bldD CDS 411922..412497 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene pyrR CDS 412593..413561 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 413554..414858 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 414855..415460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 415457..416593 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene carA CDS 416586..419918 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene carB CDS 419920..421083 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 421080..421925 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene pyrF CDS 422138..422461 product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 422500..423051 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene gmk CDS 423104..423385 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene rpoZ CDS 423593..424807 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene coaBC CDS 425091..426299 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene metK CDS 426345..428474 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(428503..429243) product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 429308..430504 product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(430501..431154) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978024.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(431230..431679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 431930..432859 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene fmt CDS 433016..434389 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 434414..435118 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene rpe CDS 435267..436259 product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 436442..437878 product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 438141..438599 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 438956..440089 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976111.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene ribD CDS 440090..440719 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 440716..441372 product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 441369..442670 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 442667..443212 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene ribH CDS 443247..443519 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 443588..444436 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene hisG CDS 444444..445001 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(445019..446899) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027787.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(446913..447485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 447616..448974 product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(448996..449739) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 449659..449961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 449958..451151 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(451156..451632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977399.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 451798..453834 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 453867..454730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977433.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(455058..456728) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene ptsP CDS complement(456743..457195) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 457386..457994 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 458130..460622 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 460683..461576 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 461573..461905 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 461911..462789 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 462946..463662 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 463741..464214 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 464359..464976 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 464996..466414 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(466369..466758) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668708.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS 467204..470101 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene gcvP CDS complement(470177..470746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325749.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 471004..472497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 472563..473396 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(473369..474196) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(474276..475070) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 475163..475960 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085615.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(475976..476647) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 476748..478028 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(478059..478913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS 479080..479667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(479701..481128) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 481406..482155 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067188.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(482429..482728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 482634..483815 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331252.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 483812..484762 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 484759..485592 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974653.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 485627..486829 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 486898..487524 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229467.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 487521..488468 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728676.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(488503..488913) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS complement(488957..489973) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225577.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 490232..491125 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225578.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(491226..493034) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978566.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 493240..494259 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862312.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(494272..494862) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978564.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(494987..495847) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 495830..496702 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974282.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 496786..496995 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974281.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 497014..497856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 497853..498251 product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 498348..499109 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene fabG CDS 499192..499884 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene ung CDS 500157..501335 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene tuf CDS 501416..502270 product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS complement(502317..503078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS complement(503233..504093) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 504277..504846 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 504894..505457 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 505520..506206 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728083.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS complement(506278..506820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(507161..508063) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226948.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(508060..508950) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226949.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 509080..510024 product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene bla CDS complement(510139..510528) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 510618..511265 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 511329..512435 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 512432..513058 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 513174..514229 product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226281.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 repeat_region 514633..515516 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggaccacccccgcatgcgcggggaccac CDS 516081..517235 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 517232..521686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 521718..522530 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245148.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(522576..524267) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(524353..524895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS 525056..525985 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(526019..526768) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 526898..527638 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027677.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(527872..528981) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(529032..530462) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene purB CDS complement(530474..531253) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(531273..532304) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977578.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(532301..533611) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(533727..534461) product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 534417..535196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(535159..535428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 535310..536821 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 536978..537799 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(537946..539319) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(539316..539981) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 540238..541395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS 541511..543451 product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225058.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(543519..544763) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene rocD CDS complement(544760..545575) product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977609.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(545678..546199) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977610.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(546258..546866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 546912..548432 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 548429..549415 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 549405..550391 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 550406..551497 product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene rhaS CDS 551667..552791 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225132.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(552795..554387) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411714.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(554469..554846) product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620749.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(554984..555187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(555202..555711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(555870..556148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 556482..557882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(557815..559053) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870119.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 tRNA complement(558124..558211) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(559127..560410) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS complement(560407..561777) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(561774..563381) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(563374..564147) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946521.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS complement(564144..564908) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS complement(564910..565890) product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230220.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(565923..566963) product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313601.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS complement(566960..568099) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS complement(568096..568362) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225913.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(568409..569260) product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(569263..578592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(578609..580447) product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141951.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 580711..581946 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 581943..582857 product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 582890..583138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 583301..583969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS complement(584011..585258) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS complement(585269..586249) product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224997.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS complement(586328..587869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(588027..588839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS complement(588836..589471) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(589468..590700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(590697..591416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(591564..592229) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 592854..593534 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029450.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(593545..593958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(593955..595187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 595381..596829 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene argG CDS complement(596897..597628) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027213.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene pepE CDS complement(597675..598532) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978288.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 598825..599796 product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027212.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 599823..601508 product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 601517..602227 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 602249..602881 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391752.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 603033..603842 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 603888..604772 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349546.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(604823..605623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(605722..606201) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(606267..606602) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064840.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene mnhG CDS complement(606626..606892) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(606889..607491) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089085.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(607488..608990) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(608987..609412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(609409..612288) product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031336.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(612509..614029) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862091.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 614194..614757 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(614780..615652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 615899..616102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 616099..616275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS 616352..616570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 616676..618586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 618583..619182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS 619179..620033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS 620011..621834 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 621974..622387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 622408..623868 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775793.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 623865..624137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(624149..625147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(625344..627470) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027382.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 627579..628094 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978019.