>Feature sequence001 1752 178 gene locus_tag LOCUS_00010 1752 178 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_00010 2078 1923 gene locus_tag LOCUS_00020 2078 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3622 2237 gene locus_tag LOCUS_00030 gene hemN 3622 2237 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_00030 3942 3625 gene locus_tag LOCUS_00040 3942 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4865 3951 gene locus_tag LOCUS_00050 gene prmB 4865 3951 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 protein_id gnl|my_center|LOCUS_00050 5011 6249 gene locus_tag LOCUS_00060 5011 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6553 8493 gene locus_tag LOCUS_00070 6553 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9535 9056 gene locus_tag LOCUS_00080 gene iscR 9535 9056 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 protein_id gnl|my_center|LOCUS_00080 10370 9861 gene locus_tag LOCUS_00090 10370 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11349 10987 gene locus_tag LOCUS_00100 11349 10987 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811007.1 protein_id gnl|my_center|LOCUS_00100 12131 11478 gene locus_tag LOCUS_00110 gene adk 12131 11478 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_00110 14392 12482 gene locus_tag LOCUS_00120 gene htpG 14392 12482 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_00120 14955 15554 gene locus_tag LOCUS_00130 14955 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15590 17950 gene locus_tag LOCUS_00140 gene ppsA 15590 17950 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_00140 18248 19657 gene locus_tag LOCUS_00150 18248 19657 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_00150 20736 20395 gene locus_tag LOCUS_00160 20736 20395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21148 22815 gene locus_tag LOCUS_00170 gene ettA 21148 22815 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_00170 23045 23917 gene locus_tag LOCUS_00180 23045 23917 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_00180 25558 24152 gene locus_tag LOCUS_00190 gene cysS 25558 24152 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769192.1 protein_id gnl|my_center|LOCUS_00190 25848 26330 gene locus_tag LOCUS_00200 25848 26330 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_00200 26514 27002 gene locus_tag LOCUS_00210 26514 27002 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_00210 27172 27915 gene locus_tag LOCUS_00220 gene lpxH 27172 27915 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_00220 30062 27921 gene locus_tag LOCUS_00230 30062 27921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30993 30229 gene locus_tag LOCUS_00240 30993 30229 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967264.1 protein_id gnl|my_center|LOCUS_00240 31614 31354 gene locus_tag LOCUS_00250 31614 31354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31806 32336 gene locus_tag LOCUS_00260 31806 32336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32333 32833 gene locus_tag LOCUS_00270 32333 32833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33046 33462 gene locus_tag LOCUS_00280 33046 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33729 34331 gene locus_tag LOCUS_00290 33729 34331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35966 34386 gene locus_tag LOCUS_00300 35966 34386 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_00300 36236 36577 gene locus_tag LOCUS_00310 36236 36577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37097 36708 gene locus_tag LOCUS_00320 37097 36708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37365 37967 gene locus_tag LOCUS_00330 37365 37967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38077 38361 gene locus_tag LOCUS_00340 38077 38361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_00340 40321 38885 gene locus_tag LOCUS_00350 gene sbcB 40321 38885 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_00350 41127 40783 gene locus_tag LOCUS_00360 gene rplS 41127 40783 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 protein_id gnl|my_center|LOCUS_00360 41890 41147 gene locus_tag LOCUS_00370 gene trmD 41890 41147 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_00370 42419 41898 gene locus_tag LOCUS_00380 gene rimM 42419 41898 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_00380 42745 42494 gene locus_tag LOCUS_00390 gene rpsP 42745 42494 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_00390 44651 43272 gene locus_tag LOCUS_00400 gene ffh 44651 43272 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 protein_id gnl|my_center|LOCUS_00400 45072 45881 gene locus_tag LOCUS_00410 45072 45881 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_00410 46380 46051 gene locus_tag LOCUS_00420 46380 46051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 46812 46390 gene locus_tag LOCUS_00430 gene fliS 46812 46390 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_00430 48226 46865 gene locus_tag LOCUS_00440 gene fliD 48226 46865 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146799.1 protein_id gnl|my_center|LOCUS_00440 48933 48502 gene locus_tag LOCUS_00450 48933 48502 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_00450 50833 48998 gene locus_tag LOCUS_00460 50833 48998 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079699.1 protein_id gnl|my_center|LOCUS_00460 52618 51395 gene locus_tag LOCUS_00470 gene flgL 52618 51395 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_00470 54606 52621 gene locus_tag LOCUS_00480 gene flgK 54606 52621 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_00480 55704 54643 gene locus_tag LOCUS_00490 gene flgJ 55704 54643 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112508.1 protein_id gnl|my_center|LOCUS_00490 56861 55704 gene locus_tag LOCUS_00500 56861 55704 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767023.1 protein_id gnl|my_center|LOCUS_00500 57557 56871 gene locus_tag LOCUS_00510 gene flgH 57557 56871 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_00510 58382 