COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..72089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3750..4877 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 5443..7473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(8168..9325) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(9496..10377) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912616.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(10545..14309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 14544..14750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(14802..16016) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(16060..16674) product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene kynB CDS complement(16838..17734) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(17844..19262) product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830598.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 19743..20459 product lytic transglycosylase IsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751263.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene isaA CDS 20723..21577 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 21699..22331 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(22377..23078) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(23224..23853) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 23978..24442 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(24504..25382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(25586..26626) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(26626..27447) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829596.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(27444..28403) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(28393..29361) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876318.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(29571..29738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(30165..30851) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(30848..31243) product holin-like murein hydrolase modulator CidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene cidA CDS complement(31337..32251) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351761.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(32907..33329) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 33575..34819 product FemA/FemB family glycyltransferase FmhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene fmhC CDS complement(35209..36153) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(36341..37516) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(37509..38195) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(38192..39253) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 39825..40436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 40905..41069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(41167..42027) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 42162..42824 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069098.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(42946..44709) product YSIRK domain-containing triacylglycerol lipase GehC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene gehC CDS 44944..45129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 45316..46776 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene nagE CDS complement(46785..46949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 46906..47769 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene galU CDS 47788..49434 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001835549.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(49481..51658) product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(51900..54401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(54431..55354) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(55659..56297) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 56471..56917 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(56969..57709) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(57826..58044) product sterile alpha motif-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 58206..58661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(58713..59063) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(59689..62697) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786115.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 62920..64881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(65180..65899) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(65931..66896) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(67123..68049) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 68282..68632 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(68685..69047) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene dhaM CDS complement(69049..69624) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene dhaL CDS complement(69637..70605) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene dhaK CDS 70862..71710 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene yidC sequence02 source 1..45612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 38..126 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 138..212 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 225..299 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 320..395 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 424..498 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 528..601 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 611..703 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 724..797 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 810..886 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 894..969 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 982..1057 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 1064..1147 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 1155..1228 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 1231..1304 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1321..1392 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 1400..1474 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 1486..1559 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(2333..2417) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 2605..3663 product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063580.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 3790..5247 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 5240..5962 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 6117..7244 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene queG CDS 7247..7717 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene trmL CDS 7738..8916 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene nagA CDS 8940..9539 product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 9558..9716 product SAS053 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(9792..10178) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 10359..10766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 11228..12613 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene fumC CDS 12635..14167 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ppx CDS 14348..16507 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(16560..17387) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 17510..18634 product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 18637..19263 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(19335..20621) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 20891..21760 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723362.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 22155..23483 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 23485..25755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 26285..26749 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 26942..28072 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 28159..28503 product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 28699..29892 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 29889..32813 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 32836..33777 product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene yhaM CDS complement(33930..34895) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(35046..35612) product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(35664..36068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 note possible pseudo, frameshifted CDS complement(36065..36193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(36319..36675) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(36748..37173) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 37309..38043 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 38040..39254 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(39313..39834) product signal transduction protein TRAP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737976.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene traP CDS 40139..41179 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene hemE CDS 41219..42148 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene hemH CDS 42164..43567 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene hemY CDS 43757..44329 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 tRNA 44783..44858 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 44869..44945 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 44953..45026 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 45040..45113 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 45127..45197 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 45211..45285 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 45286..45359 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 45408..45498 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence03 source 1..44128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(870..1265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(1361..1684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(1774..2037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(2057..2539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 2670..2819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 2834..3058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(3092..4039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(4432..4680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(4738..4899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(4892..5251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(5264..6622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(6634..8544) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(8687..8986) product DUF2951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(9068..10513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(10514..12451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(12454..13956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(13965..14882) product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(14897..17890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(17904..18179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(18248..18742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(18798..19364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(19371..19796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(19808..20215) product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002403769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(20202..20537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(20539..20835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(20835..21116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(21130..21945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(21959..22558) product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(22648..23595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(23564..24982) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(24987..26252) product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(26236..26655) product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(26883..27305) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(27373..27924) product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(27908..28306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(28299..28706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(28708..29016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(29009..29449) product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(29433..29810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(29825..30211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(30208..30423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(30468..30872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(30886..31602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(31604..31912) product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(32209..34521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(34539..35036) product DUF669 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(35055..36386) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(36370..37074) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(37071..37553) product siphovirus Gp157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(37554..37823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(37912..38082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(38097..38321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 38387..39004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 39128..39460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(39449..39667) product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(39681..39902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(39913..40722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(40757..40984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 41135..41764 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 41780..42733 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 42885..43934 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096810449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 sequence04 source 1..40612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(597..2210) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene abc-f CDS 2517..3857 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 3859..4482 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene tmk CDS 4552..4881 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 4971..5900 product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 5906..6709 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 6723..7085 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene yabA CDS 7099..7824 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 7817..8065 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 8067..8903 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rsmI CDS 8980..10941 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene metG CDS 11020..11787 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458670.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 11801..12340 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene rnmV CDS 12347..13237 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rsmA CDS 13338..13604 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 14261..15109 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ispE CDS 15137..15958 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene purR CDS 15977..16351 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 16422..16709 product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene spoVG CDS 17005..18363 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene glmU CDS 18433..19398 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 19538..20185 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 20742..21314 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene pth CDS 21311..24835 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene mfd CDS 24813..26348 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 26345..27529 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 27519..27773 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002447891.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 27804..28181 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 28458..28835 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 29021..30310 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167380392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene tilS CDS 30300..30842 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene hpt CDS 31167..33236 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene ftsH CDS 33528..34409 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene hslO CDS 34544..35473 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene cysK CDS 35651..36442 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene folP CDS 36432..36794 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene folB CDS 36796..37275 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene folK CDS 37323..38315 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene dusB CDS 38336..39823 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene lysS rRNA 40111..40220 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 40235..40310 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 40314..40389 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 40396..40471 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 40487..40561 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 sequence05 source 1..34800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(692..1156) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830391.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene perR CDS complement(1243..2193) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(2196..2654) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene bcp CDS 2737..4023 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011595.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 4338..5432 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(5475..7211) product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(7359..7901) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(7987..9039) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284765.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene mutY CDS 9210..10187 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(10294..11115) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(11130..12659) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(12675..12989) product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(12982..13788) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene recX CDS complement(14067..14870) product monofunctional peptidoglycan glycosyltransferase SgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene sgtB CDS 15034..16779 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(17027..17542) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(17628..17786) product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 17931..19079 product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene yfkAB CDS complement(19184..19705) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(19720..20958) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(20971..21177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 21308..21766 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 21770..22063 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 22234..23532 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 23570..24139 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(24220..24849) product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene vraR CDS complement(24839..25882) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(25879..26580) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene liaF CDS complement(26593..26985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(27080..27841) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene map CDS 27937..28935 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(28999..29724) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(29726..31036) product lipid II isoglutaminyl synthase subunit MurT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene murT CDS 31178..31678 product H-type ferritin FtnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949467.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene ftnA CDS 31768..32328 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(32325..33398) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene dinB misc_feature complement(33932..>34800) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000527121.1:YSIRK signal domain/LPXTG anchor domain surface protein locus_tag LOCUS_02370 sequence06 source 1..33799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4484..5428) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene whiA CDS complement(5461..6453) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(6450..7364) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene rapZ CDS complement(7534..8466) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438914.