COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..62426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(170..244) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(253..326) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(373..456) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(555..806) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(997..2400) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2862..4133) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(4123..6252) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(6256..6852) product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(6818..8077) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene rsmB CDS complement(8074..8877) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene fmt CDS complement(9021..9524) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216218.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene def CDS 9694..10971 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 11357..12490 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene dprA CDS 12506..12961 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(13253..14773) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 14944..15090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15348..16424) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene prfA tRNA complement(16636..16712) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(16748..17074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(17058..17360) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(17436..19796) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene pheT CDS complement(19807..20580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(20580..21041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(21025..21549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(21561..22550) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene pheS CDS complement(22901..23740) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene metF CDS complement(24440..25042) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(25179..25661) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 26355..27455 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene gcvT CDS 27971..28453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 28524..29006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 29122..29700 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207538.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29896..30279 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695621.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene gcvH CDS 30584..32002 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(32069..32887) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene truA CDS 33203..34444 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene gltS CDS 34543..35577 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 35743..37545 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene recQ CDS complement(37662..38984) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene argA CDS complement(38986..39348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 39760..39948 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(40086..40736) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(40733..41530) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215286.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(41530..43227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(43241..44410) product capsule polysaccharide export outer membrane protein CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215290.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene ctrA CDS 44671..45633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 45647..47299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 47302..48435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 48550..50616 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 50672..52072 product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(52251..52859) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene wrbA CDS 52910..54166 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 54578..55660 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene pheA CDS complement(55738..57078) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(57232..58908) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 59110..60891 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 61144..61563 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 61820..62266 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 sequence02 source 1..60546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..674) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene dksA CDS complement(885..1442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(1439..2239) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene proC CDS complement(2501..3676) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 4033..5067 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(5165..6496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(6581..8779) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene uvrD CDS 9162..9710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 10262..10993 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(11070..11558) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(11555..11947) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(11951..12310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(12438..12908) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene rlmH CDS complement(13015..13233) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(13235..14581) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(14888..16216) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(16660..17025) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rplS CDS complement(17039..17788) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene trmD CDS complement(17788..18297) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rimM CDS complement(18324..18572) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rpsP CDS complement(18629..20917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(21213..22016) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(22010..22453) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700855.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene rimI CDS complement(22450..23130) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene tsaB CDS complement(23253..24359) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene prfB CDS 24555..25406 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(25473..25721) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 25922..26575 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene ftsE CDS 26572..27486 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene ftsX CDS complement(27692..28117) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(28128..29525) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene atpD CDS complement(29562..30437) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene atpG CDS complement(30464..32008) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene atpA CDS complement(32019..32552) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(32556..33026) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(33104..33337) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214801.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene atpE CDS complement(33423..34274) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene atpB CDS complement(34279..34632) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(35044..35910) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 36240..36470 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 36454..37350 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 37664..38836 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(38967..39569) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(39684..40385) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 40568..41608 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene pilT CDS 41644..42873 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 43192..44442 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene murA CDS complement(44549..47137) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene mutS CDS complement(47250..47915) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(48081..49088) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene bioB CDS complement(49284..50426) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(50745..51038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(51121..51753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 52455..53060 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 53242..54024 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene trpC CDS 54247..56877 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene leuS CDS complement(57111..58436) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(58585..59181) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(59292..59648) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene arsC CDS 59893..60375 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225751.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 sequence03 source 1..52926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217668.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(1059..2060) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene holA CDS complement(2061..2555) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene lptE CDS complement(2675..3004) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene trxA CDS complement(3090..4631) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192088.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(4632..5519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(5597..6619) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(6839..7522) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 7485..7658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(7655..8686) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene murB CDS complement(8686..10065) product multidrug efflux MATE transporter NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene norM CDS 10257..11414 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene bioF CDS 11404..12192 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene bioC CDS 12286..13134 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene hpnD CDS 13131..14471 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene hpnE CDS 14574..15293 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 16049..18064 product transferrin-binding protein TbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene tbpB CDS 18211..21036 product lactoferrin/transferrin-binding protein LbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene lbpA CDS 21172..22650 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951324.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 22942..26259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(26343..26474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 26736..27002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(27143..31057) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene purL CDS 31224..31562 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 31656..32588 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene pip CDS 32622..33383 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene aroD CDS complement(33474..33941) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 34083..34859 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 34856..35716 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 35870..37093 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene pncB CDS 37179..37925 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene fabG CDS 38265..40157 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017146899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 tRNA 40223..40298 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 40311..40387 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 40593..41300 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 41375..41824 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene recX CDS 42026..42685 product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 43164..44660 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(44722..45987) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(46052..46678) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene tmk CDS complement(46971..48644) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene ettA CDS complement(48874..49134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(49511..49831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 misc_feature complement(50165..>52926) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064383.1:retention module-containing protein locus_tag LOCUS_01560 sequence04 source 1..45113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(285..854) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231013.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(1184..2455) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene purD CDS complement(2645..3274) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(3276..4334) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(4495..5430) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(5442..6191) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(6404..7378) product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218264.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene waaC CDS complement(7428..8063) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 8167..8844 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene tsaA CDS 9058..10932 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(11202..11438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(11472..11708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(11939..12232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 12358..12780 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 12798..13274 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(13306..13878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 14162..14755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 14838..15587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(15730..16134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(16377..16778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(16998..18329) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 18640..19590 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 19592..20773 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 20875..22152 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243924.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene efeB CDS complement(22209..22520) product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973063.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene bigR CDS complement(22611..23141) product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene ygaP CDS complement(23359..25146) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225268.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene ggt CDS 25630..26988 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene gnd CDS complement(27154..27408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(27758..28645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 29007..29498 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218701.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(29604..30335) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(30449..31696) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(31947..32897) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 33100..33426 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(33498..34151) product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(34151..34519) product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(34537..35202) product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(35518..36525) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene gap CDS 37013..37930 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene lpxC CDS 38246..38482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 38479..39306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(39377..39709) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 39820..40749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 40821..42188 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene mnmE CDS 42472..43746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 44088..44342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 44687..44947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 sequence05 source 1..43672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3015..4838) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(5035..5763) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(5788..6567) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rsmA CDS 6781..7287 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(7313..8110) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(8166..9506) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 tRNA 9663..9739 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 9757..9831 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 9979..10470 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(10575..11570) product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 11978..12718 product peptidoglycan-binding outer membrane protein RmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene rmpM CDS 12925..13977 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene thiL CDS 13970..14464 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 14482..14862 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974342.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene apaG CDS complement(14954..15553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(15754..16101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 16411..17790 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 17931..18173 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(18272..19099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(19154..30736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(31710..32696) product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene oppF CDS complement(32693..33679) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(33753..34667) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene oppC CDS complement(34747..35667) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene oppB CDS complement(35895..37556) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169310.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene oppA CDS complement(38250..39431) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene lpxB tRNA complement(39667..39742) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 39936..40475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 40771..41916 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene dnaJ CDS complement(42102..42533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 42704..43411 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 sequence06 source 1..36063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..6089 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001111655.1:Ig-like domain-containing protein locus_tag LOCUS_02330 CDS complement(6174..9608) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225661.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene dnaE CDS complement(9715..12723) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400800.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(13062..17780) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(18167..19525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 19931..20278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 20479..21078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 note possible pseudo, frameshifted CDS complement(21159..22454) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 22751..23632 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 23632..24558 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 24562..25425 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 25418..26275 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(26397..27371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(27503..28129) product outer membrane beta-barrel protein NspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene nspA CDS complement(28877..30391) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218620.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene katA CDS 30700..30933 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 30911..31150 product oxidoreductase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 31213..31671 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 32047..32883 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(33048..34418) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene ffh CDS 34531..35337 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 sequence07 source 1..7904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..1518) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene accC CDS complement(1615..2079) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene accB CDS 2568..3836 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208223.