57597 gene locus_tag LOCUS_00520 gene flgG 58382 57597 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_00520 59195 58455 gene locus_tag LOCUS_00530 59195 58455 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_00530 60567 59281 gene locus_tag LOCUS_00540 gene flgE 60567 59281 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_00540 61270 60590 gene locus_tag LOCUS_00550 61270 60590 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037114.1 protein_id gnl|my_center|LOCUS_00550 61760 61347 gene locus_tag LOCUS_00560 gene flgC 61760 61347 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_00560 62152 61763 gene locus_tag LOCUS_00570 gene flgB 62152 61763 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_00570 63345 62527 gene locus_tag LOCUS_00580 gene cheR 63345 62527 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_00580 64354 63410 gene locus_tag LOCUS_00590 64354 63410 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_00590 64856 65581 gene locus_tag LOCUS_00600 gene flgA 64856 65581 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946643.1 protein_id gnl|my_center|LOCUS_00600 65721 66059 gene locus_tag LOCUS_00610 65721 66059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66063 66545 gene locus_tag LOCUS_00620 66063 66545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67920 67297 gene locus_tag LOCUS_00630 67920 67297 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_00630 68606 67920 gene locus_tag LOCUS_00640 68606 67920 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_00640 69592 68627 gene locus_tag LOCUS_00650 gene arsS 69592 68627 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_00650 69768 69844 gene locus_tag LOCUS_t00010 69768 69844 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70213 69884 gene locus_tag LOCUS_00660 70213 69884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 70663 73512 gene locus_tag LOCUS_00670 gene sucA 70663 73512 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 protein_id gnl|my_center|LOCUS_00670 73513 74718 gene locus_tag LOCUS_00680 gene odhB 73513 74718 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_00680 75103 76923 gene locus_tag LOCUS_00690 75103 76923 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_00690 77128 77370 gene locus_tag LOCUS_00700 77128 77370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 77479 78987 gene locus_tag LOCUS_00710 77479 78987 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 protein_id gnl|my_center|LOCUS_00710 79353 79111 gene locus_tag LOCUS_00720 79353 79111 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_00720 81166 79586 gene locus_tag LOCUS_00730 81166 79586 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_00730 81724 81260 gene locus_tag LOCUS_00740 gene rimI 81724 81260 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_00740 82667 81750 gene locus_tag LOCUS_00750 82667 81750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 84230 82686 gene locus_tag LOCUS_00760 84230 82686 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_00760 85415 84555 gene locus_tag LOCUS_00770 gene pssA 85415 84555 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_00770 86916 85900 gene locus_tag LOCUS_00780 gene ilvC 86916 85900 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_00780 87499 87008 gene locus_tag LOCUS_00790 gene ilvN 87499 87008 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_00790 89220 87502 gene locus_tag LOCUS_00800 89220 87502 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_00800 89274 89927 gene locus_tag LOCUS_00810 89274 89927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 92204 90243 gene locus_tag LOCUS_00820 92204 90243 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_00820 92904 92275 gene locus_tag LOCUS_00830 92904 92275 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_00830 93153 94877 gene locus_tag LOCUS_00840 93153 94877 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_00840 94934 95449 gene locus_tag LOCUS_00850 gene fabA 94934 95449 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_00850 95859 96704 gene locus_tag LOCUS_00860 gene cpdA 95859 96704 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073647.1 protein_id gnl|my_center|LOCUS_00860 96826 97815 gene locus_tag LOCUS_00870 96826 97815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 98365 98096 gene locus_tag LOCUS_00880 98365 98096 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947603.1 protein_id gnl|my_center|LOCUS_00880 98877 98362 gene locus_tag LOCUS_00890 98877 98362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 98948 99295 gene locus_tag LOCUS_00900 gene arsC 98948 99295 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_00900 99295 99891 gene locus_tag LOCUS_00910 gene wrbA 99295 99891 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 protein_id gnl|my_center|LOCUS_00910 99895 100608 gene locus_tag LOCUS_00920 gene hda 99895 100608 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_00920 101456 100899 gene locus_tag LOCUS_00930 101456 100899 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_00930 102575 101499 gene locus_tag LOCUS_00940 102575 101499 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_00940 102868 103920 gene locus_tag LOCUS_00950 gene purM 102868 103920 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703153.1 protein_id gnl|my_center|LOCUS_00950 103917 104585 gene locus_tag LOCUS_00960 gene purN 103917 104585 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_00960 104582 105316 gene locus_tag LOCUS_00970 104582 105316 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_00970 106521 106000 gene locus_tag LOCUS_00980 106521 106000 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 protein_id gnl|my_center|LOCUS_00980 107704 106613 gene locus_tag LOCUS_00990 gene apbC 107704 106613 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_00990 108041 110080 gene locus_tag LOCUS_01000 gene metG 108041 110080 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764864.1 protein_id gnl|my_center|LOCUS_01000 