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 CDS complement(628129..628881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(629511..630293) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(630302..631021) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971779.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(631095..632183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 632275..632496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(632649..633356) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(633494..634453) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(634608..635486) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 635685..636545 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(636681..637352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 637607..639007 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(638980..639249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 639224..640858 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 640935..642587 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 642751..643425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 note possible pseudo, frameshifted CDS complement(643457..645691) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS complement(645688..646464) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 646996..648078 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 648071..649210 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 649207..650145 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 650157..650939 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 650979..652019 product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064449.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 652016..653881 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(653888..654634) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS 654775..657171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS 657223..658488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 658757..659977 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(659991..660758) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS 660893..661255 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(661266..661931) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029431.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 662086..663711 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 663766..664431 product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270136.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 664314..665945 product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742244.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(666057..669221) product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(669538..671061) product tripartite tricarboxylate transporter permease TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015409.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene tctA CDS complement(671061..671669) product tripartite tricarboxylate transporter TctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015410.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 gene tctB CDS complement(671666..672652) product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258645.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 672779..673570 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228704.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 673616..674197 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030549.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS 674190..675107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 675297..676313 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(676344..677759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 678229..679068 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972553.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 679243..680106 product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene cdtA CDS 680216..681280 product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene cdtB CDS 681277..683379 product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene cdtC CDS 683433..684569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 685092..689162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 689204..690109 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 690109..690753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 690750..691754 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene cysK CDS 691751..692992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(693108..693905) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225421.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 694022..694801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS 694798..695133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 695152..695868 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 695838..696953 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(697144..698631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(698679..699995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 tRNA complement(700945..701019) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS 701205..701471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 701544..702422 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 702529..703545 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 703622..705166 product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930183.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(705245..707527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 707997..712631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS complement(712727..713326) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165264447.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 713578..714177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS complement(714268..715095) product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729527.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 715597..756999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 note possible pseudo, frameshifted tRNA complement(737850..737940) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 757002..757223 product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 757382..757618 product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 757748..758836 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 758833..760143 product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 760140..760970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(761033..762235) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222026.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS 762445..763407 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 763404..764237 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 764361..765362 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674803.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 765383..766462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674804.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS complement(766524..767747) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 tRNA complement(767890..767964) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(768025..769455) product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 769554..770537 product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene axeA CDS 770675..772270 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 772267..773322 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 773330..774220 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 774217..775197 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 775190..775879 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(775863..776084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 776200..777315 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS 777324..777971 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 778017..779027 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(779052..779870) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(779985..780770) product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(780780..781457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(781633..782859) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(783019..784452) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene xylB CDS 784575..785747 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene xylA CDS complement(785791..786837) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(787121..789052) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225268.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 789187..790950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 790947..792389 product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284325.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(792448..793260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40600 note possible pseudo, frameshifted CDS 793199..793450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(793743..794951) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS complement(794948..795250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS complement(795357..796319) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 796542..797783 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(797767..800085) product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(800152..800643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 800747..801610 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 801612..801848 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(801913..804867) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 805153..805965 product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(806010..807305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027625.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(807302..810130) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 810322..811449 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029216.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 811493..811675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325661.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS 811879..812271 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977676.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS 812371..813324 product DUF6397 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027615.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 note possible pseudo, frameshifted CDS complement(813348..815861) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 815988..816773 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(816904..818724) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(818721..820565) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 820692..821060 product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901716.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 gene nmtR CDS 821092..821256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 821468..821614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 821986..822585 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 822796..823218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(823327..823920) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(824115..825062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(825204..826223) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 826379..827458 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 827604..829607 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(829686..831275) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 831395..833269 product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027279.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 833370..835202 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 835321..836199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(836249..836896) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229995.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS complement(836932..837333) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 837407..838111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(838118..838546) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(838561..839640) product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 839842..840510 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228547.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 840570..841562 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene mgrA CDS complement(841593..841727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(841743..842312) product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(842359..842988) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(843000..844487) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(844484..845239) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(845239..846744) product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(846771..848840) product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(848828..849988) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene rhaI CDS 850146..850466 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 850523..851545 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 851641..852063 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 852092..852412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 852449..853045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 853042..856809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(857182..857667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS complement(857693..858244) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225557.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 858472..859233 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099204.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 859402..859794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(859896..860861) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS complement(860939..862762) product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS complement(862818..863744) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031710.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS complement(863747..864700) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971641.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(864733..866076) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668787.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 866253..867290 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971643.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(867392..868048) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086034.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 868180..869994 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 870132..871913 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 872004..872723 product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 872882..873052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 873363..874490 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031842.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(874509..877541) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS 877738..879972 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(880053..880922) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775734.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(880919..881788) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775733.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 881736..881921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(881905..883188) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775732.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 883475..884650 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484476.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(884727..887510) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 887739..890441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 890566..891555 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 891585..893606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 893674..894705 product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS 894775..895968 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 895988..896203 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 896200..897354 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228905.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 897449..899236 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227785.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 899233..899625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 899636..900829 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 900875..901684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS complement(901664..902305) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(902696..903847) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene ispG CDS complement(903844..905658) product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417910.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(905670..906671) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417912.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene ispH CDS 906878..907681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(907704..908369) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243931.