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 3971..4582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(4766..5569) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037586615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(5648..6349) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687861.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(6525..7166) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene pyrE CDS complement(7423..7734) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene rpsJ sequence08 source 1..5407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 50..1585 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 1711..1787 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 1830..1905 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 rRNA 2247..5132 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5249..5356 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence09 source 1..2814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence10 source 1..2274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..895) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 1161..2153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 sequence11 source 1..513556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..1360) product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene ccsB CDS complement(1430..3442) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(3580..4203) product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 4348..4977 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687358.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene yihA CDS 5137..6594 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(6701..7636) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 7773..8090 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 8133..8849 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene ubiG CDS complement(8927..9172) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(9399..10379) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 10947..13865 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 14058..15464 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 15595..15864 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 16103..17008 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene rbsK CDS complement(17086..18396) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220532.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene hisD CDS 18922..20199 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(20462..21577) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene ald CDS complement(21656..22942) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene kynU CDS complement(22964..24154) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(24615..25856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(25892..26569) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene hisG CDS complement(26646..27287) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 tRNA 27529..27613 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 28020..28568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(29047..30555) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 30846..31955 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 tRNA 32094..32170 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 32312..34216 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene thrS CDS 34355..34927 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene infC CDS 35091..35288 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene rpmI CDS 35300..35656 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene rplT CDS 35877..36710 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 36768..37925 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene hflX CDS complement(38043..38831) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(38918..39823) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 40140..40478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 41332..41538 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(41619..42650) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene trpD CDS complement(42725..43330) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(43373..44236) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene lgt CDS 44544..46040 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene putP CDS 46141..47235 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene aroC CDS 47583..48053 product ProQ/FINO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 48179..48727 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(48811..49119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 49296..50489 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 50566..51132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 51249..51827 product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(51959..53770) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene typA CDS 54230..54694 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene bfr CDS 54744..55217 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213535.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene bfr CDS 55411..55704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(55934..57619) product choline/carnitine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(57785..57922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(57926..59464) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene betT CDS 59922..60797 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene prpB CDS 60947..62095 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene prpC CDS 62302..62979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 63037..64491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 64611..65480 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 65597..68203 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene acnD CDS complement(68358..69707) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene argG CDS 69848..70651 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 70885..72546 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(72622..72885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(73134..74678) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene murJ CDS complement(74781..75404) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene clpP CDS complement(75499..76809) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene tig tRNA complement(77177..77251) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(77269..77345) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 77650..79317 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(79410..80444) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene purM CDS 80633..81703 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(81845..82501) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(82642..83130) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 83555..84232 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(84189..84848) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 84916..85314 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383816.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 85573..87249 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 87542..88447 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(88856..89941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(89975..90142) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(90147..90758) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ccoO CDS complement(90786..92222) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ccoN CDS 92544..94298 product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 94793..95446 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 95523..95960 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(96044..96238) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene iscX CDS complement(96298..96639) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene fdx CDS complement(96857..98719) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene hscA CDS complement(98870..99430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(99532..99861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(100250..100462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 100638..101468 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 101452..102174 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 102184..102957 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 103144..103773 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene nth CDS 104014..105507 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 105703..106788 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene nagZ CDS complement(106935..107858) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene ubiA CDS complement(107993..108514) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(108760..110184) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689678.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 110357..111469 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene lptF CDS 111469..112533 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene lptG CDS complement(112638..113567) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene fabD CDS complement(113577..114869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(114982..115980) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(116126..117718) product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene mnmC CDS 117891..118625 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687835.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene pyrF CDS 118710..119684 product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene hldA CDS 119727..120221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 120327..121334 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rfaD CDS 121464..121958 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene rraA CDS 121965..122381 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 122751..123464 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(123566..125545) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rpoD CDS complement(125682..127457) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene dnaG CDS complement(127517..127963) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(128163..128375) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rpsU CDS complement(128793..129563) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221975.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(129588..130463) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(130508..130777) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(130779..131069) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(131077..131610) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 131901..134471 product FimV/HubP family polar landmark-like protein TspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180298734.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene tspA CDS complement(134597..135406) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 135595..136383 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(136443..138869) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(139583..141181) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(141399..141839) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(141969..143261) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene serS CDS complement(143611..145041) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene lpdA CDS complement(145168..145431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(145538..146734) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene odhB CDS complement(146807..149641) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(149836..151119) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene gltA CDS complement(151210..151458) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(151462..152169) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(152191..153954) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene sdhA CDS complement(153951..154298) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene sdhD CDS complement(154292..154669) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene sdhC CDS 155257..156237 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 156939..161402 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene gltB CDS 161481..162908 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene gltD CDS 163018..164436 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene glnA tRNA complement(164603..164678) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 164834..166312 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222122.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene ubiD CDS 166463..167539 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(167615..170011) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(170379..170894) product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(171129..172913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(172925..173521) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(173697..174872) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene hemW CDS complement(175005..175604) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene rdgB CDS complement(175620..175856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 176051..176488 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225009.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene rnhA CDS 176578..178050 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(178129..178956) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 179126..179581 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 179861..181681 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(181767..184460) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene glnE CDS complement(184578..185120) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 185662..188070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 188168..190093 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene pgaB CDS 190267..191493 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610441.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene pgaC CDS 191532..191819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 192082..194667 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222205.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene acnB CDS complement(194827..195366) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(195384..196160) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(196365..196862) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene greB CDS complement(197032..198795) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene cysI CDS complement(198885..200240) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832531.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(200328..201191) product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene tauD CDS complement(201319..203103) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(203185..204609) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene cysG CDS 204888..205799 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene prmB CDS 205792..206007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(205901..206506) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 206729..208588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 208764..209282 product outer membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 209296..210147 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene ispE tRNA 210166..210241 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 210250..210325 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 210600..211628 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213870.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 211695..212267 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 212824..214032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 214078..216228 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 216321..217544 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 217757..219442 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 219822..221081 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rho CDS 221207..222568 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 222915..224372 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 224638..225984 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 226317..227420 product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene serC CDS 227505..228215 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108043587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 228212..228511 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951048.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(228574..229062) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 229345..231357 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rep CDS complement(231419..232465) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene recA CDS complement(232693..234729) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 235086..235292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(235595..236278) product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(236495..236764) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rpsO CDS complement(237013..238254) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(238550..238939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(239149..240021) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(240101..240679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(240822..241952) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(242111..243163) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(243197..243733) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 244323..244508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 244510..245076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(245496..246359) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene pdxY tRNA 246479..246554 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(246701..246868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(247451..248734) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene hemL CDS 248970..249797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(250040..253273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(253709..254053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(254362..254787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(254771..256087) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 256225..256596 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 256786..258036 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 258029..258724 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene lolD CDS 258839..259447 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(259499..260116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 260358..261050 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 261047..262012 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 262299..262505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 262596..263000 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rbsD CDS 262997..264493 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rbsA CDS 264490..265428 product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rbsC CDS 265461..266378 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rbsB CDS 266546..267151 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene recR CDS 267352..267834 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(267959..268888) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(269026..271626) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(271613..272338) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(272366..272947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 273564..275336 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(277121..277645) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(277720..279738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(280029..282302) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224749.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(282299..282988) product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 283306..284880 product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene msrAB CDS complement(286823..289132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 289459..289779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 289922..290161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(290536..292152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(292225..294849) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene alaS CDS complement(295092..295511) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 296072..297994 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225202.