110483 111064 gene locus_tag LOCUS_01010 gene rsxA 110483 111064 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 protein_id gnl|my_center|LOCUS_01010 111077 111649 gene locus_tag LOCUS_01020 gene rsxB 111077 111649 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_01020 111659 113395 gene locus_tag LOCUS_01030 111659 113395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 113399 114442 gene locus_tag LOCUS_01040 gene rsxD 113399 114442 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_01040 114435 115085 gene locus_tag LOCUS_01050 gene rsxG 114435 115085 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 protein_id gnl|my_center|LOCUS_01050 115078 115776 gene locus_tag LOCUS_01060 115078 115776 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561393.1 protein_id gnl|my_center|LOCUS_01060 118031 115947 gene locus_tag LOCUS_01070 118031 115947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 118204 118839 gene locus_tag LOCUS_01080 gene nth 118204 118839 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 protein_id gnl|my_center|LOCUS_01080 118853 119284 gene locus_tag LOCUS_01090 118853 119284 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_01090 119900 119292 gene locus_tag LOCUS_01100 119900 119292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 120807 119953 gene locus_tag LOCUS_01110 120807 119953 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_01110 121574 120813 gene locus_tag LOCUS_01120 gene pomA 121574 120813 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 protein_id gnl|my_center|LOCUS_01120 121801 122637 gene locus_tag LOCUS_01130 121801 122637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 protein_id gnl|my_center|LOCUS_01130 124495 122921 gene locus_tag LOCUS_01140 gene gshA 124495 122921 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_01140 125038 125946 gene locus_tag LOCUS_01150 gene pbpG 125038 125946 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707427.1 protein_id gnl|my_center|LOCUS_01150 128383 126293 gene locus_tag LOCUS_01160 128383 126293 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_01160 129353 128472 gene locus_tag LOCUS_01170 129353 128472 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_01170 131057 129486 gene locus_tag LOCUS_01180 131057 129486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 131851 131054 gene locus_tag LOCUS_01190 gene mazG 131851 131054 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_01190 132188 134110 gene locus_tag LOCUS_01200 132188 134110 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_01200 134167 135432 gene locus_tag LOCUS_01210 134167 135432 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099579.1 protein_id gnl|my_center|LOCUS_01210 135503 137083 gene locus_tag LOCUS_01220 135503 137083 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_01220 137114 138325 gene locus_tag LOCUS_01230 137114 138325 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_01230 138424 139158 gene locus_tag LOCUS_01240 138424 139158 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462636.1 protein_id gnl|my_center|LOCUS_01240 139268 141595 gene locus_tag LOCUS_01250 139268 141595 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_01250 141585 142379 gene locus_tag LOCUS_01260 141585 142379 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_01260 142489 143754 gene locus_tag LOCUS_01270 142489 143754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_01270 144094 144840 gene locus_tag LOCUS_01280 144094 144840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 146338 145223 gene locus_tag LOCUS_01290 gene thiH 146338 145223 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_01290 147122 146343 gene locus_tag LOCUS_01300 147122 146343 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962601.1 protein_id gnl|my_center|LOCUS_01300 147363 147166 gene locus_tag LOCUS_01310 147363 147166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 149255 147372 gene locus_tag LOCUS_01320 gene thiC 149255 147372 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_01320 149371 149550 gene locus_tag LOCUS_01330 149371 149550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 150061 149714 gene locus_tag LOCUS_01340 150061 149714 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706891.1 protein_id gnl|my_center|LOCUS_01340 150610 151383 gene locus_tag LOCUS_01350 150610 151383 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_01350 151622 152302 gene locus_tag LOCUS_01360 151622 152302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 152293 153777 gene locus_tag LOCUS_01370 152293 153777 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_01370 153774 154463 gene locus_tag LOCUS_01380 153774 154463 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_01380 154675 154806 gene locus_tag LOCUS_01390 154675 154806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 154803 155609 gene locus_tag LOCUS_01400 154803 155609 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_01400 156582 155884 gene locus_tag LOCUS_01410 156582 155884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 157468 156590 gene locus_tag LOCUS_01420 gene htpX 157468 156590 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_01420 157883 158944 gene locus_tag LOCUS_01430 157883 158944 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_01430 161834 159243 gene locus_tag LOCUS_01440 161834 159243 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_01440 162546 162097 gene locus_tag LOCUS_01450 162546 162097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 162810 163214 gene locus_tag LOCUS_01460 162810 163214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 163218 163619 gene locus_tag LOCUS_01470 163218 163619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 163815 164318 gene locus_tag LOCUS_01480 gene nuoI 163815 164318 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_01480 164914 164582 gene locus_tag LOCUS_01490 164914 164582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 166609 165179 gene locus_tag