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 908505..911366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 911421..911822 product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene madL CDS 911824..912588 product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene madM CDS complement(912640..914277) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS complement(914274..914786) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(914783..915409) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(915548..916624) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 916849..919347 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031125.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 919348..921573 product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031124.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 921729..922751 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339291.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 922748..923791 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014531406.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 923788..924813 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(924826..925308) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014091.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 925488..926729 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467629.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 926726..926926 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(926984..928282) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS complement(928351..928566) product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228022.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(928563..930083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(930100..933465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(933462..935252) product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225490.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(935252..950578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 note possible pseudo, internal stop codon, frameshifted CDS 951204..951725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 951779..953617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 954654..954887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(955858..958365) product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(958688..960019) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209645502.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS complement(960147..960857) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS complement(960898..961677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS complement(961886..962881) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS complement(962878..963528) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(963631..964713) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS 964815..965177 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(965224..965916) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 966081..967547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(967538..968161) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977728.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(968331..969026) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(969258..970280) product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027576.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(970288..970890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 971038..971598 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(971582..972328) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 972456..973856 product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977741.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 973903..974682 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 974679..975740 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(975808..976518) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 976657..977019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 977105..977902 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 977954..978916 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 979042..980319 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 980364..981326 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 981355..982377 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977755.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 982467..983102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 983220..983798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(983825..985213) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS 985387..986646 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(986684..987844) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 987934..989157 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027535.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(989131..989325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977410.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 989521..990759 product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 990783..991511 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 991566..992468 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 992774..993490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(993590..994492) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(994683..995723) product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028737.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 995984..997024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 997290..997805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(998130..998954) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS 999698..1000327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 1000798..1001592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(1001682..1002224) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234904359.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(1003444..1004232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(1004698..1005180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 1005344..1005754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(1006031..1006495) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231011.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS 1006546..1007019 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231010.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 sequence20 source 1..783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..2020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 sequence22 source 1..2581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..1661 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 sequence23 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 sequence24 source 1..697421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..1350 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 1906..2178 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(2577..3818) product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(4054..4896) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975513.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(5240..6223) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS 6299..6595 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS 6827..7624 product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 7621..9306 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028907.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 9303..10289 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene hemC CDS 10286..11944 product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 11941..12954 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene hemB CDS 12990..13760 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 13760..14782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 14911..16212 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 16306..16971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(16981..18216) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726720.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(18377..19564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS complement(19867..21630) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene argS CDS 21748..23481 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene lysS CDS complement(23519..23938) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487415.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(24042..24419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 24334..25839 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028880.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(25859..26287) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223930.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(26367..27638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(27720..28493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(28576..29406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975534.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(29454..30464) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(30626..31237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 31367..32677 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene hemL CDS 32704..33393 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 33509..34147 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS 34155..34925 product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 34916..36703 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS 36700..37797 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene ccsB CDS complement(37836..38270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 38356..39807 product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS 39804..40730 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(40734..41357) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(41397..41627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(41713..42723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(42729..43037) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974839.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS 43197..44180 product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene tgdA CDS 44351..45088 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974837.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 45370..46170 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029457.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(46193..46558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 46778..47878 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 gene pstS CDS 47951..48904 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene pstC CDS 48954..50075 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene pstA CDS 50105..50881 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene pstB CDS complement(50965..54276) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS complement(54554..57874) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(58065..59063) product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene pitH CDS complement(59069..59689) product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(59794..60147) product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(60226..60597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(60594..60980) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 61112..63151 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901403.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(63238..63651) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 63730..64896 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229631.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 64983..65456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(65440..68097) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene alaS CDS complement(68338..69015) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(69012..69554) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene pyrE CDS complement(69551..70099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS complement(70132..71025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(71082..71921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS 72286..73833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 73830..74186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 75191..75622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS 75810..76511 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 76629..77966 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116948659.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS 77981..78745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS 78794..80935 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS 81285..82052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(82073..82765) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS complement(82766..83614) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 83779..83964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(84004..85251) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(85349..85966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 86107..86544 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene dtd CDS 86547..87167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 87258..88100 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 88183..88641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(88780..89751) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(89761..90201) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 90371..91123 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS complement(91143..91820) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(92027..92590) product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(93107..93394) product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(93416..94255) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(94665..95375) product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(95492..96298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(96352..96618) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 96845..97597 product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene glnR CDS 97669..98706 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS 98805..99395 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326184.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 99460..100440 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009689.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 100475..101206 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 101203..102618 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(102653..103150) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene soxR CDS 103221..104042 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 104039..104737 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(104727..106550) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 106779..107675 product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 gene mshD CDS 107761..110058 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS 110042..110467 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(110522..111316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 111429..112712 product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene mshA CDS 112705..113193 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS 113292..113477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(113465..114145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(114197..114592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43460 note possible pseudo, internal stop codon CDS complement(114672..117359) product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS 117442..118200 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 118214..119566 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS complement(119662..119853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS complement(119949..120626) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 gene phoU CDS 120855..122174 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 122171..122851 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(122931..123677) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029520.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 124172..124654 product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 124967..125731 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene ispD CDS 125721..126224 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene ispF CDS 126318..126722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS 126839..128230 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 gene cysS CDS 128283..129221 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene rlmB CDS 129401..130861 product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739108.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 131046..132035 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(132075..132803) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(132864..133313) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029526.