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 298082..298240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 298605..299162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 299456..299887 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rimP CDS 299925..301439 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene nusA CDS 301436..304288 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene infB CDS complement(304492..304902) product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(304979..305314) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(305449..307575) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene dnaX CDS complement(307734..308813) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene mltB CDS complement(309013..310041) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene gap CDS complement(310433..311392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(311389..313713) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 313784..314788 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224845.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(314958..315533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(315523..316068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(316398..318560) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(318643..319305) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(319318..319527) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 319697..320101 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene cueR CDS 320056..320217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 320399..321403 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(321502..322626) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(322843..324072) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(324263..324586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 324920..326443 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene ilvA CDS complement(326467..327150) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene radC CDS 327470..328306 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213954.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(328419..329267) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(329276..329785) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene ybeY CDS 329842..330837 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene hemC CDS 330948..331907 product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene czcD CDS 332005..332652 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(332726..333691) product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(333705..334127) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(334268..335017) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rlmB CDS 335202..336446 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225191.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(336522..337304) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 337318..337479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 337472..338542 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene leuB CDS 338657..338995 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 339213..339779 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(339855..340106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 340288..341082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 341135..341323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 341316..341786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 341930..342154 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(342255..342887) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene pdxH CDS complement(343059..344558) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ppx CDS complement(344829..346025) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(346230..347534) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 347795..349228 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ccoG CDS 349231..349791 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 349865..350518 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 350630..351418 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene pgeF CDS complement(351508..353046) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene purF CDS complement(353064..353561) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(353561..354757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(354773..356065) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene folC CDS complement(356142..356579) product transcriptional regulator FolI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(356583..356942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(357046..358725) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(358728..359042) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 359338..360249 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(360503..361909) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 362213..363109 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217262.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene argB CDS 363216..363899 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 364206..365531 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162098123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 365524..367182 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene pqiB CDS 367182..367703 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691649.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(367787..369169) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 369579..371090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 371157..371579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 371682..373250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 373334..374236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 374294..375007 product DUF1911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943014.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 375155..376264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 376267..376875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 377114..377773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 377775..378134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 378404..379813 product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(379939..380508) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 380932..382731 product transferrin-binding protein Tbp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene tbp2 CDS 382767..385532 product transferrin-binding protein TbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene tbpA CDS 385899..387137 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene icd tRNA 387433..387526 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(387608..388483) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(388674..389300) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(389438..391270) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene edd CDS 391742..393199 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene zwf CDS 393274..393972 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene pgl CDS 393953..395002 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 395246..396100 product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene hexR CDS 396097..397761 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene pgi CDS 398123..399337 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(399512..400348) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene panC CDS complement(400420..401205) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene panB tRNA complement(401324..401399) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(401528..402544) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(402800..404227) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene gatB CDS complement(404273..406195) product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(406371..407144) product DpnI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(407259..408710) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene gatA CDS complement(408786..409076) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene gatC CDS 409313..410353 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 410381..411259 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene mreC CDS 411268..411771 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene mreD CDS 411768..413828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 413825..414931 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene rodA CDS 415121..415780 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(415960..418182) product heme/hemoglobin uptake receptor PhuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene phuR CDS complement(418459..418659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 419057..420307 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(420432..421298) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225313.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 421454..422197 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 422368..423723 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene xseA CDS 423743..424084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(424174..425208) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene waaF CDS 425671..426084 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene gloA CDS 426258..426890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(426993..428027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(428810..430270) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(430491..431861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(432104..432727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 tRNA complement(432879..432965) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(433030..433116) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 433206..435557 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rnr CDS complement(435670..436398) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene tadA CDS 436744..437307 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 437532..439523 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene tkt CDS complement(439623..440618) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225508.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene mltG CDS 440854..441408 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene ampD CDS 441524..442795 product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 443154..445019 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 445430..446623 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(446806..448275) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(448613..450673) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ppk1 CDS 450961..451821 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996787.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(451949..452857) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 453247..453873 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(453978..454907) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(455037..455906) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(455985..456710) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208635371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 457113..457409 product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(457514..459457) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene mutL CDS 459718..460116 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene rpsF CDS 460211..460420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 460427..460657 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene rpsR CDS 460675..461124 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232586.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene rplI CDS complement(461323..462705) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(462780..464039) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193983.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(464875..465405) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(466502..467323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(467350..470175) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene uvrA CDS complement(470406..471437) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene ruvB CDS complement(471561..471875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(471954..472583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 472844..473812 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(473974..474411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 474606..475292 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rpe CDS complement(475398..477572) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 477901..478620 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene dnaQ CDS 478617..479294 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene ispD CDS complement(479366..480442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 tRNA complement(480668..480752) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 480911..481600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 481593..482180 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene ribA tRNA 482303..482378 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 482391..482467 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 482807..484138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(484389..485453) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 485980..486429 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene ptsN CDS 486432..487394 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene hprK CDS 487375..488220 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687703.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rapZ CDS 488419..489360 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene ylqF CDS 489395..490012 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(490052..490735) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225261.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 490922..491680 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene gloB CDS 491832..492593 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene pssA CDS 492654..493484 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 493815..494639 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene thiD CDS 495085..495801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 496025..496279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 496510..496764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 497178..497432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(497537..497860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(497874..498542) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(498539..499207) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene hda CDS 499437..500093 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(500158..501186) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951007.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 501392..501688 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene yajC CDS 501761..503611 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene secD CDS 503617..504552 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene secF CDS complement(504645..506156) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene ubiB CDS complement(506440..506976) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(507114..510608) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene smc CDS 511058..511954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 sequence12 source 1..1161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence13 source 1..1007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence14 source 1..956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence15 source 1..418190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(728..3514) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene ileS CDS 3754..4140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 4258..6297 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene recG CDS 6476..7207 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458388.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene nfsA CDS complement(7310..7756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(7749..8030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 8967..9254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 note possible pseudo, frameshifted CDS 9353..10375 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene hemH CDS 10625..10981 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene erpA CDS 11420..12082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 12346..13737 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 13738..14958 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene argJ CDS 15853..16344 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene mprA CDS 16395..17807 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(17857..18729) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rsmI CDS 18777..19124 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 19128..19721 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 19806..20423 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686871.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 20519..21226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 21324..22100 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene map CDS 22380..22676 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 22937..25762 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 tRNA complement(26028..26103) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 26534..27334 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(27391..28824) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(29182..29850) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 30295..30642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 30843..31442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(31717..33045) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene pmbA CDS 33173..33697 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225402.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene yjgA CDS complement(33779..34732) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 35316..36440 product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene potA CDS 36458..37435 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 37435..38316 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(38599..39474) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene xerD CDS complement(39495..39956) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(39971..40558) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(40595..41032) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 41235..42512 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815518.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 42548..43162 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(43265..43864) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(43931..44707) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(44786..45580) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686851.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 45880..46749 product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 46933..47811 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 47875..49440 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene lnt CDS 49769..50632 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene rpoH CDS complement(50798..51859) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene plsX CDS complement(52207..52737) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(52891..53070) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene rpmF CDS complement(53113..53616) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 53668..54258 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 54345..55055 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 tRNA 55109..55185 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 55495..55707 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(56075..57898) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 58290..59090 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 59091..59534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(59642..60382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(60462..60950) product type IV pilus assembly protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene pilA CDS complement(61120..61638) product fimbrial major subunit PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene pilE CDS complement(63357..64775) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 65468..66286 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene nhoA CDS 66529..67836 product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 67906..68916 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(68836..70050) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene pcaF CDS complement(70047..70709) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(70706..71383) product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 71577..71972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 72098..73126 product YeiH family putative sulfate export transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024911344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 73404..74885 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(74991..75773) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(76054..77916) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene ilvD CDS 78702..78965 product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 78969..80738 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 80881..81372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338329.