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene trxB CDS complement(8529..9965) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(9981..10466) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(10468..11310) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene lgt CDS complement(11307..12251) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene hprK CDS complement(12614..12970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(12974..15817) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene uvrA CDS complement(15823..17805) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene uvrB CDS complement(18018..18251) product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(18257..18898) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(18996..19796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(20077..20259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(20479..21486) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene prfB CDS complement(21622..24150) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene secA CDS complement(24456..25013) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene raiA CDS complement(25077..25622) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(25736..27019) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171004420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(27189..28070) product fatty acid kinase binding subunit FakB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene fakB1 CDS 28424..29065 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(29129..30355) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene pepT CDS complement(30369..30872) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(30888..31649) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 31857..33575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 sequence07 source 1..29064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10544..10681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(10743..11462) product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(11795..13132) product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene gtfB CDS complement(13119..14636) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene gtfA CDS complement(14651..17041) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene secA2 CDS complement(17026..17925) product accessory Sec system protein Asp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene asp3 CDS complement(17915..19453) product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene asp2 CDS complement(19437..20996) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene asp1 CDS complement(21007..22230) product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene secY2 CDS complement(22309..22563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 22586..24616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 note possible pseudo, internal stop codon CDS 24638..24763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 24797..25948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 note possible pseudo, internal stop codon CDS 26171..26341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 26453..26812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 27680..27943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 sequence08 source 1..13979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1739..3229) product L-lactate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene lqo CDS 3788..5392 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 5559..7004 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene treP CDS 7110..8750 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene treC CDS 8767..9492 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118675.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene treR CDS 10010..10546 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 10708..12396 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829412.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene dnaX CDS 12501..12821 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 12823..13419 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene recR sequence09 source 1..3183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(129..3049) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence10 source 1..1636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence11 source 1..453771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1436..2485) product DUF3644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(2591..3073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(3088..3519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(4419..4601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 note possible pseudo, frameshifted repeat_region 4870..5028 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttagtactctgtaattttaggtat CDS 5961..6470 product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001822554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(6530..7141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(7208..7801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 8433..9836 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene menE CDS 9839..10831 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene menC CDS complement(10822..11058) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene yidD CDS 11120..11590 product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene ytkD CDS 11571..12359 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(12387..13967) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene pckA CDS 14483..15685 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene metK CDS 15766..16677 product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(16876..17223) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623470.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(17220..17585) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene crcB CDS complement(17612..17914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091442.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 18098..18808 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 18909..19358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(19355..19795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 20471..20689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 20919..21782 product N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 22642..24150 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 24600..25652 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene ribD CDS 25657..26286 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 26315..27496 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene ribB CDS 27512..27973 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene ribE CDS complement(28034..29014) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196362.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 29255..30079 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 30321..31271 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 31688..32101 product SarA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(32157..32717) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(32714..33667) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 33810..34958 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 35260..37671 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene leuS CDS 37685..37996 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(38053..39312) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 39433..41067 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 41067..41762 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 41819..42223 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 42628..42849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 43388..44797 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene pepV CDS 44800..45648 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene dat CDS 46000..46791 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 46804..47451 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002493957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene trmB CDS 47567..48400 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(48498..48818) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 48918..49988 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 50008..50316 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 50468..51328 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 51341..51940 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 51958..55158 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 55183..56496 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene murC CDS 56572..57009 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 57168..58115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 58320..59411 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 59761..60750 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene ccpA CDS 60924..62591 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(62652..63536) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184370.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 63885..65147 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene tyrS CDS complement(65648..66901) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 67053..67673 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 67822..68946 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(68989..70608) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene serA CDS complement(70598..71758) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(71879..72340) product SACOL1771 family peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 72415..73158 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(73442..74392) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(74724..75326) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rpsD CDS complement(75550..76020) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 76198..77904 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene ezrA CDS 78097..79233 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 79230..80450 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene thiI CDS 80482..81249 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 81426..82412 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene sppA CDS 82422..83036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 83406..84344 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 84429..85625 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(85922..86116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 86260..86769 product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(86991..87359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(87794..89167) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 89336..90619 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 90625..91689 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene thrC CDS 91686..92606 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene thrB CDS 92760..93572 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(93621..93935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(94141..95589) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 95811..97304 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(97381..97530) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene rpmG CDS 97691..97960 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsN CDS 98040..99017 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene guaC CDS complement(99236..99859) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene lexA CDS 100002..100214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 100349..100585 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 100696..102684 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene tkt CDS 102845..103084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 103268..103741 product DUF1453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 103877..104998 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 104999..108031 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(108212..108571) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene mscL CDS 108814..110448 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 110821..113520 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene acnA CDS 113899..114360 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(114405..114704) product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(114785..115366) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene plsY CDS 115817..117388 product ABC-F type ribosomal protection protein Vga(G) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene abc-f CDS 117559..119556 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557340.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene parE CDS 119556..121970 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene parC CDS 122071..123549 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 123707..124555 product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 124676..126712 product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227709.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene ptsG CDS 126789..128099 product cell elongation protein CozEb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene cozEb CDS 128220..130757 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene mprF CDS complement(130824..131345) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene msrA CDS 131484..132455 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(132515..132700) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 132823..133230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 133635..133787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(133808..134899) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 135218..136480 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 136503..137762 product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485777.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(138850..139176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171798.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 139305..141113 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene pepF CDS complement(141245..142156) product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene cvfB CDS 142973..144580 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942303.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 145140..146126 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 146131..147009 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene dapA CDS 147006..147728 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene dapB CDS 147744..148463 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene dapD CDS 148716..149870 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 149867..150937 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127595.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 150937..152202 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene lysA CDS complement(152388..152588) product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene cspA CDS complement(152756..153064) product regulatory protein MsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene msaA CDS 153725..153997 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 154012..154656 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001788788.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 154643..155782 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(155903..157249) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene brnQ CDS complement(157439..159328) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(159342..160139) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(160286..160489) product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(160647..160886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(161329..162555) product dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene sucB CDS complement(162569..165358) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(165649..167022) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(167019..167696) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(168075..168692) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(168704..169774) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(169790..170293) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(170300..171745) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(172122..172343) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(172343..172846) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(172862..173290) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913317.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene msrB CDS complement(173287..173811) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831118.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene msrA CDS complement(173836..174684) product fatty acid kinase binding subunit FakB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene fakB2 CDS complement(174703..175179) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(175198..176151) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(176265..176699) product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(176758..177876) product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404645.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(177905..178090) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001838183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 178433..179134 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 179201..179596 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(179655..180536) product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(180550..183996) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(184213..185121) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rarD CDS complement(185157..186278) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(186818..187153) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene gpsB CDS complement(187173..187730) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(187747..188055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 188244..188870 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002476769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene recU CDS 188867..191047 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138336.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(191086..191403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(191403..192077) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene nth CDS complement(192070..192756) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(192896..194188) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene asnS CDS complement(194272..196986) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(197015..197989) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(197973..199184) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(199174..200307) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene bshA CDS complement(200322..200642) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(201026..201721) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001827022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(201773..202360) product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(202386..202937) product YpiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(202948..204189) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(204191..205483) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene aroA CDS complement(205467..206558) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene aroB CDS complement(206574..207740) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene aroC CDS complement(208330..208779) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ndk CDS complement(208852..209808) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(209821..210537) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(210550..211116) product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450555.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(211412..211684) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(211862..212860) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(212882..214192) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene der CDS complement(214539..215720) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rpsA CDS complement(215803..216471) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene cmk CDS 216548..217510 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(217847..218833) product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(219071..220339) product elastin-binding protein EbpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ebpS CDS complement(220497..221873) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(221866..222813) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456188.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 222919..223167 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(223284..223835) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(224246..225991) product two-component system sensor histidine kinase SrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene srrB CDS complement(225975..226700) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(226973..227713) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159577.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(227710..228258) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene scpB CDS complement(228242..228976) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 229071..229586 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(229653..230540) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene xerD CDS complement(230567..231025) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(231122..231664) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 231741..232649 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(232996..233763) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 233847..234665 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene proC CDS complement(234723..235640) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454063.