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(133514..134638) product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 gene msiK CDS complement(134881..135540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 135539..136195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(136258..136980) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 tRNA 137114..137189 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(137235..137474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS complement(137471..137635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(137632..137880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 138112..138837 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 note possible pseudo, frameshifted CDS 138827..139015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(138999..139619) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(139691..140125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(140239..140376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(140373..140852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(140900..141133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 141204..143360 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 143599..144831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(145500..146492) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 146661..147263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 147352..147987 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028486.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS complement(148046..148621) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 148772..149212 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 gene arfB CDS complement(149272..149772) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 150047..151660 product diguanylate cyclase CdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029551.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 gene cdgB CDS 151760..152731 product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029552.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(152807..153967) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 gene nagA CDS complement(153964..154944) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 155080..155574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 155792..157072 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 157131..157379 product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486412.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 157406..158275 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 gene otsB CDS 158404..159696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS complement(159789..161261) product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(161354..162322) product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 162733..164061 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene thrC CDS 164058..164336 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 164747..164950 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 165257..166882 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene groL CDS complement(167003..167938) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 gene murQ CDS complement(167994..168941) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 169010..169399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 169396..169668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(169684..170721) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029579.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS 170892..171668 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 gene pstB CDS 171727..172404 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112720.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 172569..173666 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 gene pstS CDS 173810..174793 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036711.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 gene pstC CDS 174790..175731 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 gene pstA CDS 175752..176525 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 gene pstB CDS complement(176501..176788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS complement(176785..177627) product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 gene whiJ CDS 177790..180351 product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS 180432..180869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 180978..181817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 181840..182754 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(182790..183422) product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(183367..184746) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 184957..186609 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 187004..189079 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 189221..189688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(189569..189880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS complement(189880..190587) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 190682..191227 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(191256..191525) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(191522..191794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(191885..192049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS complement(192139..192855) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS 192906..193556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(193517..194842) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031724.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 194937..195554 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(195530..195793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 196044..196427 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(196412..197290) product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(197287..197973) product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(197982..198503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(198593..200008) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS 200222..201085 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(201103..201696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS 201769..204939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 204939..205799 product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(205860..206234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(206231..206473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS complement(206570..209077) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS complement(209090..209404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 209674..210132 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 210210..211547 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS complement(211635..212138) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229654.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 212137..212745 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 gene thpR CDS complement(212870..213265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS 213308..214858 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974635.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS 214740..214958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44540 note possible pseudo, frameshifted CDS 215212..216210 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 216525..217568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(217546..218361) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 218427..219407 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 219404..220231 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029603.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 220256..221359 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776913.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 221449..222468 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256284.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(222539..223501) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 gene serC CDS complement(223846..225096) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS complement(225137..226414) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031651.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS complement(226411..227055) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469546.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS complement(227036..227458) product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223334.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS complement(227455..227901) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971722.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(227930..229474) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779113.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 229745..230716 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 230847..233735 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(233869..234360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 234535..236031 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 236049..236528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 236645..237697 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 237694..238341 product tripartite tricarboxylate transporter TctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015410.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 gene tctB CDS 238341..239867 product tripartite tricarboxylate transporter permease TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015409.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene tctA CDS complement(239941..240177) product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 gene chpH CDS complement(240306..240752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(240860..241615) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 241695..243377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 243490..244035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(244022..244669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS 244577..244768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(244769..245401) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228492.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(245448..246131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS complement(246221..246883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(246889..248037) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS complement(248312..249400) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 249604..250305 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene pdxH CDS complement(250624..251421) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS 251716..252420 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 252657..253547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44920 CDS 253609..254472 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031631.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS complement(254549..256222) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS complement(256219..257016) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(257079..257753) product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974584.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 257935..259371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 259386..259544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS 259704..261236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(261271..261840) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS complement(261848..263395) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS 263588..264034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974580.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 264070..264978 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 gene purU CDS complement(265073..265498) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175129.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS 265644..266210 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027025.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(266347..267714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS complement(267711..268253) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974573.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS 268549..268914 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS 269102..269515 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(269597..270796) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(270864..271493) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 271728..274082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 274109..274612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(274640..275221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 275404..277026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(277305..277607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS complement(277780..277974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(278147..281074) product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 gene afsR CDS 281269..283845 product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 283842..284960 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(285087..285302) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS complement(285516..286634) product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055604.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS 286978..287571 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 287568..288689 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(288793..289665) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(289822..290382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 290808..293771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 293852..294031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS complement(294095..294808) product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222232.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS complement(294929..295471) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(295669..296913) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS 296944..297909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS 298134..298445 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 gene groES CDS 298584..300209 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 gene groL CDS complement(300343..301038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(301110..301901) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS complement(301944..302261) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS 302681..303292 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 303575..304150 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS 304319..305824 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 gene guaB CDS 305878..306993 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(307064..308302) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 308518..310224 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(310122..310574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS 310614..313256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45450 tRNA 311663..311733 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 313366..316206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45460 note possible pseudo, internal stop codon, frameshifted CDS 316277..317824 product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(317951..319015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(319730..320077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS 320378..321973 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 gene guaA CDS 322160..322690 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 322881..323471 product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS complement(323479..324138) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(324135..325427) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS 325575..327017 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029865.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS 327014..327274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(327282..327779) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897578.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(327830..329071) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029864.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(329131..330246) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS complement(330394..331170) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030586.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 331253..331621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(331884..332396) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223801.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 332423..333181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(333093..333506) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728052.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS 333613..334689 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(334721..336619) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS complement(336739..337971) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029869.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS complement(338175..338810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS 338909..341347 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 gene pcrA CDS 341529..342284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(342364..343761) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029871.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS 344087..344491 product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS 344751..345929 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 gene sucC CDS 345957..346844 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene sucD CDS complement(347148..347795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 note possible pseudo, internal stop codon CDS 347867..349423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 349497..349904 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971523.