LOCUS_01500 166609 165179 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970749.1 protein_id gnl|my_center|LOCUS_01500 167342 166986 gene locus_tag LOCUS_01510 167342 166986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 168964 167789 gene locus_tag LOCUS_01520 gene tal 168964 167789 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_01520 169788 169381 gene locus_tag LOCUS_01530 169788 169381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 170573 169968 gene locus_tag LOCUS_01540 170573 169968 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446889.1 protein_id gnl|my_center|LOCUS_01540 170887 171159 gene locus_tag LOCUS_01550 170887 171159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 171701 171997 gene locus_tag LOCUS_01560 171701 171997 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_01560 173396 172200 gene locus_tag LOCUS_01570 173396 172200 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_01570 173519 173995 gene locus_tag LOCUS_01580 173519 173995 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_01580 174361 174795 gene locus_tag LOCUS_01590 gene zntR 174361 174795 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_01590 174825 177347 gene locus_tag LOCUS_01600 174825 177347 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_01600 177584 177784 gene locus_tag LOCUS_01610 177584 177784 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198960.1 protein_id gnl|my_center|LOCUS_01610 178116 179534 gene locus_tag LOCUS_01620 178116 179534 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650522.1 protein_id gnl|my_center|LOCUS_01620 180237 179785 gene locus_tag LOCUS_01630 180237 179785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 180964 180476 gene locus_tag LOCUS_01640 180964 180476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 183324 181441 gene locus_tag LOCUS_01650 183324 181441 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390407.1 protein_id gnl|my_center|LOCUS_01650 184723 183698 gene locus_tag LOCUS_01660 184723 183698 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 protein_id gnl|my_center|LOCUS_01660 185607 185050 gene locus_tag LOCUS_01670 185607 185050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 185851 185594 gene locus_tag LOCUS_01680 185851 185594 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106029.1 protein_id gnl|my_center|LOCUS_01680 186966 186058 gene locus_tag LOCUS_01690 186966 186058 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 protein_id gnl|my_center|LOCUS_01690 187570 186983 gene locus_tag LOCUS_01700 187570 186983 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_01700 188022 189896 gene locus_tag LOCUS_01710 188022 189896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 190993 190001 gene locus_tag LOCUS_01720 190993 190001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 192735 191005 gene locus_tag LOCUS_01730 192735 191005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 193630 192764 gene locus_tag LOCUS_01740 193630 192764 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_01740 197118 193633 gene locus_tag LOCUS_01750 197118 193633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_01750 198038 197115 gene locus_tag LOCUS_01760 198038 197115 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_01760 198235 198035 gene locus_tag LOCUS_01770 198235 198035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 199599 198427 gene locus_tag LOCUS_01780 199599 198427 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_01780 199811 200143 gene locus_tag LOCUS_01790 199811 200143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 201395 200187 gene locus_tag LOCUS_01800 201395 200187 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_01800 201661 201392 gene locus_tag LOCUS_01810 201661 201392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 203456 202005 gene locus_tag LOCUS_01820 203456 202005 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_01820 204465 203461 gene locus_tag LOCUS_01830 204465 203461 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_01830 206286 204919 gene locus_tag LOCUS_01840 206286 204919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_01840 208566 207070 gene locus_tag LOCUS_01850 208566 207070 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_01850 210269 208563 gene locus_tag LOCUS_01860 210269 208563 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_01860 211324 210281 gene locus_tag LOCUS_01870 gene hypE 211324 210281 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_01870 212762 211620 gene locus_tag LOCUS_01880 gene hypD 212762 211620 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_01880 213108 212872 gene locus_tag LOCUS_01890 213108 212872 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_01890 213991 213350 gene locus_tag LOCUS_01900 213991 213350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 214016 214336 gene locus_tag LOCUS_01910 214016 214336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 214620 214279 gene locus_tag LOCUS_01920 gene hypA 214620 214279 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_01920 216322 215105 gene locus_tag LOCUS_01930 216322 215105 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_01930 217560 217045 gene locus_tag LOCUS_01940 217560 217045 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096572.1 protein_id gnl|my_center|LOCUS_01940 218523 217900 gene locus_tag LOCUS_01950 218523 217900 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480654.1 protein_id gnl|my_center|LOCUS_01950 222371 218760 gene locus_tag LOCUS_01960 222371 218760 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_01960 223735 222431 gene locus_tag LOCUS_01970 223735 222431 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 protein_id gnl|my_center|LOCUS_01970 224306 223737 gene locus_tag LOCUS_01980 224306 223737 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811094.1 protein_id gnl|my_center|LOCUS_01980 225307 224306 gene locus_tag LOCUS_01990 225307 224306 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_01990 