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 81516..82712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 82746..83771 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene lpxK CDS 83771..84325 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 84331..84513 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 84510..85283 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690726.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene kdsB CDS 85479..85799 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(86053..86628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(86691..87449) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(87436..88290) product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(88439..88729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(88816..89103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(89178..89648) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(89896..91320) product multidrug efflux transporter outer membrane subunit MtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene mtrE CDS complement(91323..94520) product multidrug efflux RND transporter permease subunit MtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene mtrD CDS complement(94530..95732) product multidrug efflux RND transporter periplasmic adaptor subunit MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene mtrC CDS 95963..96619 product multidrug efflux system transcriptional repressor MtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene mtrR CDS 96789..98696 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene speA CDS 98767..99456 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(99670..100407) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 100733..101572 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene fghA CDS 101882..102703 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene dapD CDS complement(102811..104262) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(104572..105303) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 105652..106191 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(106267..107277) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene trpS CDS 107406..107591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 107594..110164 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene clpB CDS complement(110228..110872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(111015..111797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(111794..113494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(113507..115141) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(115252..116241) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(116292..117746) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127580446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(117820..118230) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 118448..119332 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 119679..120998 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(121070..122440) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene purB CDS complement(122681..123475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(123695..124300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 125183..126232 product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene gtdA CDS 126406..127044 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene maiA CDS 127173..127877 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(128003..128854) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 129993..131039 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 131167..131700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 131690..132976 product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 133333..133824 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene pncC CDS 134129..134932 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(135066..135410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(135587..136087) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ftnA CDS 136335..138575 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154236097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 138730..140214 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379222.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(140289..141884) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(142114..143217) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(143349..143912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(143974..145449) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene trpE CDS 145760..146527 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(146613..147626) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene ilvC CDS complement(147673..147975) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(148000..148491) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene ilvN CDS complement(148491..150275) product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene ilvB CDS complement(150809..151510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(151612..152838) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene sstT CDS 153302..155140 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 155263..159180 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(159585..160373) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 160460..161185 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(161300..161767) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 161906..163162 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 163362..164420 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene alr CDS 164636..165019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 165146..165520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 165711..166094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 166122..166301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 167092..168222 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene dapE CDS 168350..169111 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene lpxH CDS 169300..172146 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene gcvP CDS 172368..174176 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 174189..174803 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(174873..175112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(175568..175807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(176067..176327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 176670..177590 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 177702..178574 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(178656..178910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(179311..180462) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 180777..181040 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rpsT CDS 181412..182557 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 182714..183400 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 183534..185339 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene aspS CDS complement(185512..186690) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene prpF CDS 186927..187487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(187585..189903) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(189906..190106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(190173..190319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(190560..191192) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215270200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(191260..192309) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(192353..193558) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 193857..194741 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(194852..195475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(195472..195924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(195928..197082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(197110..201177) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene hrpA CDS complement(201231..201686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 202019..203083 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene fba CDS 203221..203940 product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 203971..204564 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene mog CDS 204813..205859 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(205926..207317) product two-component system sensor histidine kinase MisS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene misS CDS complement(207343..208020) product two-component system response regulator MisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene misR CDS complement(208209..210032) product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244038.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(210025..210399) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(210812..213025) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(213194..214606) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(214655..216592) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(216614..217777) product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 218284..218691 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 218787..219248 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(219370..220017) product GrxB family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358860.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(220134..220742) product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(220743..221591) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 222078..224273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 224384..224764 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 224751..225245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(225768..225908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(225995..227179) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene ubiM CDS complement(227381..227653) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene rpmA CDS complement(227673..227981) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rplU CDS 228208..229182 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ispB tRNA 229255..229329 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(229390..230070) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(230197..230673) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene queF CDS complement(230815..231228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 231468..232205 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 232232..232846 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(232922..234718) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 235175..235429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(235511..236629) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene tgt CDS 236800..237459 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ung CDS 237532..238491 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene gshB CDS 238496..238888 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(238971..240767) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene spxB CDS 241178..241585 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 241648..242079 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(242158..243540) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688594.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene mpl CDS complement(243667..245019) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(245394..247385) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene ftsH CDS complement(247447..248067) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 248165..248458 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene yhbY CDS complement(248545..248988) product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 249122..250723 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 250904..251179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(251336..252166) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(252281..253546) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(253575..253784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(253784..254101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222238.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(254171..254674) product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223573.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 tmRNA 254794..255157 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 255608..256591 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 257063..258106 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 258131..259219 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 259229..260251 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 260297..261055 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(261098..262390) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene aroA CDS complement(262502..263452) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene ttcA CDS 263628..264113 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(264220..264588) product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(264812..265237) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 265430..268186 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225053.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene secA CDS complement(268272..268499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(268576..269544) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene speB CDS complement(269771..270430) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(270658..272010) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691680.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene glmM CDS complement(272443..273984) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 274402..275199 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene nadE CDS complement(275274..275810) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(275839..277128) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene bioA CDS complement(277285..277695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(278315..278656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(278767..279366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 279758..280930 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene metZ CDS 281012..281218 product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 281288..282133 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224358.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene folP CDS 282447..284234 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 284377..285129 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene surE CDS 285129..285788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 285870..286778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 287076..288854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 288928..290289 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene tilS CDS 290364..290963 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene rpoE CDS 290970..291575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(291665..292678) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene hemB CDS complement(292865..293800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(293869..295134) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(295122..295592) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218833.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene tsaE CDS 295822..296634 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene murI CDS 297077..299149 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 299139..299345 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 tRNA 299520..299595 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(299897..300577) product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(300805..302961) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(303997..306156) product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene piuA CDS 306958..307848 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(308038..308997) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 309478..310539 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 310560..311351 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 311511..312368 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114019.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 312422..313168 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 313611..314696 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hisC CDS 314751..315692 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene hisB CDS 315967..316398 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 316752..317042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 317707..319668 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 319658..320641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 320865..321473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 321950..322687 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 322805..323413 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 323566..324252 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 324450..324698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 324842..326728 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 326874..327776 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 tRNA complement(327976..328066) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(328094..328184) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(328266..329045) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene yaaA CDS complement(329212..330519) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 330784..331140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 331223..332635 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene thrC CDS 332761..334554 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene msbA CDS 334625..335401 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(335503..336765) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene hemA CDS 337025..337966 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 339137..341893 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(341992..342270) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(342438..343019) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 343245..344654 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene dnaB CDS 344870..345556 product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 345673..346332 product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene pilV CDS 346335..347330 product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 347336..347860 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951047.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 347873..348331 product PilX family type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 348478..348951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(349135..349791) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(349788..351611) product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 352106..352771 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene queC CDS 352908..353336 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene queD CDS 353458..354630 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene zapE CDS 354706..355131 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene ndk CDS 355258..356358 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene rlmN CDS 356355..357122 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene pilW CDS 357122..358015 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 358015..359286 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227267.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene ispG CDS 359375..359776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 359810..361105 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene hisS CDS 361106..361732 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 361835..363292 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene der CDS 363494..364054 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene azu CDS complement(364128..366404) product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene maeB CDS complement(366734..367531) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(367684..368502) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687512.