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(349967..350797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029882.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS 350954..351592 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene purN CDS 351589..353166 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 gene purH CDS complement(353245..353496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS complement(353515..354150) product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(354275..354676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS 354812..355672 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 355669..356130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 356331..357995 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804291.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS complement(358146..358631) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 358691..359074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS complement(359085..360032) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS complement(360142..361131) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS complement(361245..362468) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532148.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(362616..363317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS complement(363559..364785) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 gene rocD CDS 364975..365988 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 gene trpS CDS 366107..366676 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS complement(366883..367179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS complement(367650..368948) product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS 369175..370581 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 370728..371033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 371196..372791 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973111.1 transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS complement(372910..373410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS complement(373591..374595) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145736531.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(374729..375292) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326184.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(375414..376892) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091305175.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS complement(377013..378380) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS 378478..379233 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031670.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS complement(379357..380883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS 381095..381451 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974216.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 381489..382709 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029845.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS 383239..385278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS complement(385480..385827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS complement(385858..386688) product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888478.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS 386900..387655 product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972538.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS 387664..389061 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS 389058..390155 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030922.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS 390215..391129 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030923.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS complement(391249..391491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS complement(391525..392022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(392186..392905) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(393009..393533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS complement(393517..393732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS complement(393845..394039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS complement(394051..394254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS complement(394251..395066) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 395271..395687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 395684..396034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS complement(396124..396903) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 CDS complement(396903..398657) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 gene sdhA CDS complement(398680..399150) product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS complement(399150..399455) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974113.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 gene sdhC CDS 399743..401344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS 401669..402406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 402601..404184 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 CDS complement(404082..404420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS 404393..405913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 405920..406324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS 406331..406693 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS 406671..407354 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 407461..408729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS 408726..409976 product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 409973..410899 product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 410934..411971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS 412115..413341 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS 413554..414612 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS 414808..416307 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS 416304..417440 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS 417437..418738 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 418739..419128 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS 419134..420423 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 420706..422031 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 gene mgtE CDS 422112..422981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS complement(423010..423756) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385801.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS 423921..424442 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 424510..425889 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS complement(426010..426426) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 426478..426984 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486788.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(426954..427205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS complement(427261..428193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS 428371..428985 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 429118..429432 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 429808..430371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS complement(430374..430832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS complement(431532..432800) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230677.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 gene thrS CDS complement(432943..433443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS complement(433443..434867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS complement(434961..436256) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029933.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 436321..437310 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS 437372..438511 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 438689..439015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS complement(439147..439524) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974617.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS complement(439599..440180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS complement(440358..440978) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974068.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(440975..442612) product two-component system sensor histidine kinase AfsQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974067.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 gene afsQ2 CDS complement(442609..443286) product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 gene afsQ1 CDS 443698..444246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(444403..445071) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS complement(445101..445982) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS complement(445975..447411) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(447440..448393) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 gene deoC CDS 448555..449190 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029946.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS complement(449264..450931) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS complement(450947..451753) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS complement(451832..452284) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS 452435..453856 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS 454014..454928 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 455669..456010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(456000..457778) product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 CDS complement(458187..458822) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS 458989..459813 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS 459803..460480 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 CDS 460480..462150 product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878492.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS complement(462185..462328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS complement(462384..462590) product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974048.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS complement(462644..464251) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS 464400..465257 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS 465423..466490 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 466495..467292 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS 467309..467533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 467634..468719 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870180.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS 468796..470364 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 gene hutH CDS complement(470379..470555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS 470630..471019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 471174..472448 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS 472531..472866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47040 note possible pseudo, frameshifted CDS complement(472880..473497) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(473499..474137) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(474494..475156) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 gene msrA CDS complement(475171..476574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 476476..477630 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS complement(477654..478148) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 478413..479555 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 gene ilvA CDS 479778..480905 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS 480902..481771 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS 481945..485226 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270179.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS complement(485312..485620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(485613..486497) product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 gene mca CDS 486600..487010 product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974010.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 487230..487727 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 gene greA CDS 487854..489881 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974002.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(489981..490682) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 490929..492797 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS 492985..494064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS 494147..495364 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225476.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(495365..496576) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 496750..498045 product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS 498101..499168 product ParB/Srx family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194141.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS 499195..500076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029997.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS 500144..500893 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 gene cpaB CDS 500919..502151 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973971.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS 502148..502642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS 502639..503010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS 503027..504373 product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 504394..505371 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 505388..506281 product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 506561..506758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS 506836..507348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 507385..508011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030004.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS 508011..508757 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030005.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS complement(508771..510600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 511091..511846 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029725.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 511878..512816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 513194..514528 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 514927..515640 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS 515810..517291 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(517314..519146) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730823.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS 519499..520023 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS 520020..520697 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS 520694..523072 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(523190..524995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS 525078..526496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS 526553..528226 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS 528304..529701 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 529878..530444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 530551..532446 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487155.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS complement(532486..533016) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS complement(533027..533581) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS 533729..534688 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973944.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS complement(534675..534944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS complement(534941..535936) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS 536023..536670 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS 536882..537238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(537331..538329) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 gene glpX CDS complement(538415..538654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 538629..539129 product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS complement(539116..539709) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(539810..540079) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS complement(540076..541413) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 gene xseA CDS 541412..542413 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(542415..542825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47690 note possible pseudo, frameshifted CDS 543094..544182 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 gene ychF CDS complement(544316..544579) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS complement(544572..544841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS 545144..545896 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS complement(545901..548381) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(548480..548683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(548792..549403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS 549565..551592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS 551781..553649 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 gene typA CDS 554034..555674 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS 555755..556684 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 556677..557639 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 557654..558697 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 558690..559745 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS 559922..561556 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 CDS 561559..562482 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 562475..563437 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS 563455..564429 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS 564422..565450 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS complement(565460..565810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(565807..566235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS 566472..567332 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 567341..567532 product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228870.