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene rnz CDS 235801..237285 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene zwf CDS 237417..238271 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(238366..239769) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene gndA CDS complement(239850..240959) product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(241279..242259) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(242272..242709) product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(242893..244170) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(244183..245166) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(245159..246157) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(246177..247595) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene lpdA CDS complement(247608..248666) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene buk CDS complement(248723..249622) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(249635..251317) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene recN CDS complement(251331..251783) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene argR CDS complement(252022..253890) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene dxs CDS complement(253959..254840) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(254821..255045) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(255032..256375) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene xseA CDS complement(256390..256776) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene nusB CDS complement(256800..257171) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(257194..258549) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene accC CDS complement(258552..259010) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene accB CDS complement(259258..259815) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene efp CDS complement(259834..260904) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 260996..261601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 261617..261847 product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(261951..262781) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 262909..263295 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(263542..265017) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene gcvPB CDS complement(265010..266356) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene gcvPA CDS complement(266369..267460) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene gcvT CDS complement(267624..268148) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(268145..268336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(268314..268712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(268705..268998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(268995..269204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(269416..269736) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene comGC CDS complement(269749..270816) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene comGB CDS complement(270785..271759) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene comGA CDS complement(272011..272631) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(272657..272968) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(272976..273956) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(273953..274165) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(274158..275597) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(275599..276153) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(276687..276836) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene rpmG CDS complement(277005..279044) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 279428..279637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 279663..279842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 280016..280174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(280909..281508) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 281782..282882 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ispG CDS complement(283114..283521) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(283511..284371) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(284368..285135) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(285259..286149) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(286165..287505) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 287964..288932 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene ispH CDS complement(288975..290075) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(290066..290752) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468796.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(290912..292021) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rpoD CDS complement(292039..293835) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene dnaG CDS complement(293914..294738) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(294752..295381) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001797828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 295935..297326 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(297415..298176) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene recO CDS complement(298201..299097) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene era CDS complement(299100..299504) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene cdd CDS complement(299518..299856) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(299853..300326) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene ybeY CDS complement(300328..301272) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(301419..302021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(302037..303035) product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene floA CDS complement(303052..303738) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(303935..304111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(304269..305615) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene mtaB CDS complement(305620..306372) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(306372..307307) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene prmA CDS complement(307312..308448) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene dnaJ CDS complement(308565..310388) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene dnaK CDS complement(310453..311058) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene grpE CDS complement(311105..312094) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831038.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene hrcA CDS complement(312193..313320) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene hemW CDS complement(313388..315211) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene lepA CDS 315459..315707 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene rpsT CDS complement(315834..316808) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene holA CDS complement(316877..319120) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(319117..319581) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(319654..320316) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(320369..321091) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(321091..321447) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rsfS CDS complement(321465..322028) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene yqeK CDS complement(322021..322587) product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene nadD CDS complement(322587..322880) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene yhbY CDS complement(322904..323707) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene aroE CDS complement(323719..324819) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene yqeH CDS complement(324821..325348) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(325420..326106) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene mtnN CDS complement(326276..327514) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(327518..328279) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene pxpA CDS complement(328272..329636) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(329650..330096) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(330087..331118) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(331102..331833) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene pxpB CDS 332125..332289 product epipeptide YydF family RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 332583..333545 product YydG family radical SAM peptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 333526..334293 product zinc metalloprotease LiaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene liaK CDS 334306..334941 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 334956..335678 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(335950..337332) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(337335..340367) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(340439..341356) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(341659..343395) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene thiC CDS complement(343763..344239) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene greA CDS complement(344262..344888) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene udk CDS complement(344893..346158) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(346177..347106) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(347099..347743) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(348184..348450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(348440..348661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(348969..349289) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(349303..349731) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939059.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene ruvX CDS complement(349724..349999) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(350065..352695) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene alaS CDS complement(352945..355341) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(355344..356018) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(356167..357279) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene mnmA CDS complement(357276..358424) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 358634..359641 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(359751..359942) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(360035..360454) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 360585..361850 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(361978..362748) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(362873..363766) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(363778..364740) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(364737..365726) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(365716..366729) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(366834..368552) product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(369734..371500) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene aspS CDS complement(371505..372773) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene hisS CDS complement(373185..374063) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(374060..374512) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene dtd CDS complement(374525..376714) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(376935..377453) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(377464..379749) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene recJ CDS complement(380030..382309) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene secDF CDS complement(382528..382791) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160682.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene yajC CDS complement(382807..383946) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene tgt CDS complement(383964..384989) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene queA CDS complement(385002..386000) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene ruvB CDS complement(386011..386613) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene ruvA CDS complement(386628..387071) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368902.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(387096..388385) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496100.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene obgE CDS complement(388658..388942) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene rpmA CDS complement(388953..389273) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(389277..389585) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rplU CDS complement(389705..390223) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene mreD CDS complement(390223..390897) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911041.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene mreC CDS 390860..391150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(391181..391657) product DUF4930 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 391947..392108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(392191..392874) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830861.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene radC CDS 392959..393249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(393728..394993) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(395005..397635) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 397944..398159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 note possible pseudo, frameshifted CDS 398078..398497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 note possible pseudo, frameshifted CDS complement(398503..399582) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(400165..401454) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene hemL CDS complement(401476..402450) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene hemB CDS complement(402454..403128) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(403144..404070) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene hemC CDS complement(404402..405238) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(405254..406597) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene hemA CDS complement(406722..407327) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene yihA CDS complement(407501..408763) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene clpX CDS complement(408985..410304) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene tig CDS complement(410376..411308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(411318..411929) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(412121..412477) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene rplT CDS complement(412560..412760) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene rpmI CDS complement(412786..413343) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene infC CDS complement(413515..415023) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(415360..417297) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene thrS CDS complement(417658..418581) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene dnaI CDS complement(418578..419957) product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(419957..420427) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene nrdR CDS complement(420780..421781) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene gap CDS complement(422103..422720) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene coaE CDS complement(422734..423606) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene mutM CDS complement(423624..426251) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene polA CDS complement(426370..428079) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(428080..428781) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(429011..430273) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene icd CDS complement(430321..431439) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082708.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(431867..433627) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene pyk CDS complement(433645..434616) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440192.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene pfkA CDS complement(434927..435871) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(435858..436730) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene accD CDS complement(436904..438139) product NAD-dependent malic enzyme 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(438337..441528) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(441562..442497) product pApA hydrolase Pde2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene pde2 CDS complement(442509..443804) product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 444048..444461 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(444518..445207) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 445337..446392 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(446745..447860) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene ald CDS 447977..448480 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(448520..448684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(448788..451946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(452253..452408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(453098..453355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 sequence12 source 1..1621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(38..1586) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence13 source 1..1472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence15 source 1..894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence18 source 1..639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 132..207 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 212..287 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 295..370 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 378..459 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 468..542 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 550..638 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence19 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 38..126 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 148..224 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 234..308 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 327..402 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 sequence21 source 1..539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..268132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..1208 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 1230..1844 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene hisG CDS 1834..3096 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene hisD CDS 3089..4099 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 4083..4664 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene hisB CDS 4661..5236 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene hisH CDS 5229..5933 product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene hisA CDS 5930..6694 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene hisF CDS 6685..7314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 note possible pseudo, frameshifted CDS complement(8007..8261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 8371..9597 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(9653..11359) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066521.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene betA CDS complement(11414..12907) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene betB CDS 13131..13682 product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 13730..13906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(14351..15469) product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(16166..17794) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(18085..19713) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(20013..20711) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 20846..21550 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene budA CDS complement(22092..22643) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 22751..23944 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(23960..25531) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 25830..26771 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(27964..28674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(28679..29407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(29391..30311) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(30354..30596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(30985..32286) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 32491..33180 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 33275..34210 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(34272..34466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(34885..35640) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene fabG CDS complement(36154..37992) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(38255..39190) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(39339..40901) product zinc ABC transporter substrate-binding lipoprotein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene adcA CDS complement(41285..41824) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene nrdG CDS complement(41821..43671) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene nrdD CDS complement(44177..44431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(44450..46072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(46292..50764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 tRNA complement(51381..51473) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 51642..52754 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 52751..53575 product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(53720..54241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 54667..54939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(55000..56199) product autolysin/adhesin Aaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene aaa CDS complement(56653..57801) product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(57804..58700) product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 58868..60208 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(60269..61597) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(61812..62024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(62201..63010) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(63010..65637) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene ppdK CDS complement(65829..66449) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 66593..68017 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(68066..68911) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene panC CDS complement(68914..69726) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860047.