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 369123..371510 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene ppsA CDS complement(371705..372217) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(372223..373098) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(373190..373513) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(373586..374179) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 374513..375382 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rfbD CDS 375800..377206 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene leuC CDS 377337..377474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 377536..377673 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 377843..378484 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene leuD CDS complement(378556..379536) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225293.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 379858..381222 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 381224..382219 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 382532..384628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 384981..385655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 385677..386681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 386863..388329 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 388449..389522 product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 389629..390486 product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 390483..390818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 390884..392623 product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene atsA CDS 392726..394447 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 394564..396303 product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene atsA CDS 396413..397462 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(397584..398216) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693808.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(398539..400152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(400350..401324) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene lipA CDS complement(401321..401941) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene lipB CDS complement(401944..402213) product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 402417..404870 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene lon CDS 405062..405331 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 406067..407911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(407994..408443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(408610..408816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(408846..409967) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(409996..412803) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene rbbA CDS complement(412829..413278) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(413375..414517) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(414658..415629) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339091.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(415652..416257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 416554..417036 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene ispF CDS 417112..417777 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene rpiA sequence16 source 1..360099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 268..558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(777..1268) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1445..2281) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(2401..2790) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(2956..3885) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene ribF CDS complement(4109..5461) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene ribBA CDS 5752..6357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 6382..6876 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene tpx CDS 7060..8115 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 8388..8675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(8778..9341) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(9451..10386) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 10765..12024 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(13624..14697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(14770..16800) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene uvrB CDS 17327..17608 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene hfq CDS 17680..18243 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 18360..18731 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 18745..19248 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221222.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene folK CDS 19384..20031 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 20144..20428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 20753..22273 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 22486..22797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 23063..23482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 23472..23720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(23779..24510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(24655..25680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(25853..26842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(27324..31001) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(31284..32189) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 32372..33451 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene hppD CDS 33666..34985 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 35039..35584 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 35700..36701 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 36879..38261 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene nhaC CDS 38448..39146 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 39149..39778 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 39894..41078 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 41207..41953 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene recO CDS 42011..42742 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene pdxJ CDS 42784..43161 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene acpS CDS 43259..43531 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 43809..45170 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218495.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(45251..45877) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690802.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene upp CDS complement(45946..47295) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene gshA CDS complement(47493..48503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 48634..49983 product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694038.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 50034..51026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 51054..51233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 51151..52494 product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 54235..54441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 54438..54836 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 55055..56362 product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 56694..57839 product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene yiaY CDS complement(58240..60477) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(61090..61911) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236618.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene dapB CDS complement(61942..62412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 62658..63095 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene fur CDS 63176..63922 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene aat CDS complement(64013..65659) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(65758..67428) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(67518..68618) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene mnmA CDS 68898..69281 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 69372..70214 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688911.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene kdsA CDS complement(70340..73984) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene recB CDS complement(74195..74797) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360624.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(74890..77382) product haemoglobin-haptoglobin-utilization protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705045.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene hupB CDS complement(77472..78509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 78839..80365 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 80834..81736 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 81932..82561 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene purN CDS 82584..83246 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(83330..83878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(84149..85465) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene clpX CDS 85834..86772 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687718.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 87084..88265 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(88415..89134) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 89284..89772 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene fxsA CDS 89971..90753 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene trpA CDS 91037..91909 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706663.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene accD CDS complement(92003..92776) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687811.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene folE2 CDS 93007..94170 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 94443..95267 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 95672..96487 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene hpnC CDS complement(96538..96996) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene ruvX CDS complement(96989..97537) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(97772..99031) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(99162..99536) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 99798..100769 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(100872..101747) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(101805..102632) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 102852..103472 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene lolA CDS 103859..107254 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene mfd CDS 107391..108332 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene miaA CDS 108514..110007 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980777.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(110063..110713) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(110713..111387) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene modB CDS complement(111447..112196) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene modA CDS 112467..112715 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene moaD CDS 112718..113179 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene moaE CDS 113182..113766 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 113760..114953 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 115118..116209 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene trmA CDS complement(116297..120130) product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 120551..121261 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 121294..122907 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980843.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 122904..124130 product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 124223..125290 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene hemE CDS 125498..126502 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene ilvE CDS 126789..128279 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene cls CDS 128210..128386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 128752..131031 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene nrdA CDS 131067..131987 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 132207..133361 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene nrdB CDS 133554..133865 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene yfaE CDS 134095..135399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(135704..136336) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456391.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 136630..137631 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064003.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 137767..138672 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 138669..139463 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(139584..141032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(141589..142395) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244053.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 142394..143509 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene rluD CDS complement(143533..143910) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene crcB CDS complement(143967..144455) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene purE CDS complement(144688..145386) product tol-pal system YbgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(145401..146069) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(146097..146282) product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(146407..147396) product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(148089..148277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 148500..148889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 148985..149341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 149382..150275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(150505..150750) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705082.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 151348..151872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 151938..153125 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(153183..153767) product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene metW CDS complement(153764..154906) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 155077..155250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(155301..155675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 155859..156092 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(156354..156701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 157003..158301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(158371..159555) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene coaBC CDS complement(159661..160404) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene rph CDS 160505..161380 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(161536..163689) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(163707..163913) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rpoZ CDS complement(164010..164627) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene gmk CDS 164754..165329 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 165481..167109 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002260424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(167210..167623) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(167919..169067) product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(169173..170015) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 170177..170737 product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(170766..171392) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(171502..172419) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene hemF CDS complement(172571..174706) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene pnp CDS 175148..176836 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222583.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene dld CDS complement(176920..179208) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene clpA CDS complement(179209..179376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 179765..179968 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 180113..180325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 180363..180581 product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 180647..181093 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene smpB CDS 181209..181547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 181596..183251 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene guaA CDS 183333..184511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 184512..185345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(185573..186766) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene dapC CDS 186969..187613 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene hisH CDS 187716..188465 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene hisA CDS 188612..188929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 189037..189804 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene hisF CDS 189854..190399 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 190433..191191 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 191343..191747 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225530.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene hisI CDS 191845..192168 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 192299..192622 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 192679..192876 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene tatA CDS 192880..193434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 193441..194187 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene tatC CDS complement(194272..195204) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene truB CDS complement(195303..195674) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene rbfA CDS 195952..196368 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(196456..196935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(197164..197508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(197920..198111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 198189..198989 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene dapF CDS 198989..199648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 199650..200255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 200428..201360 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene cysK CDS 201528..202619 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene ychF CDS 203002..203511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(203585..204625) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 204672..206054 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene argH CDS complement(206142..206873) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 207087..209201 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225171.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 209543..211108 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene narH CDS 211108..211776 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene narJ CDS 211780..212463 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene narI CDS complement(212528..213166) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706615.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(213227..213565) product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(213618..214406) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(214562..215059) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(215419..215925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(216207..216827) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene ubiX CDS complement(216972..217328) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene folB CDS 217393..218022 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene plsY CDS 218079..218603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(218711..219940) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(220168..220905) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene ubiE CDS complement(220935..221303) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 221440..222009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688863.