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 567751..568023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 568231..568986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47940 note possible pseudo, frameshifted CDS 568983..570125 product ATP-grasp peptide maturase system methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028638.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 gene tgmC CDS 570175..571380 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(571445..573088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47970 note possible pseudo, frameshifted CDS complement(573343..573717) product DUF6113 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030071.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS complement(573714..574574) product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030070.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 gene mshB CDS complement(574588..574782) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973854.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS complement(574945..576039) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(576036..577064) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(577073..578050) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(578150..579970) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(579995..580906) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS complement(581308..582264) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS 582406..582732 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS 582844..583941 product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(584087..584494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS complement(584639..585589) product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029742.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS complement(585586..587178) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(587204..587755) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930077.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(587843..588628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48130 note possible pseudo, frameshifted CDS 588528..588719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS 588855..589943 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 gene dapE CDS 590045..590800 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS complement(590937..591797) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 gene folP CDS 591926..592288 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973835.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS complement(592347..593153) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 593343..593510 product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(593700..594476) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS 594622..595290 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 gene sigE CDS 595287..596123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS 597433..598659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 598765..599271 product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 599410..600099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327210.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS complement(600162..601313) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 CDS 601471..602205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 602238..602786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(602958..603695) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 604289..605644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48310 note possible pseudo, internal stop codon, frameshifted CDS complement(605653..607455) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS 607657..608571 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(608561..609403) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(609413..610033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(610116..610700) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030091.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(610711..611676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS complement(611697..611990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(612109..612336) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS complement(612500..613138) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS complement(613282..613542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973806.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS 613655..614701 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS 614710..615921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS 616058..617833 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030096.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 617830..618810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176128594.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 618935..619891 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 619985..621181 product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 gene moeZ CDS complement(621240..622796) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS complement(622834..623733) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS 623807..624433 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS complement(624468..626075) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS complement(626159..626953) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(626950..627714) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 gene modA CDS complement(627711..628118) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(628276..631197) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 631242..631652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 631892..635137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48570 tRNA complement(634653..634751) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS 635201..638563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48580 note possible pseudo, frameshifted CDS 638573..639499 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 gene nudC CDS complement(639503..639766) product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS 639932..642211 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS 642375..642734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 642832..643188 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973786.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS 643185..643517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973785.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(643723..644895) product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 645090..645668 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 645753..647339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48670 note possible pseudo, internal stop codon CDS 647350..648045 product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973780.1 transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS 648063..648818 product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030111.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS 649061..649291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972269.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS complement(649288..650499) product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296723.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS complement(650493..652043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS complement(652040..652966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729335.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS complement(652963..654231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086251.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS 654388..655203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 655270..655761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS complement(655789..656325) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS complement(656322..657869) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS 657928..659067 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS 659246..659671 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS 659776..659973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS 659999..661090 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS complement(661177..661731) product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS 661855..664824 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 tRNA 664892..664966 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS 665283..666989 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS complement(667153..667521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS 667868..668332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS complement(668352..669929) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS 670052..670642 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS complement(670639..671247) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS 671330..672958 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS 672973..675024 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 675021..675968 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 675972..677135 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS 677285..678184 product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS complement(678202..678918) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030670.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS complement(678954..679958) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 680045..681148 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS 681145..682233 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS 682235..683092 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS 683205..683447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS 683515..685335 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 gene glmS CDS complement(685696..686217) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976010.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS 686863..687981 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS 688067..688663 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 gene orn tRNA 688827..688900 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS 689094..690086 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS complement(690752..691093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS 691157..691930 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS 692000..693346 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 gene aroA CDS 693362..694369 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 gene rsgA CDS complement(694543..695346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(695396..696454) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS 696582..697322 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975187.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 sequence25 source 1..630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..453753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 121..2949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS complement(2939..3577) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223288.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(3571..4830) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223289.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS 4807..5022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS 5039..5863 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 gene hisN CDS complement(6036..7499) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS 7658..8083 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 tRNA 8128..8202 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 8280..9173 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS complement(9223..10113) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222515.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(10178..10969) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(11027..11161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS 11215..11478 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS complement(11489..11806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 11805..13358 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223920.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS complement(13324..13533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS complement(13579..14319) product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030647.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 gene erm(O) CDS 14684..18430 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 18584..18964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS 18961..19284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(19309..19806) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224743.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 CDS complement(19818..20918) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080850788.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS 21075..22019 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS complement(22148..24271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49360 CDS complement(24335..25480) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS 25638..26807 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS 26827..27996 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS 27993..28811 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS complement(28920..29537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(29723..32017) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS 32180..32956 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS 33162..34157 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259264.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS complement(34209..34637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS complement(34528..35325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49460 CDS complement(35322..36059) product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522352.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 CDS 36365..37015 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 CDS 37305..37859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49490 CDS complement(38107..38523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49500 CDS complement(38529..38780) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS complement(38777..39604) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS 39718..40191 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS 40414..41181 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846112.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS complement(41397..42014) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS 42080..42985 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS 43000..43956 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS 43953..44432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS 44561..45106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS 45081..45911 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 CDS complement(46007..46702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS complement(46799..48943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS 49055..49720 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222336.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS complement(49683..50333) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(50489..50626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS 50699..51283 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225787.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS complement(51263..52474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS complement(52579..53709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS 54005..55417 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS 55527..56675 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS complement(56879..58357) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS 58738..59205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49720 CDS complement(59927..60793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS 60876..61151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS complement(61273..61650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978001.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(61706..62407) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415984.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS complement(62418..62648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS 62542..63174 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS complement(63632..64870) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS 64911..65840 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028612.