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene panB CDS 69856..70713 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(71130..72323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(72913..73371) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(73462..73644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(74311..75969) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene argS CDS complement(76061..77050) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene add CDS complement(77254..77439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(77436..77606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(77747..78166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(78229..78552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 79266..79424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 79650..79886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 79949..81385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 81378..81683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 81798..83081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 83078..84001 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 84014..84814 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(85448..85684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(85739..85942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(86530..87522) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(87907..89448) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene guaA CDS complement(89470..90936) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene guaB CDS complement(90970..92238) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(92235..92819) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene xpt CDS 93275..93682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 93809..94471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 94583..95182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 95555..96655 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene thiO CDS 96737..98128 product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(98183..98938) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 99072..99848 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 100189..100758 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene ahpC CDS 100773..102296 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene ahpF CDS complement(103002..103208) product DUF6007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(103224..103667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(103607..104275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(104381..105331) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 105502..106320 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(106781..107770) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene bioB CDS 108002..109039 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 109020..109679 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 109699..110541 product dipeptide ABC transporter glycylmethionine-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene gmpC CDS complement(110612..111970) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(111990..112274) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699538.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(112276..112716) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(112717..114663) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 114858..117158 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 117355..118746 product multidrug efflux MFS transporter NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene norC CDS 118763..119938 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(120184..121578) product multidrug efflux MFS transporter NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene norC CDS complement(122775..123983) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(124460..124702) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene rpsR CDS complement(124754..125263) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene ssb CDS complement(125289..125585) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene rpsF CDS 126152..126667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 126684..126869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(127070..128167) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene ychF CDS complement(128167..128379) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831361.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(128400..129287) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(129317..130132) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485220.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 130702..131805 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 131802..132977 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 132931..134775 product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 134772..136997 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene metE CDS 137328..138071 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(138761..139171) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(139168..139389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(139744..140622) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 140726..142123 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(142613..143470) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene noc CDS complement(143498..144217) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene rsmG CDS complement(144218..146092) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene mnmG CDS complement(146110..147492) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene mnmE CDS complement(147638..147985) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene rnpA CDS complement(148172..148309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 148911..150251 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene dnaA CDS 150428..151561 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene dnaN CDS 151710..152402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 152618..152839 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene yaaA CDS 152836..153951 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene recF CDS 153964..155895 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene gyrB CDS 155932..158514 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene gyrA CDS complement(158585..159397) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 159612..161114 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene hutH CDS 161444..162724 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene serS CDS 163075..163767 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 163764..164093 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 164656..165621 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 165857..166762 product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 166774..168741 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 168738..169184 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene rplI CDS 169318..170718 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene dnaB CDS 171006..172292 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(172640..173533) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 tRNA 173639..173713 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 173720..173794 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(174055..174195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 174464..175165 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene yycF CDS 175181..177013 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene walK CDS 177003..178340 product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene yycH CDS 178337..179116 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene yycI CDS 179139..179921 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002447628.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 180278..180757 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene rlmH CDS complement(180857..181027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 181165..181632 product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711815.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 181880..183115 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485355.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene arcA CDS 183208..184629 product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene arcD CDS 184669..185364 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 185383..186381 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene argF CDS 186401..187330 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene arcC CDS complement(187498..188250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 188340..188630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(188761..188931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(189041..189220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(189300..189497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(189509..190552) product acyl-CoA/acyl-ACP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(190567..191325) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(191331..192290) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(192304..193044) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(193148..193660) product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 194504..195031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 195035..195172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(195637..196278) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene pcp CDS complement(196302..197228) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(197225..197923) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 198340..198657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 198697..199326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 note possible pseudo, frameshifted CDS 199293..199505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 199666..200121 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 200134..200523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(200738..202789) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene helD CDS 203673..204722 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 204740..205405 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911017.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(205463..206632) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 206855..207055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 207130..207819 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 207984..208499 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(208732..208869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(209388..210206) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990045.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(210264..211700) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene bglA CDS complement(211718..213613) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 213740..214444 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 214836..215630 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 215638..217527 product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 217529..217984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 217985..218539 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 218546..219562 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 219580..219927 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(220113..221150) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(221560..223011) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(223023..224453) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(224471..226402) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(226654..227478) product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene licT CDS 227791..230589 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103208866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 230747..231283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 231285..232859 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 232849..234015 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 234035..235582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 235622..236419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 236627..236788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 237029..240736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 240861..241070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 241116..241238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(241371..241646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 241711..242208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 242279..242434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(242509..243747) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(243860..245464) product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 245601..247052 product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387337.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 247049..248416 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene allB CDS complement(248465..249706) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(249706..250494) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 250673..251896 product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene allC CDS 251913..252704 product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene allE CDS 252720..253736 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene allD CDS 253764..254813 product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene allD CDS 254830..256581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 note possible pseudo, internal stop codon, frameshifted CDS 256581..257846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 note possible pseudo, internal stop codon, frameshifted CDS 257843..258592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 258605..259540 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene arcC CDS complement(259760..260107) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(260120..261073) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 261328..261663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 261755..261955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(261923..263068) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 263310..263474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(263695..264567) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 264772..265509 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 265858..266565 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene deoD CDS 266578..267933 product tetracycline efflux MFS transporter Tet(38) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene tet(38) sequence23 source 1..242873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(749..1813) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958531.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1767..1976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1998..3452) product multidrug efflux MFS transporter LmrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene lmrS CDS complement(3534..3989) product SepA family multidrug efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(4028..5353) product multidrug efflux MFS transporter SdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene sdrM CDS complement(5487..6182) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(6193..7383) product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(7481..7993) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 8175..8435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(8627..9382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(9502..9627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(9685..10155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(10163..10600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(10926..11753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(12077..12439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 note possible pseudo, internal stop codon, frameshifted CDS complement(12532..12882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 note possible pseudo, internal stop codon, frameshifted CDS complement(13351..14193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(14124..14543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(14548..15450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(15463..15783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(15903..16223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(16331..17701) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(17887..18849) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(18846..19871) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(19906..20886) product Fe(3+) dicitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832728.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(20957..22030) product staphyloferrin A biosynthesis protein SfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene sfaC CDS complement(22030..23799) product staphyloferrin A synthetase SfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene sfaB CDS complement(23777..24964) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 25076..27037 product D-ornithine--citrate ligase SfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene sfaD CDS 27350..28522 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026189.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(28811..29296) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(29361..29606) product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(29619..30161) product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene amaP CDS 30878..31303 product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 31403..31864 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 31839..32522 product response regulator transcription factor SaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene saeR CDS 32523..33551 product two-component system sensor histidine kinase SaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene saeS CDS complement(33790..34518) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(34515..35234) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(35215..35997) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825921.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(36388..36780) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001790547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene rpsI CDS complement(36800..37237) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene rplM CDS complement(37445..38251) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene truA CDS complement(38267..39070) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(39060..39926) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(39923..40732) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 40959..41195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(41123..41491) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene rplQ CDS complement(41508..42452) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829787.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(42529..42918) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene rpsK CDS complement(42943..43308) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene rpsM CDS complement(43476..43694) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene infA CDS complement(43859..44509) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(44527..45819) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene secY CDS complement(45819..46259) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829796.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene rplO CDS complement(46276..46455) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene rpmD CDS complement(46472..46972) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene rpsE CDS complement(46993..47352) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene rplR CDS complement(47383..47919) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rplF CDS complement(47948..48346) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene rpsH CDS complement(48378..48563) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829713.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(48585..49124) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene rplE CDS complement(49149..49466) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rplX CDS complement(49506..49874) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene rplN CDS complement(49905..50168) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene rpsQ CDS complement(50193..50402) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene rpmC CDS complement(50392..50826) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene rplP CDS complement(50829..51482) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rpsC CDS complement(51507..51860) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene rplV CDS complement(51893..52171) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene rpsS CDS complement(52236..53069) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene rplB CDS complement(53101..53376) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388082.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rplW CDS complement(53376..53996) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rplD CDS complement(54023..54682) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rplC CDS complement(54708..55016) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene rpsJ CDS 55363..55758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(55831..57165) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800700.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(57283..59415) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838479.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(59656..60570) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 60680..60865 product SE1832 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 61010..61327 product membrane stabilizing protein MspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene mspA CDS complement(61391..62545) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(62651..65776) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(65932..67191) product lipid II:glycine glycyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene femX CDS complement(67350..68117) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 68257..68700 product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(68755..69777) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene moaA CDS complement(69799..70410) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene mobA CDS complement(70410..70643) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene moaD CDS complement(70640..71095) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(71106..71576) product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene mobB CDS complement(71573..72832) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 72901..73377 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene moaC CDS complement(73487..73987) product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(74009..75013) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(75401..76006) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(76007..76678) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113093.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene modB CDS complement(76690..77454) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene modA CDS 77797..78624 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene fdhD CDS complement(78683..79432) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438495.