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 222217..223167 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene trxB CDS complement(223245..223610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(223808..224080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(224422..224907) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene ybaK CDS 225029..225388 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 225605..227272 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene recN CDS complement(227303..229057) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene recD CDS 229280..230479 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 230634..231170 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033908763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(231266..232165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 232578..234056 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(234213..235076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 235376..236755 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235637.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene radA CDS 237306..239474 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene speF CDS 239590..240903 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene potE CDS 241526..242389 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 242538..243098 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 243249..244274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 244878..245156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 245283..247160 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(247480..248130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070541142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 248249..248599 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 248814..249362 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 249480..250583 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 250597..251394 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 251493..252662 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(252771..253379) product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 253597..256410 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692988.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene gyrA CDS 256496..257215 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene trmB CDS 257603..258931 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 259043..260950 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222546.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 261005..261304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 tRNA 261359..261449 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(261577..262587) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene lepB CDS complement(262587..264380) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene lepA CDS 264589..265659 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene dusA CDS 265794..267179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 267213..267662 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene nudB CDS 267739..268242 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene hscB CDS 268381..269085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 269178..270131 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 270325..271542 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(271621..272097) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene greA CDS 272734..273789 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene earP CDS 273836..274396 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene efp CDS complement(274479..275450) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(275673..276596) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(276587..277054) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217097.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(277204..277947) product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(277957..279306) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 280245..281786 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225308.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 281798..283180 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217354.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene pntB CDS complement(283319..284233) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 284336..284995 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225210.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(285068..285913) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene htpX CDS 286236..288818 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene glnD CDS 289089..290093 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 290314..291660 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359904.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 291650..291913 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(291951..292844) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(292983..293732) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(293927..294742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(294732..294899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 294893..295729 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225307.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene serB tRNA complement(295846..295921) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 296114..297022 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 297127..297693 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene dcd CDS 297830..298600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 299732..300442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 300464..300733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 300748..302076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 302066..302443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 302436..302657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 302650..305835 product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120945058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 305847..307592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 307589..308176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 308169..308897 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 308894..310390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 310387..313776 product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104752311.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 313773..315908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 315908..318604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 318608..322657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(323155..323310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(323430..323939) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212976.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(323923..325323) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002251980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(325446..326075) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(326205..329501) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 329794..330687 product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(330752..331051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(331188..332225) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene pyrC CDS complement(332319..332903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(332917..333141) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 333574..334251 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 334337..334768 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 334761..335054 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 335102..335674 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene pth CDS 335867..336514 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene adk CDS 336669..337388 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rnc CDS 337429..338361 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene era CDS complement(338446..339225) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(339826..340587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(340590..340877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(340913..341503) product type VII secretion system immunity protein YqcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene yqcF CDS complement(341773..342270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(342341..342988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(342989..343489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(343490..344101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(344143..344784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 345017..345871 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 345930..346253 product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 346346..346837 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene ribH CDS 346902..347327 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002241285.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene nusB CDS 347779..348822 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(348916..349596) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 349863..350840 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 350855..351214 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 351312..352418 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene mutY CDS 352912..355584 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene aceE CDS 355676..356005 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 356068..357714 product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene aceF CDS 357801..359597 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700029.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene lpdA sequence17 source 1..149522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(535..1197) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene thiE CDS complement(1226..2545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(3460..3669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(4101..4904) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 5009..5311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(5725..6054) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene cyaY CDS 6133..6294 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 6297..7547 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene lysA CDS 7614..8210 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene rnhB CDS 8411..8929 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(9252..10112) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(10109..11851) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225711.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(11848..12357) product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene rfaE2 tRNA complement(12494..12569) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(12591..12667) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(12713..12790) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 13147..14004 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene folD CDS complement(14076..15239) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(15430..15852) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(15916..17412) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rng CDS complement(17704..18096) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene rsfS CDS complement(18170..18778) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene nadD CDS complement(18891..19469) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(19556..20536) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene pdxA CDS complement(20683..21459) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene lpxA CDS complement(21522..21977) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene fabZ CDS complement(21983..23035) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene lpxD CDS complement(23087..23599) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(23628..26030) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene bamA CDS complement(26035..27378) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene rseP CDS complement(27578..28768) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011798751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene ispC CDS complement(29091..29888) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690029.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(29882..30640) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(30773..31333) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene frr CDS complement(31683..32402) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215090.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene pyrH CDS complement(32727..33581) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene tsf CDS complement(33722..34447) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene rpsB CDS 34940..36112 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 36432..36983 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 37365..38786 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(39040..39459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(39468..39929) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(39996..40505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(40536..41291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 note possible pseudo, internal stop codon CDS 42072..43076 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(43572..44303) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene truC CDS complement(44377..45249) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene rsgA CDS 45466..47595 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene dinG CDS complement(47635..49257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(49294..52077) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene polA CDS complement(52209..52406) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 52966..53124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 53348..53995 product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 54202..54897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 54950..55663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 56069..56749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(57069..58343) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(58363..59496) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene carA CDS 59944..63117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 tRNA 63186..63261 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(63363..63788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(63853..64980) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene proB CDS complement(65006..65305) product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(65569..67011) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene nuoN CDS complement(67021..68520) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(68835..70853) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene nuoL CDS complement(70865..71170) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene nuoK CDS complement(71167..71829) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(71842..72321) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene nuoI CDS complement(72481..73557) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene nuoH CDS complement(73560..75818) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene nuoG CDS complement(75896..76189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(76191..77486) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene nuoF CDS complement(77733..78206) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene nuoE CDS complement(78206..79462) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene nuoD CDS complement(79455..80042) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(80053..80532) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215610.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(80523..80891) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(81274..83121) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980767.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(83360..83941) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene ruvA CDS complement(84225..84857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(84911..85375) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene trmL CDS 86155..86898 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012503964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene bioH note possible pseudo, internal stop codon CDS 87233..88036 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 88084..88860 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219882.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene mlaE CDS 88865..89374 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene mlaD CDS 89410..90009 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 90013..90291 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 90288..91178 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(91247..95953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(96175..98010) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene glmS CDS complement(98529..99188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(99584..100966) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225769.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene glmU CDS complement(101073..101336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(101401..102081) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 102180..103190 product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 103280..104293 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 104419..106815 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 106833..108299 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 108296..109912 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(110013..112025) product choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010211761.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene betT CDS complement(112238..113923) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene betA CDS 114537..115856 product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(116167..117630) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene betB CDS 118022..118705 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(118794..119564) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 120134..121576 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene tldD CDS 121770..123308 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002259776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 123325..124275 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 124536..125267 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 125857..127455 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(127745..128716) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(128825..129271) product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225757.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 129467..129673 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(129765..131033) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene waaA CDS complement(131183..131785) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(131920..133812) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene mnmG CDS complement(134031..134900) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(135028..135567) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687445.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene ruvC CDS complement(135607..136494) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950979.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene prmA CDS complement(136753..137238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 137485..139440 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene dxs CDS complement(139437..140309) product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 140378..141103 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene minC CDS 141134..141946 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene minD CDS 141950..142219 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene minE CDS 142216..143145 product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene oxyR CDS complement(143288..143542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(143772..144026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(144630..144884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(145243..146760) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene lysS CDS 147956..149350 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene gltX sequence18 source 1..136170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(660..1148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1607..3025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(3152..4501) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene ftsY CDS 4694..5140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 5257..6585 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(6664..7779) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225714.