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS 66259..68124 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523564.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 gene asnB CDS 68121..69101 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104380.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 69098..69958 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538163.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 69955..71640 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900733.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 71637..73259 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538164.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 73256..74503 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530314.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS 74673..75341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114849.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS 75347..76591 product phenazine biosynthesis protein PhzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093621.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 gene phzC CDS 76644..77729 product phenazine antibiotic biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082414.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS 77729..79108 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082413.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS 79118..79672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS 79714..82047 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975859.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 CDS 82420..83838 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS 84160..84441 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS complement(84558..85880) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 gene murA CDS 86001..86558 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 CDS 86564..86893 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS 86923..88587 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS 88718..89623 product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 89620..94983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS 94988..97312 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028673.1 transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS complement(97480..98025) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925634.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(98080..100461) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS complement(100464..100820) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS 100926..101363 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS 101374..101790 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS 101968..103179 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330441.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS 103447..104820 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223556.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS 104891..106759 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 106942..107586 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 107676..108482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028670.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS complement(108582..109709) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 gene hppD CDS 109748..110350 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS complement(110293..110775) product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS 111034..112359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50150 note possible pseudo, internal stop codon, frameshifted CDS 112576..113127 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279138.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 note possible pseudo, internal stop codon, frameshifted CDS complement(113152..113436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 113698..116070 product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS 116192..116533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975892.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 CDS complement(116569..117159) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 CDS complement(117301..118629) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 CDS 118694..118996 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 gene clpS CDS 118996..119601 product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS 119769..121328 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS 121399..121830 product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS 121929..122210 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS 122210..123160 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS 123305..124441 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 gene rodA CDS complement(124448..124678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS 124758..125513 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS 125537..126265 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 gene rph CDS 126467..127522 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS 127555..128934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS 128934..129809 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS 129806..130681 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS 130713..132815 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775735.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS 132824..133426 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 gene rdgB CDS complement(133503..134171) product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS complement(134171..134851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028614.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS complement(134984..135763) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS complement(135756..136250) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 gene bcp CDS 136385..136693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS 136729..137070 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS complement(137081..139306) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS complement(139429..140727) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS 140806..142062 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS 142133..142765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS 142762..143460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50480 tRNA 143568..143644 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS 143777..144205 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 CDS 144295..144630 product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 gene mhuD CDS complement(144696..145535) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866451.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS complement(145570..146361) product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975969.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 gene ehuA CDS complement(146391..147044) product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975970.1 transl_table 11 codon_start 1 locus_tag LOCUS_50530 gene ehuD CDS complement(147041..147760) product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975971.1 transl_table 11 codon_start 1 locus_tag LOCUS_50540 gene ehuC CDS complement(147760..148707) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975972.1 transl_table 11 codon_start 1 locus_tag LOCUS_50550 gene ehuB CDS complement(148745..149605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS complement(149941..151458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 151578..152084 product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975973.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS complement(152027..153577) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS complement(153574..154554) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975976.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS 154786..155688 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975977.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS 155850..156683 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975978.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS complement(156772..158664) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975983.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS 158977..160194 product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 transl_table 11 codon_start 1 locus_tag LOCUS_50640 tRNA complement(160265..160340) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(160466..160541) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 CDS complement(160532..161050) product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028603.1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS complement(161102..161479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975980.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS complement(161533..162411) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS 162565..163179 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 repeat_region 163229..163500 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgctccccgcacgcgcggggttggtcc CDS complement(163540..164895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028595.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS 165126..165491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975996.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS 165559..166368 product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS complement(166393..166986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270050.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS 167019..167714 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS 167711..169177 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS complement(169188..170621) product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS complement(170752..171717) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028591.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS complement(171721..172728) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 CDS complement(172749..174071) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 174314..175351 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(175820..176812) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(176965..177120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS 177170..177550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS complement(177658..179082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(179033..179512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS 179549..181663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS complement(181810..182694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 183124..184896 product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 185068..185922 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS 186049..186885 product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 gene sigR CDS 186882..187202 product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 gene rsrA CDS 187387..188667 product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS 188664..189368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS 189452..190438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 190470..191093 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 transl_table 11 codon_start 1 locus_tag LOCUS_50940 gene def CDS 191366..192802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS 193066..194022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS complement(194002..194208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(194388..195413) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(195413..197806) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS complement(198385..198621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS complement(198618..200831) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860780.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS complement(200970..201758) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 202025..203287 product N,N'-diacetylchitobiose ABC transporter substrate-binding protein DasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973739.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 gene dasA CDS 203336..204310 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973738.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS 204307..205221 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973737.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS 205229..206797 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS 206833..207846 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS 208210..209703 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS complement(209890..210147) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS complement(210479..211447) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS 211521..211934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030132.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(212001..212876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS complement(212915..213328) product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS complement(213491..214444) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS 214598..216850 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS complement(216828..217292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS 217392..217814 product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS complement(217872..220310) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS complement(220459..220854) product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 gene sodN CDS 220766..221029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 221026..221445 product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 gene sodX CDS complement(221358..221981) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 222070..222834 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS complement(222939..224174) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 transl_table 11 codon_start 1 locus_tag LOCUS_51240 CDS 224656..225597 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS 225605..226534 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973711.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS 226531..227307 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS complement(227329..228129) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS complement(228174..228740) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974892.1 transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS complement(228856..229422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 229548..229706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS complement(229746..230285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS 230388..231326 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS complement(231363..232118) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS 232358..233758 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 233755..235503 product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027218.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 235505..235984 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027217.1 transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS 235984..236745 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027216.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS 236823..237548 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS 237545..238414 product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS 238414..240465 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 gene tkt CDS complement(240573..241013) product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975822.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS complement(241112..241687) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067348.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS 241778..242608 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 transl_table 11 codon_start 1 locus_tag LOCUS_51440 CDS complement(242769..242990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS complement(242983..243810) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS 243970..244137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS 244179..244379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS 244376..244792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS complement(244761..245411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51500 CDS complement(245614..246462) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS complement(246459..247196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51520 CDS complement(247324..248220) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973705.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 CDS complement(248233..249111) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS complement(249221..249400) product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS 249545..249940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 249937..252126 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030140.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS 252204..253244 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 253249..256581 product SAV_2336 N-terminal domain-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030142.