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(79455..80015) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(80118..80981) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(80962..81636) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 81893..82774 product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 82959..84476 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(85093..86010) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(86201..86581) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(86955..88112) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(88523..88870) product SarA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(89399..90451) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(90924..91262) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832425.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(91476..92552) product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 92772..93137 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 93295..94248 product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417018.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(94341..95468) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(95479..96261) product N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(96280..96531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(96665..97129) product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840811.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(97129..100065) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene fdhF CDS complement(100444..101397) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830043.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(101547..102332) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(102353..103042) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(103407..104153) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 104289..104633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(104699..106087) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 106587..107321 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 107378..107716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 107718..107894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(107950..108129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(108126..108770) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(109206..110048) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(110120..110392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(110674..111624) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 111840..112367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(112404..112910) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(112993..114291) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(114391..115524) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(115674..115877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(116168..117403) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene hutI CDS complement(117403..119070) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene hutU CDS complement(119090..120235) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 120644..121555 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(121755..122684) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene hutG CDS 123123..124157 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(124221..124904) product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(124916..125119) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(125191..126198) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(126224..126556) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(126691..127953) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(127946..128845) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(128926..129441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(129431..129934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(129936..130139) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(130316..131029) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 131170..131778 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(131821..132636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(132633..133193) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(133190..133510) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831459.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(133643..134374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 134512..135360 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 135798..137009 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene gltS CDS complement(137071..138267) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 138390..138866 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(138925..139851) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(140131..141162) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(141634..141804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(141794..142843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(143627..144529) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 144794..145444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(145611..146300) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene tenA CDS complement(146393..147790) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833794.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(147863..148345) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(148771..149442) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229920.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(149439..150503) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 150678..151355 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 151348..152718 product heme sensor histidine kinase HssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene hssS CDS complement(152795..154288) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene mqo CDS 154734..155909 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 156518..156943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 156962..157150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(157351..158955) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(159251..159883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(159968..160513) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 160644..161636 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 161788..162813 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(163095..163517) product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(163649..164260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(164281..165528) product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(165676..166884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 note possible pseudo, internal stop codon CDS complement(166954..167337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 note possible pseudo, internal stop codon CDS 167702..168640 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(168707..170155) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 170748..172871 product AraC family transcriptional regulator Rsp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rsp CDS complement(172903..174105) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 174416..174763 product DUF4889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516798.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(174826..175728) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(175868..176941) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(177223..177579) product DUF3139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 177771..179366 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(179433..180593) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 181104..182591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 182606..183178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(183295..183945) product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene nreC CDS complement(183959..184999) product nitrate respiration regulation sensor histidine kinase NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene nreB CDS complement(184996..185460) product nitrate respiration regulation accessory nitrate sensor NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene nreA CDS complement(185476..186153) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene narI CDS complement(186146..186721) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene narJ CDS complement(186714..188267) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene narH CDS complement(188257..191928) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 192179..192733 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 192996..193415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 note possible pseudo, internal stop codon CDS complement(193758..195527) product LPXTG-anchored adenosine synthase AdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene adsA note possible pseudo, frameshifted CDS complement(195551..195961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 note possible pseudo, frameshifted CDS complement(196226..197170) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene cobA CDS complement(197161..197475) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene nirD CDS complement(197475..199880) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene nirB CDS complement(199873..200334) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(200306..201055) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(201219..201761) product N-acetyltransferase SnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene snaA CDS 202077..202892 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484951.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(202942..203124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 203454..204980 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 205987..207018 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 207033..207710 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene sdaAB CDS 207729..208628 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460421.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene sdaAA CDS 208916..209173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(209460..210656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(211515..212657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 212975..215224 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene pflB CDS 215348..216109 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446860.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene pflA CDS complement(216206..217276) product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(217908..218462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(218468..219613) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(220057..220641) product class A sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene srtA CDS complement(220929..222200) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 222667..224622 product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 225281..226663 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(226721..228511) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(228495..230285) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(230494..232116) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(232210..232944) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene trpA CDS complement(232937..234154) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene trpB CDS complement(234151..234783) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(234784..235566) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene trpC CDS complement(235550..236566) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene trpD CDS complement(236550..237134) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(237131..238534) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 239152..240132 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(240673..241716) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 misc_feature complement(242080..>242873) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147473.1:Ig-like domain-containing protein locus_tag LOCUS_12130 sequence24 source 1..242813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 835..1011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1273..1404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1576..1767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1946..3256) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 3431..4309 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 4306..5040 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 5043..6146 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 6146..6748 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(6799..7251) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 7383..8996 product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene bshC CDS 9141..9572 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene mraZ CDS 9591..10526 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene rsmH CDS 10545..10934 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene ftsL CDS 10909..13059 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 13550..14515 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene mraY CDS 14516..15865 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene murD CDS 15879..16775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 17123..18505 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene ftsA CDS 18535..19701 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene ftsZ CDS 19874..20695 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene pgeF CDS 20685..21359 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 21364..21924 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 21935..22225 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 22373..23104 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232511.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 23130..23738 product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 23928..26675 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene ileS CDS 27056..27541 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene lspA CDS 27545..28462 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 28865..29389 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene pyrR CDS 29589..30881 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830174.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 30900..31781 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830068.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 31796..33073 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 33073..34173 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 34166..37339 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene carB CDS 37351..38118 product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene pyrK CDS 38115..39035 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016381.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 39036..39731 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene pyrF CDS 39731..40339 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene pyrE CDS complement(40407..40817) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(41015..42718) product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 42899..43522 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene gmk CDS 43522..43731 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene rpoZ CDS 43896..45089 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene coaBC CDS 45086..47494 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560839.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene priA CDS complement(47870..56827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 57143..57631 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 57624..58559 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene fmt CDS 58556..59860 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rsmB CDS 59862..60956 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830070.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene rlmN CDS 60963..61706 product protein-serine/threonine phosphatase Stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 61703..63751 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene pknB CDS complement(63848..64762) product serine protease SplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene splA CDS complement(64894..66945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(66982..67857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 68213..69088 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene rsgA CDS 69088..69738 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene rpe CDS 69744..70394 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 70688..70888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 71180..71758 product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 71755..72486 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676089.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 72479..73933 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 73963..75717 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 75752..77485 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 77489..77617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(77625..77813) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene rpmB CDS 78199..78573 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 78586..80253 product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene fakA CDS 80406..81071 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene sdaAB CDS 81085..81954 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene sdaAA CDS 81957..84002 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene recG CDS 84156..84716 product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830099.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene fapR CDS 84718..85704 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene plsX CDS 85697..86623 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene fabD CDS 86616..87353 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene fabG CDS 87537..87770 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426914.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 87931..88662 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene rnc CDS 88666..92235 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene smc CDS 92237..93445 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene ftsY CDS 93432..93764 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 93778..95145 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene ffh CDS 95277..95552 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene rpsP CDS 95650..96153 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene rimM CDS 96150..96872 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene trmD CDS 96990..97340 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene rplS CDS 97550..98308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 98332..99531 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 99913..100593 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 100583..101737 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831769.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 101925..102341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(102545..105118) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(105151..105588) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(105874..106773) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 106898..107497 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 107516..107884 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 108191..109072 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene ylqF CDS 109059..109841 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 110064..110333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 110567..111733 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene sucC CDS 111754..112662 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene sucD CDS 112912..113793 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene dprA CDS 113899..115968 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829508.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene topA CDS 115993..117300 product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene trmFO CDS 117418..118308 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456225.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene xerC CDS 118316..118858 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene hslV CDS 118875..120284 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene hslU CDS 120299..121072 product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene codY CDS 121238..122020 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene rpsB CDS 122108..122986 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene tsf CDS 123142..123864 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene pyrH CDS 123883..124437 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene frr CDS 124793..125554 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 125569..126351 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 126369..127499 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene dxr CDS 127506..128786 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene rseP CDS 128812..130515 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 130737..135047 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 135171..135638 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene rimP CDS 135660..136835 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene nusA CDS 136847..137134 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 137131..137442 product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 137454..139550 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene infB CDS complement(139718..140242) product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(140512..141201) product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439671.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(141215..141973) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(141966..142787) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(142787..143761) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(143758..145236) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 145667..145969 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 145983..146396 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 146393..148108 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene ureC CDS 148120..148572 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832382.