225469 226224 gene locus_tag LOCUS_02000 gene modA 225469 226224 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_02000 231400 226304 gene locus_tag LOCUS_02010 231400 226304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 233264 231387 gene locus_tag LOCUS_02020 gene treZ 233264 231387 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_02020 236613 233308 gene locus_tag LOCUS_02030 gene treS 236613 233308 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 protein_id gnl|my_center|LOCUS_02030 237585 236953 gene locus_tag LOCUS_02040 237585 236953 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_02040 238896 237667 gene locus_tag LOCUS_02050 238896 237667 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067368.1 protein_id gnl|my_center|LOCUS_02050 239018 239989 gene locus_tag LOCUS_02060 239018 239989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 239986 241059 gene locus_tag LOCUS_02070 239986 241059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 241193 242182 gene locus_tag LOCUS_02080 241193 242182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_02080 242185 243147 gene locus_tag LOCUS_02090 242185 243147 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_02090 244139 243438 gene locus_tag LOCUS_02100 gene tsaB 244139 243438 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_02100 244487 245830 gene locus_tag LOCUS_02110 244487 245830 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_02110 245852 246439 gene locus_tag LOCUS_02120 gene pncA 245852 246439 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942927.1 protein_id gnl|my_center|LOCUS_02120 246569 246961 gene locus_tag LOCUS_02130 246569 246961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 249218 247260 gene locus_tag LOCUS_02140 249218 247260 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_02140 249694 249227 gene locus_tag LOCUS_02150 249694 249227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 250346 249807 gene locus_tag LOCUS_02160 250346 249807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 252718 250343 gene locus_tag LOCUS_02170 gene mrcB 252718 250343 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_02170 253459 252788 gene locus_tag LOCUS_02180 253459 252788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444495.1 protein_id gnl|my_center|LOCUS_02180 253754 254176 gene locus_tag LOCUS_02190 253754 254176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 254234 254464 gene locus_tag LOCUS_02200 254234 254464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 254854 254360 gene locus_tag LOCUS_02210 254854 254360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 256034 254847 gene locus_tag LOCUS_02220 256034 254847 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103855.1 protein_id gnl|my_center|LOCUS_02220 256409 256146 gene locus_tag LOCUS_02230 256409 256146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 256535 257407 gene locus_tag LOCUS_02240 256535 257407 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_02240 257455 258081 gene locus_tag LOCUS_02250 257455 258081 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705976.1 protein_id gnl|my_center|LOCUS_02250 258924 258331 gene locus_tag LOCUS_02260 258924 258331 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_02260 259718 259245 gene locus_tag LOCUS_02270 259718 259245 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869573.1 protein_id gnl|my_center|LOCUS_02270 260116 260991 gene locus_tag LOCUS_02280 260116 260991 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207718.1 protein_id gnl|my_center|LOCUS_02280 261346 261990 gene locus_tag LOCUS_02290 261346 261990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173306.1 protein_id gnl|my_center|LOCUS_02290 262586 261969 gene locus_tag LOCUS_02300 262586 261969 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705445.1 protein_id gnl|my_center|LOCUS_02300 262877 263827 gene locus_tag LOCUS_02310 262877 263827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 263989 264555 gene locus_tag LOCUS_02320 263989 264555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 264956 265198 gene locus_tag LOCUS_02330 264956 265198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 265412 266026 gene locus_tag LOCUS_02340 265412 266026 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 protein_id gnl|my_center|LOCUS_02340 266053 266841 gene locus_tag LOCUS_02350 266053 266841 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390647.1 protein_id gnl|my_center|LOCUS_02350 268258 266981 gene locus_tag LOCUS_02360 268258 266981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 268692 268354 gene locus_tag LOCUS_02370 268692 268354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 269516 269193 gene locus_tag LOCUS_02380 gene nirD 269516 269193 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_02380 271956 269518 gene locus_tag LOCUS_02390 gene nirB 271956 269518 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_02390 272330 273796 gene locus_tag LOCUS_02400 272330 273796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 273909 275618 gene locus_tag LOCUS_02410 273909 275618 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_02410 275996 277015 gene locus_tag LOCUS_02420 275996 277015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 278671 277205 gene locus_tag LOCUS_02430 gene boxB 278671 277205 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_02430 280325 278676 gene locus_tag LOCUS_02440 gene boxC 280325 278676 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_02440 281859 280936 gene locus_tag LOCUS_02450 281859 280936 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_02450 281960 282436 gene locus_tag LOCUS_02460 281960 282436 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_02460 282482 282646 gene locus_tag LOCUS_02470 gene rubA 282482 282646 CDS product rubredoxin RubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760495.1 protein_id gnl|my_center|LOCUS_02470 282797 283939 gene locus_tag LOCUS_02480 282797 