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 256669..256878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS 256875..258092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51610 note possible pseudo, frameshifted CDS 258259..259605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS 259707..262739 product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030145.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 gene fxsT CDS complement(262736..263677) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031174.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS 263721..264782 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS complement(264868..268632) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS complement(268922..270001) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973687.1 transl_table 11 codon_start 1 locus_tag LOCUS_51670 CDS complement(270006..270878) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS complement(270999..271721) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS complement(271771..272574) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS 272886..275321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51710 note possible pseudo, internal stop codon, frameshifted CDS 275318..275782 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327267.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS complement(275790..276917) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030158.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(276994..277272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030159.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(277304..277840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS 278120..279424 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS complement(279488..280288) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030160.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS complement(280290..281465) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS 281537..283312 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 gene polX CDS 283536..283991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS complement(284026..285330) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 transl_table 11 codon_start 1 locus_tag LOCUS_51810 CDS 285525..286220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 CDS 286217..287572 product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 transl_table 11 codon_start 1 locus_tag LOCUS_51830 gene egtA CDS 287569..288951 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 transl_table 11 codon_start 1 locus_tag LOCUS_51840 gene egtB CDS 288951..289814 product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 transl_table 11 codon_start 1 locus_tag LOCUS_51850 gene egtC CDS 289811..291040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS complement(291000..291851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51870 CDS complement(291934..292773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51880 CDS complement(292770..293324) product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS complement(293457..294452) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS 294539..295060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS 295216..296094 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS complement(296124..298520) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS 298595..300607 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 gene yicI CDS complement(300522..300818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51950 CDS 300839..302038 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS complement(302123..303187) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 CDS complement(303187..304968) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062419932.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS complement(305010..314387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS complement(314777..315358) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS complement(315424..315765) product DUF6153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029668.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS 315897..316655 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495273.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS 316727..317518 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978600.1 transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS complement(317581..318354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS complement(318351..320393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(320390..320821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(321482..322909) product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027490.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS 323055..324563 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804819.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS 324563..325471 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 gene prpB CDS 325492..326625 product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079735.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 CDS complement(326670..327911) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031072.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 CDS complement(327974..329854) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031071.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS complement(329863..331386) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031070.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS complement(331439..331984) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031069.1 transl_table 11 codon_start 1 locus_tag LOCUS_52140 CDS complement(332029..332799) product aminoglycoside adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029599.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS 332878..333171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS 333168..333554 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS 333656..334753 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS 334838..335674 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 tRNA complement(335727..335800) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS 335927..336340 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030200.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS 336337..337101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS 337126..338520 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 transl_table 11 codon_start 1 locus_tag LOCUS_52220 gene lysA CDS 338621..339910 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS 339948..341021 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 transl_table 11 codon_start 1 locus_tag LOCUS_52240 gene thrC CDS 341193..342179 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 gene thrB CDS 342588..344603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 344692..345804 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS 345927..346151 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 gene rpmE CDS 346280..347350 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 gene prfA CDS 347367..348260 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 gene prmC CDS 348280..348927 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS 348924..349589 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS 349717..351108 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS 351315..351740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52340 CDS 352018..352824 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 gene atpB CDS 352910..353146 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 gene atpE CDS 353187..353750 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 CDS 353747..354565 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS 354679..356250 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 gene atpA CDS 356253..357182 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 357185..358639 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 gene atpD CDS 358736..359119 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS 359162..359608 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS complement(359815..361098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS complement(361352..362389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS complement(362739..363425) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS complement(363422..364618) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS 364848..365426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS complement(365455..365757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52490 note possible pseudo, frameshifted CDS 366194..367045 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467732.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 CDS complement(367049..367621) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS 367719..368264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS complement(368258..368587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52530 CDS 368950..369798 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS 369963..370256 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS 370472..372883 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030216.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS complement(372958..373629) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 transl_table 11 codon_start 1 locus_tag LOCUS_52570 gene nucS CDS 373899..374291 product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS complement(374260..375372) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS 375536..375862 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS complement(376051..377160) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031776.1 transl_table 11 codon_start 1 locus_tag LOCUS_52610 CDS complement(377474..378505) product bifunctional NAD(P)H-dependent oxidoreductase/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031875.1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS 378569..379039 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031876.1 transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS complement(379347..380324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 CDS complement(380560..381567) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973604.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS complement(381564..382604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52660 note possible pseudo, frameshifted CDS complement(382694..383461) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS complement(383465..384502) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS complement(384587..385528) product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS complement(385692..389060) product polarized growth protein Scy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030220.1 transl_table 11 codon_start 1 locus_tag LOCUS_52700 gene scy CDS complement(389244..389696) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 transl_table 11 codon_start 1 locus_tag LOCUS_52710 gene mce CDS 389866..391071 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 CDS 391068..392045 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 transl_table 11 codon_start 1 locus_tag LOCUS_52730 gene meaB CDS 392042..393220 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS 393272..393832 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804308.1 transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS complement(393861..395060) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 transl_table 11 codon_start 1 locus_tag LOCUS_52760 CDS 395023..395238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS complement(395226..395468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS complement(395774..396496) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742079.1 transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS 396585..397538 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227102.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 CDS 397916..398737 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS complement(398706..399272) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS 399394..400296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS complement(400472..401389) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS complement(401469..402326) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS complement(402323..402727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS 402704..403222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS 403219..403662 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(403800..404438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS 404733..405251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS 405345..406376 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224778.1 transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS complement(406377..406760) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110060.1 transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS complement(406843..407034) product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS complement(407038..407928) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 CDS 408063..408518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS 408487..408921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS complement(409153..410373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52970 CDS 410602..411408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS complement(411989..412843) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467799.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS 413045..413524 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(413517..413930) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398287.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS 414012..414626 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255052.1 transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS complement(414693..419153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS complement(419701..420246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS complement(420256..420648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS complement(420655..420891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 420869..421777 product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975523.1 transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS complement(421846..422541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS 422666..423340 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973594.1 transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS 423333..424832 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS complement(424896..425375) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 425454..425798 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030226.1 transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS complement(425856..427079) product peptidoglycan bridge formation glycyltransferase FemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027237.1 transl_table 11 codon_start 1 locus_tag LOCUS_53130 gene femY CDS 427259..428971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS 429018..429596 product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155369284.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS 429593..430477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS 430520..431029 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS 431074..431436 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS 431516..433213 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS complement(433259..434605) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229564.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 CDS complement(434733..435488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53210 CDS 435712..436731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53220 CDS 436792..437745 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 CDS 438231..438845 product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 CDS 438987..439607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS 439597..441096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53260 CDS complement(441203..442633) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 transl_table 11 codon_start 1 locus_tag LOCUS_53270 gene pyk CDS complement(442694..443902) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS complement(443899..446040) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 gene pta CDS 446310..447335 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS complement(447421..447663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS complement(447680..448048) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887754.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS 448104..448763 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887993.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 CDS 448760..449584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS 449703..450923 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS 451024..451911 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084839.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS 452015..452311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53370 note possible pseudo, frameshifted CDS complement(452408..452653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53380 CDS complement(452650..452790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS complement(452962..453291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS 453595..453744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53410