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene ureE CDS 148565..149254 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 149266..149880 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002477667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ureG CDS 149880..150722 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 150925..151269 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene rbfA CDS 151373..152290 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene truB CDS 152307..153278 product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene ribF CDS 153383..153652 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene rpsO CDS 153815..155908 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene pnp CDS 156253..157926 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 158066..160417 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 160420..161136 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 161163..162428 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 162421..163710 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664775.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 163707..164408 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439542.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 164456..165292 product YmfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 165309..165704 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 165744..166328 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene pgsA CDS 166671..167828 product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 168025..169074 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene recA CDS 169381..170940 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829512.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene rny CDS 171069..171443 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 171433..173583 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 173915..174712 product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 174828..176588 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804320.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 176589..177455 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 177764..179317 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene miaB CDS 179317..179706 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 179790..180302 product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene thiW CDS 180397..183006 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene mutS CDS 183018..184964 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene mutL CDS 184989..185522 product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 185785..186600 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 186648..188153 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene glpK CDS 188273..189943 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 190171..191091 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 191114..192070 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene miaA CDS 192063..192269 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene hfq CDS complement(192584..193057) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 193166..194404 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene hflX CDS 194412..195656 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 196338..196706 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 196730..198070 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene glnA CDS complement(198178..199305) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(199517..200044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(200058..200513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(200526..200870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 201046..201285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 201299..202084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 202095..202316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 202330..202554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(202544..202909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 202958..203236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 203238..203414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 203418..203660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 203742..204092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 204089..205255 product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 205277..205831 product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 205886..207847 product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 207862..208032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 208035..210482 product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 210839..211120 product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 211120..212484 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 212487..213200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 213214..213621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 213614..213832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 213825..214028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 214030..214407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 214391..214822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 214824..215282 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 215285..215686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 215679..216002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 215999..216238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 216228..216776 product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 216816..216959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 216964..217122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 217122..217430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 217423..217599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 217613..218059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 218247..218567 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 218689..218994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 218972..220675 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 220679..221947 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 221898..222671 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 222684..223829 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 223923..224201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 224214..224546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 224537..224971 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 224968..225375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 225387..226004 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 226086..226259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 226265..226627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 226663..226830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 226874..232759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 232788..234302 product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 234329..238489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 238479..238634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 238670..238960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 238960..239436 product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 239477..239782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 239796..241184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(241217..241441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 241875..242081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 242071..242619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 sequence25 source 1..225953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1040..2110) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 2445..3485 product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(3545..4786) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(5106..6224) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(6342..6662) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene ytxJ CDS complement(6892..7767) product EMYY motif lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 7888..8403 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 8496..9431 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene murB CDS complement(9701..9922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(10024..10992) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829597.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene nrdF CDS complement(11360..13465) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene nrdE CDS complement(13419..13826) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene nrdI CDS 14464..15345 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 15366..15866 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene queF CDS 16031..17542 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(17769..18296) product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(18376..19425) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663030.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene hisC CDS complement(19689..21206) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(21203..22159) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(22452..24230) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene recQ CDS complement(24241..26118) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(26370..28304) product polyglycerol-phosphate lipoteichoic acid synthase LtaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098285.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene ltaS CDS complement(28966..29973) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(29970..30650) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(30665..30880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(30899..31501) product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(31507..32652) product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(32636..33229) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 33608..34273 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene queC CDS 34273..34701 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene queD CDS 34702..35418 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene queE CDS 35499..36197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(36529..36783) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(36847..37446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(37644..38669) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(38906..40252) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(40561..42468) product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(42470..43393) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438878.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene pfkB CDS complement(43396..44145) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(44383..44862) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene ybaK CDS complement(44885..47197) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(47316..48473) product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene norA CDS 48649..49356 product CPBP family intramembrane metalloprotease SdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene sdpB CDS complement(49414..50352) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene mdh CDS complement(50498..50779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(50817..51725) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(51803..52726) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 52952..53398 product HTH-type transcriptional regulator MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene mgrA CDS 53590..54441 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 54585..55295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832119.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 55298..55780 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 55923..56495 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(56746..57045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(57134..57433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 57626..58309 product DUF1129 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(58377..58871) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(58899..60104) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(60168..61055) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(61186..61752) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(61893..62366) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(62385..63098) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(63175..64176) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene thiF CDS complement(64176..64943) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(64945..65148) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene thiS CDS complement(65150..65746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(65697..65915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(66020..66646) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 66910..67755 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(68055..69053) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(69067..69684) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(69992..71893) product peptide resistance ABC transporter permease subunit VraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143647.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene vraE CDS complement(71883..72644) product peptide resistance ABC transporter ATP-binding subunit VraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene vraD CDS complement(72749..73771) product histidine kinase GraS/ApsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene graS CDS complement(73758..74438) product response regulator transcription factor GraR/ApsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene graR CDS complement(74998..76065) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(76442..77875) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(78063..78563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832127.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(78674..79690) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(79687..80688) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(80713..81516) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080809.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(81736..82569) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(83108..84337) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002493541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 84698..84934 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 84927..86921 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene feoB CDS 86935..87093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(87254..88984) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 89176..90447 product penicillin-binding protein PBP4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene pbp4 CDS complement(90501..90899) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene tagD CDS complement(90985..92082) product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(92166..92969) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 93244..94038 product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832071.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene tagH CDS 94103..94519 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(94584..95360) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 95548..96291 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(96356..97009) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 97130..97909 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 97884..98723 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 98720..99649 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(99713..100147) product Na+/H+ antiporter Mnh2 subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene mnhG2 CDS complement(100122..100424) product Na+/H+ antiporter Mnh2 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene mnhF2 CDS complement(100421..100903) product Na+/H+ antiporter Mnh2 subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene mnhE2 CDS complement(100904..102403) product Na+/H+ antiporter Mnh2 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene mnhD2 CDS complement(102393..102740) product Na+/H+ antiporter Mnh2 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene mnhC2 CDS complement(102737..103162) product Na+/H+ antiporter Mnh2 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene mnhB2 CDS complement(103149..105530) product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(105553..106107) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 106343..106549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 106564..106779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(106829..107062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 107256..108191 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 108420..109328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 109868..110239 product global transcriptional regulator SarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832055.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene sarA CDS complement(110293..111012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(111245..111751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(111845..112645) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362976.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(112632..113348) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(113393..114301) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(114348..115223) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(115254..116912) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene argS CDS complement(116914..117324) product DUF1934 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(117453..117962) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(117992..119290) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438750.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(119315..119797) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(119864..120412) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633782.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(120579..120917) product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832090.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(121035..122579) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(122752..123222) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(123239..123994) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(124010..125368) product serine/threonine exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene steT CDS complement(125633..126394) product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 126556..127545 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene pta CDS 127545..128387 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832052.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(128722..129894) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(130075..131805) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(131822..132469) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 132590..133147 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(133507..134361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(134512..135114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(135312..136763) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(137113..137475) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(137490..137801) product DUF5327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(137806..138462) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 138619..139449 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene thiD CDS complement(139498..140697) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(140917..141186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(141604..142308) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(142421..142678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(142678..143034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(142988..144148) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(144145..145503) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(145879..146037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(146196..147662) product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene msr(C) CDS complement(147702..149282) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 149796..149972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 149975..150256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(150514..151245) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene nagB CDS complement(151256..151924) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936718.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(151940..153421) product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene ptsG CDS 153590..154399 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667382.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 154504..154872 product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557152.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 154891..155568 product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene bshB2 CDS 155616..156497 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene folE2 CDS complement(157383..159197) product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene uidA CDS complement(159217..160059) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(160072..161118) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene uxuA CDS complement(161121..162533) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene uxaC CDS complement(162548..163951) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(163969..164979) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(164984..165625) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(166012..167229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 167349..168113 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 168127..169851 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 170483..171049 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene lepB CDS complement(171153..171719) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(171737..172606) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(172743..173219) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene tadA CDS 173285..173908 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 173895..174557 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(174616..177192) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(177474..180053) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(180301..180984) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(181213..181404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(181649..182704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(182948..184030) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(184209..185159) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(185324..185467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(185535..186725) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 186838..188004 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494717.