283939 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_02480 284013 284192 gene locus_tag LOCUS_02490 284013 284192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 284820 284272 gene locus_tag LOCUS_02500 284820 284272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 285106 284813 gene locus_tag LOCUS_02510 285106 284813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 285692 285177 gene locus_tag LOCUS_02520 285692 285177 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221954.1 protein_id gnl|my_center|LOCUS_02520 287706 286006 gene locus_tag LOCUS_02530 gene hybC 287706 286006 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817177.1 protein_id gnl|my_center|LOCUS_02530 288882 287743 gene locus_tag LOCUS_02540 gene hybB 288882 287743 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 protein_id gnl|my_center|LOCUS_02540 289904 288879 gene locus_tag LOCUS_02550 gene hybA 289904 288879 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706349.1 protein_id gnl|my_center|LOCUS_02550 291047 289914 gene locus_tag LOCUS_02560 gene hybO 291047 289914 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173957.1 protein_id gnl|my_center|LOCUS_02560 291522 292430 gene locus_tag LOCUS_02570 291522 292430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 292495 293775 gene locus_tag LOCUS_02580 292495 293775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 295293 294016 gene locus_tag LOCUS_02590 295293 294016 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_02590 295732 296439 gene locus_tag LOCUS_02600 295732 296439 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_02600 296447 297958 gene locus_tag LOCUS_02610 296447 297958 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_02610 298106 300883 gene locus_tag LOCUS_02620 298106 300883 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_02620 302296 301235 gene locus_tag LOCUS_02630 302296 301235 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 protein_id gnl|my_center|LOCUS_02630 304981 302345 gene locus_tag LOCUS_02640 gene pepN 304981 302345 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_02640 306537 305227 gene locus_tag LOCUS_02650 306537 305227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 306699 306968 gene locus_tag LOCUS_02660 gene grxC 306699 306968 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369179.1 protein_id gnl|my_center|LOCUS_02660 306965 307357 gene locus_tag LOCUS_02670 gene hslR 306965 307357 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660720.1 protein_id gnl|my_center|LOCUS_02670 307624 308067 gene locus_tag LOCUS_02680 307624 308067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 308495 310552 gene locus_tag LOCUS_02690 gene fusA 308495 310552 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_02690 311127 310804 gene locus_tag LOCUS_02700 311127 310804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 312641 311247 gene locus_tag LOCUS_02710 gene cobB 312641 311247 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_02710 314100 312895 gene locus_tag LOCUS_02720 gene hmeB 314100 312895 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_02720 314893 314120 gene locus_tag LOCUS_02730 gene hmeA 314893 314120 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_02730 315411 314896 gene locus_tag LOCUS_02740 315411 314896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 317375 315420 gene locus_tag LOCUS_02750 317375 315420 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_02750 319007 317463 gene locus_tag LOCUS_02760 319007 317463 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_02760 319780 319061 gene locus_tag LOCUS_02770 gene dsrM 319780 319061 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02770 320312 319980 gene locus_tag LOCUS_02780 320312 319980 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_02780 320669 320361 gene locus_tag LOCUS_02790 gene tusB 320669 320361 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_02790 321071 320682 gene locus_tag LOCUS_02800 gene tusC 321071 320682 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_02800 321480 321088 gene locus_tag LOCUS_02810 gene tusD 321480 321088 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_02810 322580 321507 gene locus_tag LOCUS_02820 gene dsrB 322580 321507 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_02820 323927 322683 gene locus_tag LOCUS_02830 gene dsrA 323927 322683 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_02830 324598 324774 gene locus_tag LOCUS_02840 324598 324774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 324803 325507 gene locus_tag LOCUS_02850 324803 325507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 325521 326180 gene locus_tag LOCUS_02860 325521 326180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 326560 326904 gene locus_tag LOCUS_02870 gene tusE 326560 326904 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301417.1 protein_id gnl|my_center|LOCUS_02870 327936 327271 gene locus_tag LOCUS_02880 327936 327271 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080380.1 protein_id gnl|my_center|LOCUS_02880 329405 327933 gene locus_tag LOCUS_02890 329405 327933 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022191.1 protein_id gnl|my_center|LOCUS_02890 332222 329709 gene locus_tag LOCUS_02900 332222 329709 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_02900 332556 333110 gene locus_tag LOCUS_02910 332556 333110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 333259 334773 gene locus_tag LOCUS_02920 333259 334773 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262402.1 protein_id gnl|my_center|LOCUS_02920 335220 335696 gene locus_tag LOCUS_02930 gene soxY 335220 335696 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_02930 335778 336092 gene locus_tag LOCUS_02940 gene soxZ 335778 336092 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_02940 337134 336193 gene locus_tag LOCUS_02950 337134 336193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 338966 337131 gene locus_tag LOCUS_02960 338966 