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene asd CDS 7943..8530 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 8800..9405 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 tRNA complement(9564..9639) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(9646..9722) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(9892..11040) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 11361..11816 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene mraZ CDS 11813..12775 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene rsmH CDS 12825..13085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 13165..14916 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218783.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 14931..16406 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 16585..17109 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479516.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 17144..18511 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 18717..19799 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene mraY CDS 19920..20444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 20473..20877 product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964512.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 20914..22251 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224926.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene murD CDS 22326..23486 product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003752201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 23493..24560 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene murG CDS 24776..26173 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033908872.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene murC CDS 26196..27107 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223420.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 27097..27858 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 27882..29117 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216537.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ftsA CDS 29246..30418 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ftsZ CDS 30657..31091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 31519..31881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 32020..32823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 32841..36050 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene carB CDS complement(36129..37601) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene pyk CDS complement(38065..39144) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene apbC CDS 39365..39604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 39939..41222 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(41567..42463) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene gluQRS CDS complement(42506..43435) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 43712..46015 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene parC CDS 46165..47754 product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 47747..49411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 49627..50379 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(50524..50982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(50989..51366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(51739..52050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 repeat_region 52303..53197 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaacacgcagccgcgcaaaggcggctga CDS 53561..54625 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 55042..55992 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 repeat_region 56427..61717 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaacacacagccgcccgaaggcggctga CDS complement(61906..62199) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene cas2 CDS complement(62358..63371) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene cas1c CDS complement(63613..64143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(64149..64538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(64587..65189) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene cas4 CDS complement(65192..66058) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene cas7c CDS complement(66058..67833) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene cas8c CDS complement(67830..68507) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene cas5c CDS complement(68653..71973) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(71973..75041) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(75128..75724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(75789..78677) product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(78775..81075) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(81218..83194) product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(83303..84250) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(84234..85145) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 85527..87803 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene metE CDS complement(87875..88267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(88416..88853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 89091..90353 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(90480..91796) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222836.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(92185..94362) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(94413..94853) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(94885..96015) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(96098..98002) product NADH-dependent dehydratase PglD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222987.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene pglD CDS complement(98117..99292) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(99285..100067) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene fmt CDS complement(100569..101210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(101207..102376) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(102395..103465) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(103470..104765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(104762..105949) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(106000..107439) product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704927.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(107923..109227) product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene wbpA CDS complement(109660..110754) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene ribD CDS complement(110800..111375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(111471..111800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(112151..114544) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene gyrB CDS complement(114810..116459) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene yidC CDS complement(116682..116894) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene yidD CDS complement(116899..117237) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rnpA CDS complement(117239..117373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 117908..119536 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene dnaA CDS 119556..120659 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene dnaN CDS complement(120742..122403) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene pgi CDS 122755..123798 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene aroG CDS 123915..124076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 124267..126345 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 126535..128691 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene yccS CDS 128730..129053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(129159..130595) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene mgtE CDS 131032..131685 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 131761..132591 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene prmC CDS complement(132705..133211) product 4-hydroxyphenylacetate 3-monooxygenase, reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene hpaC CDS complement(133222..133665) product MarR family adhesin repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene nadR sequence19 source 1..125897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..1174 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene thrB CDS complement(1239..2765) product fatty acid resistance MFS efflux transporter permease subunit FarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene farB CDS complement(2993..4168) product fatty acid resistance MFS efflux transporter adaptor subunit FarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene farA CDS complement(4487..5182) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene bioD CDS complement(5268..6680) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene hemN CDS 6964..7698 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene fnr CDS complement(7814..9067) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(9288..10541) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(10704..11012) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(11022..12707) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene rpsA CDS complement(12864..13523) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688932.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene cmk CDS 13812..15014 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(15153..15965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(16488..17525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 18063..18668 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 18689..19153 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(19231..20073) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(20350..21078) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 21345..22268 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene hslO CDS complement(22342..22776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(23034..23633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(23832..24893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(25018..26739) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene argS CDS complement(26862..27971) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene frmA CDS complement(28117..28866) product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(29129..30484) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene yegQ CDS 30866..31615 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 31671..32132 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene dtd CDS complement(32255..33082) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(33164..33871) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(33892..34737) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene ftsN CDS complement(34841..36331) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224914.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(36337..36666) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030003521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(36815..38287) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 38582..39730 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223198.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene obgE CDS 39882..41300 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene cysS CDS 41703..42326 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(42386..43132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(43194..43946) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(44110..44862) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(44900..45397) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene moaC CDS 45670..48372 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244350.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ppc CDS 48599..49648 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 49736..50290 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene orn CDS 50367..53003 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene pepN CDS 53170..54159 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 54274..54666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 54670..54966 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 55348..55776 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215010.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene rplM CDS 55786..56178 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rpsI CDS complement(56437..57093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 57258..58163 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene glyQ CDS 58238..60298 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene glyS CDS 60779..62020 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene proV CDS 62126..63178 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464578.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene proW CDS 63238..64275 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene proX CDS 64398..64832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 64903..66000 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963749.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 65997..67031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 67049..67456 product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 67459..67932 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143891478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 67916..69019 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 69038..70090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 70104..71180 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene rfbB CDS 71177..72055 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene rfbA CDS 72171..72713 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene rfbC CDS 72790..73857 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 73868..74449 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene gmhB CDS 74475..75212 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687014.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 75215..75925 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215591.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(75965..76276) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene grxD CDS complement(76330..77244) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(77271..78314) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene argC CDS complement(78447..79601) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(79775..80140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 80217..80675 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 80994..81881 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212590.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 82019..82678 product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695658.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene exbB CDS 82683..83117 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(83218..83574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(83595..84491) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 84641..85093 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene dut CDS complement(85262..86089) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene mutM CDS complement(86234..87532) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene tyrS CDS complement(87751..89613) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(89897..90169) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene ftsB CDS complement(90184..91470) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691316.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene eno CDS complement(91803..93266) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene guaB CDS complement(93609..94391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(94403..96070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 96339..96788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(97075..98841) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 99605..100399 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 100582..102417 product lytic transglycosylase LtgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ltgA CDS 102617..103399 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(103482..103670) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305661.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene yacG CDS complement(103674..104441) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene zapD CDS complement(104438..105061) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene coaE CDS complement(105063..105926) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(105930..107177) product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene pilG CDS complement(107221..108900) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221967.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene pilB tRNA complement(109173..109248) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 109544..109891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 110092..110691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(110781..114374) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene putA CDS complement(114518..115222) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 115472..116599 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 117068..118672 product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100230921.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene mdlC CDS 118691..119635 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(119718..119885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 119952..121046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 121049..121516 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(121697..124435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 124746..125735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 sequence20 source 1..108218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..2313) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene fusA CDS complement(2332..2802) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690099.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rpsG CDS complement(2922..3293) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rpsL CDS complement(3508..4581) product trimeric porin PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244345.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene porB CDS complement(5203..6588) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(6968..10195) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene recC CDS complement(10448..11389) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene ppk2 CDS 11551..13344 product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(13454..14320) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980911.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(14426..15508) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene aroB CDS complement(15641..16189) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(16236..18404) product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene pilQ CDS complement(18420..18953) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(18972..19607) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(19611..20228) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(20231..21328) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 21478..23898 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219786.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(24093..25085) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(25195..25398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 25601..26926 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099178.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 26923..27960 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(28765..29127) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(29214..29855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212574.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(29857..30393) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(30417..31511) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(31544..32968) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 33931..34908 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(35139..35903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 36351..37046 product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 37162..37674 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene coaD CDS 38051..39826 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene aceK CDS complement(39986..41218) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(41890..42726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039851149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(43063..43452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(43449..43964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(43977..44180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(44170..44505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(44555..44782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(44794..46665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(46684..47103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(47107..48057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(48259..51813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(51828..52238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(52333..56580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(56813..57577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(57579..58058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(58058..58504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(58488..58907) product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(58922..59908) product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(59974..60336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(60317..61393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(61509..61832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(61829..63169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(63169..64593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(64612..66237) product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene terL CDS complement(66247..66501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(66512..67021) product DUF1804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213715.