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(188583..189770) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene tuf CDS complement(189924..192005) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene fusA CDS complement(192147..192617) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene rpsG CDS complement(192687..193100) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rpsL CDS complement(193195..193449) product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(193638..197255) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene rpoC CDS complement(197391..200945) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene rpoB CDS complement(201155..201763) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494716.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(201973..202338) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rplL CDS complement(202385..202885) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene rplJ CDS complement(203176..203871) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene rplA CDS complement(204062..204484) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene rplK CDS complement(204650..205198) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene nusG CDS complement(205218..205397) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene secE CDS complement(205618..206133) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(206279..206803) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(206804..207553) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rlmB CDS complement(207557..207934) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(207951..209351) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene cysS CDS complement(209335..209976) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene cysE CDS complement(210283..211737) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283792.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene gltX CDS complement(211896..212378) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene ispF CDS complement(212382..213068) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene ispD CDS complement(213184..214548) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene radA CDS complement(214704..217151) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(217167..218171) product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(218161..218694) product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(218715..219176) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 219343..220548 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(220778..221335) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene pdxT CDS complement(221337..222224) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene pdxS CDS 222323..223720 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830028.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(223774..225702) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 rRNA complement(225768..225876) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 sequence26 source 1..165323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 3395..3790 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene spxA CDS 4188..4892 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene mecA CDS 4999..5958 product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 6032..7843 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene pepF CDS complement(8447..10366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(10607..12625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(13018..13806) product protease adaptor protein YjbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene yjbH CDS complement(13823..14194) product truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(14549..15136) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 15268..15615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 15632..16273 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 16276..17085 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 17082..17936 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 17955..19340 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene mgtE CDS 19352..21181 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395153.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(21476..22246) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene fabI CDS complement(22397..23482) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 24141..25721 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 25801..26538 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288675.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 26589..27098 product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(27140..28324) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(28302..29477) product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002475762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 29960..31444 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 31434..31673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 31694..33256 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 33588..34379 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 34764..36398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 36417..37775 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 37925..39433 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 39646..39807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 39898..40302 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 40622..40819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(40916..41512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 41818..42072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 note possible pseudo, internal stop codon, frameshifted CDS 42144..42452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 note possible pseudo, internal stop codon, frameshifted CDS 42743..42877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 43052..43261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 tRNA complement(43488..43578) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(43579..43653) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(43937..44581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 44801..45019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(45095..46087) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 46282..46467 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 46474..47076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 47567..48133 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620949.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 48134..48784 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 48781..49539 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene fetB CDS complement(49594..50532) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 50709..52064 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 52057..53730 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene menD CDS 53717..54508 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene menH CDS 54528..55343 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene menB CDS complement(55409..56575) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 57108..58910 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(59177..63031) product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074534.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(63210..63650) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(63790..64272) product osmotic stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(64291..65454) product polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 65680..66315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(66462..67607) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 67805..68134 product DUF5011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037831.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 68577..69680 product cytochrome aa3 quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene qoxA CDS 69680..71668 product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene qoxB CDS 71661..72269 product cytochrome aa3 quinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene qoxC CDS 72266..72556 product cytochrome aa3 quinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene qoxD CDS complement(73043..73900) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene folD CDS 74130..74594 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene purE CDS 74581..75708 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene purK CDS 75710..76411 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 76415..76675 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene purS CDS 76677..77348 product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene purQ CDS 77341..79530 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467589.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene purL CDS 79509..80930 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene purF CDS 80934..81962 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene purM CDS 81965..82531 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene purN CDS 82547..84025 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709277.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene purH CDS 84044..85285 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485333.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene purD CDS complement(85410..86201) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(86194..87600) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(87615..88190) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(88504..88635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 89097..90422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 90601..91773 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 91828..92358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 92511..92777 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437472.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 92777..94504 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene ptsP CDS complement(94545..94772) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289618.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene nrdH CDS 94989..95651 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(95720..97402) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(97402..97617) product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(98176..98727) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene def CDS 98894..99526 product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 99685..100794 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035320.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene pdhA CDS 100798..101775 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 101968..103260 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 103264..104670 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260117.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene lpdA CDS 104758..105030 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833064.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 105163..105702 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020625.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 105714..106814 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 106801..107607 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 107604..108413 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103388157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 108413..109483 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819684.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 109543..110571 product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 110718..111191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(111263..111874) product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831689.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 111990..112805 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(112889..113074) product DUF5325 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810620.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 113172..115019 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene typA CDS 115218..116342 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(116368..116556) product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(116560..117042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 117179..117454 product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 117562..118785 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 119391..122843 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 123094..123495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 123624..123989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(124178..125086) product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470218.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 125344..126255 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene cyoE CDS 126281..126742 product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 126888..127640 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(127912..129312) product PTS glucitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(129356..129658) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(129701..130192) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357187.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 130439..130867 product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene lacA CDS 130888..131403 product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene lacB CDS 131416..132342 product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262465.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene lacC CDS 132358..133335 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene lacD CDS 133634..134701 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 134691..135131 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(135178..136104) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830132.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 136202..136453 product DUF2129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(136454..136843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 136904..137455 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene rsmD CDS 137448..137942 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene coaD CDS complement(137990..139123) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 139250..139789 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872158.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 139840..140013 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene rpmF CDS 140145..140891 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 141243..142307 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene pheS CDS 142301..144706 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene pheT CDS complement(145781..146716) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene rnhC CDS 146870..147136 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830081.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene zapA CDS 147138..147656 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830147.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 147845..149557 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161938.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene polX CDS 149574..151922 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249275.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 151999..152313 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene trxA CDS 152502..154289 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene uvrC CDS 154459..155070 product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 155104..156870 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene sdhA CDS 156870..157679 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene sdhB CDS 158040..158837 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039659.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene racE CDS 158850..159431 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 159434..159934 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(160234..160692) product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125705.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 tRNA 160896..160969 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(161032..162081) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096810449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 162220..162396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(162379..163350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(163373..164104) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 164536..164757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 sequence27 source 1..115049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..1904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 2392..3384 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene trpS CDS complement(3445..3993) product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(3993..4157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(4102..5766) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(5787..6725) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786734.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(6726..7799) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(7833..8894) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(8894..9820) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521533.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 10071..10448 product DUF3899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915157.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(10492..11739) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081231.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene fabF CDS complement(11757..12698) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 12847..13041 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(13091..13987) product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469251.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(14175..14798) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(14791..16842) product DUF1430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(17405..20017) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene clpB CDS complement(20407..22224) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829283.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(22380..22688) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 22800..23618 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 23643..24968 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(25025..25414) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(25565..26467) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(26550..30188) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054828577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene addA CDS complement(30185..33652) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene addB CDS complement(33899..34477) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene lepB CDS complement(34940..36271) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 36464..37666 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 37659..39032 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831901.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene argH CDS complement(39117..39278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 39528..40466 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(40519..41763) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(41868..43070) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(43231..44775) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene pruA CDS 45248..45637 product S1 domain-containing post-transcriptional regulator Ygs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene ygs CDS complement(45807..46067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(46090..46686) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 46759..47139 product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 47270..49687 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 49668..50096 product Na+/H+ antiporter Mnh1 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081626.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene mnhB1 CDS 50096..50443 product Na+/H+ antiporter Mnh1 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene mnhC1 CDS 50433..51932 product Na+/H+ antiporter Mnh1 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene mnhD1 CDS 51934..52422 product Na+/H+ antiporter Mnh1 subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene mnhE1 CDS 52412..52705 product Na+/H+ antiporter Mnh1 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene mnhF1 CDS 52683..53039 product Na+/H+ antiporter Mnh1 subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831900.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene mnhG1 CDS complement(53322..53696) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(53721..55034) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(55375..56847) product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(57033..58235) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(58568..58927) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(58940..59176) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 59585..60649 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(60702..60944) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 61048..61383 product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(61436..62401) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468866.