337131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 340120 339218 gene locus_tag LOCUS_02970 340120 339218 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_02970 340224 340652 gene locus_tag LOCUS_02980 340224 340652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 340827 343523 gene locus_tag LOCUS_02990 340827 343523 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_02990 343584 344036 gene locus_tag LOCUS_03000 343584 344036 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_03000 345735 344323 gene locus_tag LOCUS_03010 345735 344323 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_03010 346131 347432 gene locus_tag LOCUS_03020 gene mtaB 346131 347432 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03020 347425 348177 gene locus_tag LOCUS_03030 347425 348177 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707267.1 protein_id gnl|my_center|LOCUS_03030 348883 348515 gene locus_tag LOCUS_03040 348883 348515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 349705 348890 gene locus_tag LOCUS_03050 gene xthA 349705 348890 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_03050 350053 350823 gene locus_tag LOCUS_03060 350053 350823 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_03060 351381 351034 gene locus_tag LOCUS_03070 351381 351034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 351532 351672 gene locus_tag LOCUS_03080 351532 351672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 351937 352404 gene locus_tag LOCUS_03090 351937 352404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 352594 353337 gene locus_tag LOCUS_03100 gene fnr 352594 353337 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_03100 353778 353703 gene locus_tag LOCUS_t00020 353778 353703 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 355097 353835 gene locus_tag LOCUS_03110 355097 353835 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965785.1 protein_id gnl|my_center|LOCUS_03110 355900 355232 gene locus_tag LOCUS_03120 gene queC 355900 355232 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_03120 356800 356159 gene locus_tag LOCUS_03130 gene queE 356800 356159 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_03130 357760 356843 gene locus_tag LOCUS_03140 357760 356843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 358320 357784 gene locus_tag LOCUS_03150 gene pal 358320 357784 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_03150 359654 358317 gene locus_tag LOCUS_03160 gene tolB 359654 358317 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_03160 360640 359654 gene locus_tag LOCUS_03170 360640 359654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 361073 360648 gene locus_tag LOCUS_03180 gene tolR 361073 360648 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_03180 361781 361107 gene locus_tag LOCUS_03190 gene tolQ 361781 361107 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_03190 362194 361781 gene locus_tag LOCUS_03200 gene ybgC 362194 361781 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_03200 363305 362265 gene locus_tag LOCUS_03210 gene ruvB 363305 362265 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 protein_id gnl|my_center|LOCUS_03210 363916 363302 gene locus_tag LOCUS_03220 gene ruvA 363916 363302 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_03220 364431 363913 gene locus_tag LOCUS_03230 gene ruvC 364431 363913 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 protein_id gnl|my_center|LOCUS_03230 365277 364531 gene locus_tag LOCUS_03240 365277 364531 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020411.1 protein_id gnl|my_center|LOCUS_03240 365972 365385 gene locus_tag LOCUS_03250 365972 365385 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_03250 366365 367858 gene locus_tag LOCUS_03260 366365 367858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 367930 368538 gene locus_tag LOCUS_03270 367930 368538 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071224.1 protein_id gnl|my_center|LOCUS_03270 368621 369259 gene locus_tag LOCUS_03280 368621 369259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 370053 369478 gene locus_tag LOCUS_03290 370053 369478 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_03290 372655 370094 gene locus_tag LOCUS_03300 372655 370094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 372942 373187 gene locus_tag LOCUS_03310 372942 373187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 373739 373386 gene locus_tag LOCUS_03320 373739 373386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 373901 374368 gene locus_tag LOCUS_03330 373901 374368 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_03330 375442 374378 gene locus_tag LOCUS_03340 gene lptG 375442 374378 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 protein_id gnl|my_center|LOCUS_03340 376548 375439 gene locus_tag LOCUS_03350 gene lptF 376548 375439 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_03350 376775 378274 gene locus_tag LOCUS_03360 gene pepA 376775 378274 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209310.1 protein_id gnl|my_center|LOCUS_03360 378271 378696 gene locus_tag LOCUS_03370 gene holC 378271 378696 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_03370 378875 379267 gene locus_tag LOCUS_03380 378875 379267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 381688 379436 gene locus_tag LOCUS_03390 gene parC 381688 379436 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_03390 381723 382010 gene locus_tag LOCUS_03400 381723 382010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 382809 382132 gene locus_tag LOCUS_03410 382809 382132 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_03410 383071 384366 gene locus_tag LOCUS_03420 383071 384366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_03420 384975 384385 gene locus_tag LOCUS_03430 384975 384385 CDS product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195111.1 protein_id gnl|my_center|LOCUS_03430 386904 385015 gene locus_tag LOCUS_03440 gene parE 386904 385015 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_03440 