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(67021..67239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(67239..67511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213717.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(67508..67852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(67849..68169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(68069..68479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(68460..68693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(68696..68929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(68926..69471) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225300.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(69611..70069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(70071..70481) product gp16 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 note possible pseudo, frameshifted CDS complement(70626..70799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(70803..71423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(71726..72751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(72855..73742) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(73797..73973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(73973..74500) product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(74513..74728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(74725..75180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(75177..75665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(75667..75807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(75817..76500) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(76500..76802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(76949..77137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(77134..77361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(77441..77764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(77757..78326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(78323..79042) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(79246..81360) product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(81357..81605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 81918..82676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(82852..83457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 83537..84172 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 84268..85521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(85686..86486) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(86618..86812) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene thiS CDS complement(86944..88038) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(88207..90081) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene thiC CDS 90513..90950 product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(90972..91547) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene rsmD CDS complement(91636..92091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(92262..94571) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene topA CDS complement(95015..95461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(95605..95946) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(96027..96815) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene phhA CDS 97039..98451 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241766.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene phrB tRNA 98581..98657 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 98912..100990 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene metG CDS 101112..101867 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 101981..102877 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(103019..104665) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene groL CDS complement(104720..105094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(105151..105438) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235240.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene groES CDS complement(105828..106838) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 sequence21 source 1..107245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 301..591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(676..996) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene raiA CDS complement(1130..2479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2688..3416) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689540.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene lptB CDS complement(3621..4133) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene lptA CDS complement(4114..4692) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene lptC CDS complement(4689..5225) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(5384..7009) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(7198..8832) product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene oppA CDS complement(8974..9768) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 10122..11465 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212610.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene gdhA CDS complement(11560..15081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(15392..16447) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221981.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene tal CDS 16534..17508 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 17636..18490 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 18500..18634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 18857..19777 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene pyrB CDS 19797..20255 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene pyrI CDS complement(20674..22227) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 22602..22925 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216413.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 22932..24101 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene lapB CDS 24108..24602 product DNA-mimic protein DMP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(24687..25316) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene rsmG CDS complement(25443..27971) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(28278..29411) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene bamC CDS complement(29436..30311) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene dapA CDS 30694..32085 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(32189..32395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(32470..33408) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene ispH CDS complement(33431..33937) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene lspA CDS 34159..34935 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225108.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(35093..35941) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(35998..37704) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(37847..38617) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene xth CDS complement(38639..38947) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689479.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 39257..41302 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 41457..43313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 43539..44930 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene fumC CDS complement(45039..45851) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene cysE CDS complement(46073..46345) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 46680..47429 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951384.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 47552..48136 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene petA CDS 48148..49497 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 49512..50294 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181874519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 50540..51109 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene grpE CDS 51371..53299 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene dnaK CDS 53676..54839 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(54983..55720) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(56181..56396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 tRNA complement(56795..56880) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(56903..57247) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene secG CDS complement(57253..58008) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene tpiA CDS 58351..59661 product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene pgtP CDS 59692..60519 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224888.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene aroE CDS 60519..61214 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene mtgA CDS complement(61304..63433) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693786.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 63553..64458 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 64476..64676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 64961..65959 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225123.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene dusB CDS 66047..66292 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 66364..66801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 66927..67364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 67491..69068 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene purH CDS 69262..69495 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene rpmB CDS 69525..69680 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene rpmG CDS 70069..70323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 70682..70942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(71028..72587) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244180.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(72786..73820) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene queA CDS complement(73978..75729) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene ptsP CDS complement(75734..76003) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(75997..76416) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(76505..77065) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242054.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(77293..77919) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(77977..78711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662421.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 78880..80898 product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 81306..81542 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215574.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene acpP CDS 81690..82937 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene fabF CDS complement(83050..83304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 83625..84245 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 84394..85044 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693735.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(85111..85656) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(85677..87062) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223160.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 87487..88131 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215400.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene rplC CDS 88131..88751 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rplD CDS 88748..89062 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene rplW CDS 89068..89901 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene rplB CDS 89907..90185 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215422.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene rpsS CDS 90194..90523 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene rplV CDS 90533..91234 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215427.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene rpsC CDS 91218..91634 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene rplP CDS 91634..91825 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215432.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rpmC CDS 91825..92088 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene rpsQ CDS 92323..92691 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene rplN CDS 92704..93027 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene rplX CDS 93037..93576 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene rplE CDS 93580..93885 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene rpsN CDS 93900..94292 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215438.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene rpsH CDS 94306..94839 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951357.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene rplF CDS 94853..95206 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene rplR CDS 95223..95741 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene rpsE CDS 95734..95919 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene rpmD CDS 95921..96355 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215449.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene rplO CDS 96368..97681 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene secY CDS 97689..97907 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene infA CDS 98094..98456 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene rpsM CDS 98475..98870 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene rpsK CDS 98890..99510 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene rpsD CDS 99536..100522 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene rpoA CDS 100547..100924 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233417.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene rplQ CDS complement(101188..103170) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene parE CDS complement(103382..104005) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(104125..104829) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(104962..105474) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244258.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(105670..106839) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene metK sequence22 source 1..69369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 159..234 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 386..838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 841..1377 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene nusG CDS 1499..1930 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene rplK CDS 1930..2622 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene rplA CDS 2853..3353 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene rplJ CDS 3411..3782 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene rplL CDS 4050..8228 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene rpoB CDS 8351..12529 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700598.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene rpoC CDS complement(12853..13284) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene mscL CDS complement(13574..13912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(14141..15043) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222047.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(15103..16752) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene ubiB CDS 16938..17516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 17527..17739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 17996..18340 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 18337..19029 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 19178..20152 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene moaA CDS 20363..20872 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene luxS CDS 21271..21747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 22205..22588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 22609..23934 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene miaB CDS 24120..24746 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 24845..26680 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229553.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene uvrC CDS 27079..27645 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene pgsA tRNA 27733..27808 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 27839..27914 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 27933..28008 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 28059..28132 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 28281..28370 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 28597..28995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(29290..29847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(30013..30273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 30727..31767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(31836..32711) product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(32992..33792) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene fabI CDS complement(34065..35000) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(35076..35762) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(35764..36501) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(37069..37344) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217400.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(37689..39194) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225525.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene pta CDS complement(39325..40317) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(40473..41582) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(41725..42621) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene xerC CDS complement(42751..43812) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene tsaD CDS complement(43994..44680) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225569.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 44991..45266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(45488..45967) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 46449..46775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 46978..48357 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225062.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 48888..49883 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 50106..50546 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 50562..52055 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 52094..53128 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(53199..53735) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219633.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(54001..54321) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene iscA CDS complement(54486..54869) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene iscU CDS complement(54952..56166) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(56218..56661) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene iscR CDS 57116..58288 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 58533..59684 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 59702..61000 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222698.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(61085..61918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(62327..63529) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene trpB CDS complement(63697..64314) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(64416..65837) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene trkA CDS complement(66103..66537) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene secB CDS complement(66593..66859) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene grxC CDS complement(66939..68654) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225400.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene recJ