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(62406..63191) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(63195..63626) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 63725..63991 product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(64079..64453) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(64472..65389) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene lipA CDS complement(65475..66794) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(66811..67635) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(67648..68496) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(68951..69949) product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(70364..71128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(71225..71554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 72080..72859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(73009..73734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(73780..74439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(74581..75978) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene sufB CDS complement(76045..76503) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(76493..77734) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006450.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(77763..79070) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene sufD CDS complement(79098..79865) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene sufC CDS 80168..81016 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(81076..81279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(81423..81956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(81956..83158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(83432..84253) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732324.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(84370..85188) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732324.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(85212..85907) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(85900..86928) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(87177..87491) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831936.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(87621..88001) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene gcvH CDS complement(88071..88424) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589549.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 88617..88940 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(88996..89544) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(89599..90330) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene aroD CDS complement(90340..91344) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 91484..91903 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(91968..92732) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 tmRNA complement(93711..94069) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(94143..94607) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene smpB CDS complement(94624..96969) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene rnr CDS complement(97013..97753) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(97855..98088) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene secG CDS complement(98157..98624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(98825..98965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(98997..100301) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene eno CDS complement(100457..101974) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene gpmI CDS complement(101976..102737) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260089.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene tpiA CDS complement(102929..104119) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(104318..105325) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene gap CDS complement(105354..106382) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 106663..106872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(107240..107863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 108274..109179 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(109214..109702) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831463.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(109912..110496) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene clpP tRNA 110626..110697 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 111189..111389 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(111448..111810) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 misc_feature complement(112006..>115049) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082831.1:MSCRAMM family adhesin SdrF locus_tag LOCUS_19370 sequence28 source 1..106855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2614..3798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(4027..8865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(10034..10285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 note possible pseudo, frameshifted CDS complement(10312..10605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(10605..11081) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(11436..12272) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(12307..13305) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(13388..13819) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774961.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(14284..15651) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene rlmD CDS complement(15747..16685) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(17160..18587) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene gatB CDS complement(18600..20060) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458553.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene gatA CDS complement(20063..20365) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene gatC CDS 20658..22205 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957020.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene putP CDS complement(22343..23548) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(23560..25569) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene ligA CDS complement(25570..27768) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene pcrA CDS complement(27768..28457) product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272056.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(28624..29298) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(29973..30275) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165363.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(30345..31640) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene purB CDS complement(31884..32069) product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(32050..32619) product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830398.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(32684..33508) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene nadE CDS complement(33501..34970) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 35221..36291 product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897635.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 36307..37137 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(37187..38284) product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457082.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 38371..38922 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 38979..39905 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 39931..40209 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 40276..41655 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 42307..43515 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(43565..43765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 note possible pseudo, frameshifted CDS complement(43984..44433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(44430..44645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(44842..45021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(45079..45381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(45386..46777) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024933635.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(46767..47456) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(47683..47820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(47792..47920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 48115..48816 product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(49186..49521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 49552..50289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(50382..50549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 50931..51092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(51573..52613) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468109.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(52686..52859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830431.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 53046..53435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 53856..54035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(54475..55320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(55323..55880) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830393.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(56057..57418) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481425.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(57428..58978) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene gntK CDS complement(58991..59674) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(60042..60770) product phenol-soluble modulin export ABC transporter permease subunit PmtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221651.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene pmtD CDS complement(60767..61642) product phenol-soluble modulin export ABC transporter ATP-binding protein PmtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene pmtC CDS complement(61657..62307) product phenol-soluble modulin export ABC transporter permease subunit PmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494112.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene pmtB CDS complement(62326..62946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(62924..63820) product phenol-soluble modulin export ABC transporter ATP-binding protein PmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene pmtA CDS complement(63820..64197) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(64344..64517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 64687..65976 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 66066..66578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 66805..67755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(67986..69080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(69073..70326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(70356..70529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 70521..70745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(70815..72008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(72013..72270) product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360471.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(72652..74271) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240642.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene groL CDS complement(74315..74602) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene groES CDS 74777..75517 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(75585..76601) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene adhP CDS complement(76858..77814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 78113..78910 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 79711..80280 product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830005.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 80280..80417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 80671..81744 product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 81757..82473 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(82524..83480) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(83473..84966) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(84985..85971) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790331.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(86321..86467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(86576..86800) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830019.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(86822..87904) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(88671..89321) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 89475..91430 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene abc-f CDS complement(92116..93132) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene tsaD CDS complement(93125..93595) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene rimI CDS complement(93562..94230) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene tsaB CDS complement(94223..94672) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene tsaE CDS 95151..96839 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene ilvD CDS 96866..98602 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene ilvB CDS 98599..99072 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene ilvN CDS 99119..100123 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene ilvC CDS 100212..101747 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 101744..102793 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene leuB CDS 102796..104169 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832489.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene leuC CDS 104169..104738 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718953.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene leuD CDS 104751..106019 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene ilvA CDS complement(106084..106443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(106422..106562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 rRNA complement(106670..106778) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 sequence29 source 1..88751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 134..208 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 213..285 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 290..365 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 387..470 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA 475..549 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA 553..626 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 1254..2159 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene rocF CDS 2241..3047 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene cdaA CDS 3048..3980 product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894032.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 4003..5352 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene glmM CDS complement(5646..6749) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648723.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(6749..7183) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(7197..9236) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(9606..11123) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 11719..13521 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334463.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene glmS CDS 13611..14399 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908182.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 14468..15331 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370925.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(15394..16260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 16559..17257 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 17316..17549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 17648..19012 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 19642..21072 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene nhaC CDS complement(21047..21235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 21275..21658 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 21673..22563 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rbsK CDS complement(22635..23345) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene deoD CDS 23701..25002 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 25016..25369 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(25483..25956) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 26334..27518 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 27515..28714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 28845..29516 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(29570..30367) product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene coaW CDS 30995..31855 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 32003..32539 product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene rpoE CDS 32866..34473 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 34685..36043 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene glpT CDS complement(36192..36713) product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036002.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 36944..37816 product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 38313..39575 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485257.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 39610..39939 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 40140..41567 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 41834..43159 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115101.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene rho CDS 43281..43535 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829959.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 43704..44306 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 44306..45382 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene prfA CDS 45369..46217 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440566.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene prmC CDS 46303..47349 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829923.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 47349..47774 product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 47883..48413 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 48431..49672 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 49691..50320 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene upp CDS 50344..51483 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829933.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene wecB CDS 51640..51990 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801792.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 note possible pseudo, frameshifted CDS 52028..52747 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene atpB CDS 52792..53004 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene atpE CDS 53157..53672 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 53672..54211 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829963.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 54238..55749 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene atpA CDS 55781..56647 product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene atpG CDS 56671..58083 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene atpD CDS 58106..58510 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094394.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 58651..58881 product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 59341..60606 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358006.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene murA CDS 60702..61142 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene fabZ CDS complement(61216..61650) product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 61840..62193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 62687..63493 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832736.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene thiD CDS 63484..64299 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene thiM CDS 64289..64927 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene thiE CDS 65016..65882 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene yidC CDS complement(65940..66590) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(66611..68101) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene cls CDS 68243..68530 product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene csoR CDS 68543..68764 product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581792.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 68766..68972 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene copZ CDS 69092..71269 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene copA CDS 71355..71495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(71567..72772) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002486299.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 72929..74002 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159631.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 74013..75374 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611464.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 75637..77124 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485310.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 77520..77987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 77980..79476 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 79469..80038 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457109.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 80044..80397 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene acpS CDS 80462..81610 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene alr CDS 81700..81870 product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene mazE CDS 81871..82224 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621175.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 82615..83619 product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829902.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 83698..84024 product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829952.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 84026..84508 product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011447044.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene rsbW CDS 84480..85250 product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440602.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene sigB CDS 85434..87587 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 87580..88035 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 tRNA 88356..88438 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 88472..88545 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550