387079 387333 gene locus_tag LOCUS_03450 387079 387333 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 protein_id gnl|my_center|LOCUS_03450 387317 388225 gene locus_tag LOCUS_03460 387317 388225 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_03460 389013 388423 gene locus_tag LOCUS_03470 389013 388423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 389228 389010 gene locus_tag LOCUS_03480 389228 389010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 390085 389225 gene locus_tag LOCUS_03490 390085 389225 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_03490 390811 390386 gene locus_tag LOCUS_03500 390811 390386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 391684 390950 gene locus_tag LOCUS_03510 391684 390950 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_03510 392364 391681 gene locus_tag LOCUS_03520 gene cybH 392364 391681 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_03520 394179 392383 gene locus_tag LOCUS_03530 394179 392383 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 protein_id gnl|my_center|LOCUS_03530 395255 394176 gene locus_tag LOCUS_03540 395255 394176 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_03540 395822 396619 gene locus_tag LOCUS_03550 gene folE2 395822 396619 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_03550 397960 396698 gene locus_tag LOCUS_03560 397960 396698 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_03560 398960 398253 gene locus_tag LOCUS_03570 398960 398253 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_03570 402220 398957 gene locus_tag LOCUS_03580 402220 398957 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_03580 402919 402248 gene locus_tag LOCUS_03590 402919 402248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 404190 402919 gene locus_tag LOCUS_03600 404190 402919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_03600 405553 404486 gene locus_tag LOCUS_03610 405553 404486 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_03610 406197 405553 gene locus_tag LOCUS_03620 406197 405553 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_03620 406766 406197 gene locus_tag LOCUS_03630 406766 406197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence002 70 453 gene locus_tag LOCUS_03640 70 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 914 552 gene locus_tag LOCUS_03650 914 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1527 2009 gene locus_tag LOCUS_03660 1527 2009 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_03660 2197 2655 gene locus_tag LOCUS_03670 2197 2655 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_03670 3277 3930 gene locus_tag LOCUS_03680 3277 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4671 5645 gene locus_tag LOCUS_03690 4671 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 7509 5722 gene locus_tag LOCUS_03700 7509 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 8669 8001 gene locus_tag LOCUS_03710 8669 8001 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_03710 9089 8754 gene locus_tag LOCUS_03720 9089 8754 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720923.1 protein_id gnl|my_center|LOCUS_03720 9205 9363 gene locus_tag LOCUS_03730 9205 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 10058 9360 gene locus_tag LOCUS_03740 10058 9360 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_03740 10536 11621 gene locus_tag LOCUS_03750 10536 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 12858 11728 gene locus_tag LOCUS_03760 12858 11728 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947289.1 protein_id gnl|my_center|LOCUS_03760 13909 12929 gene locus_tag LOCUS_03770 13909 12929 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 protein_id gnl|my_center|LOCUS_03770 14990 13902 gene locus_tag LOCUS_03780 gene pdhA 14990 13902 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957708.1 protein_id gnl|my_center|LOCUS_03780 15330 15917 gene locus_tag LOCUS_03790 15330 15917 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_03790 19113 16024 gene locus_tag LOCUS_03800 19113 16024 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_03800 20294 19110 gene locus_tag LOCUS_03810 20294 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 20941 20378 gene locus_tag LOCUS_03820 20941 20378 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368954.1 protein_id gnl|my_center|LOCUS_03820 21155 21544 gene locus_tag LOCUS_03830 21155 21544 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_03830 21628 22224 gene locus_tag LOCUS_03840 21628 22224 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_03840 22646 23395 gene locus_tag LOCUS_03850 gene sfsA 22646 23395 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545814.1 protein_id gnl|my_center|LOCUS_03850 23623 25062 gene locus_tag LOCUS_03860 gene ccoN 23623 25062 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 protein_id gnl|my_center|LOCUS_03860 25077 25769 gene locus_tag LOCUS_03870 gene ccoO 25077 25769 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_03870 25762 25974 gene locus_tag LOCUS_03880 25762 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 25964 26806 gene locus_tag LOCUS_03890 gene ccoP 25964 26806 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_03890 27050 27175 gene locus_tag LOCUS_03900 27050 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 27376 28806 gene locus_tag LOCUS_03910 gene ccoG 27376 28806 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971694.1 protein_id gnl|my_center|LOCUS_03910 28898 29410 gene locus_tag LOCUS_03920 28898 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 29407 31881 gene locus_tag LOCUS_03930 29407 31881 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_03930 32086 32325 gene locus_tag LOCUS_03940 32086 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 32362 32670 gene locus_tag LOCUS_03950 32362 32670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 33643 32948 gene locus_tag LOCUS_03960 33643 32948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 33787 33945 gene locus_tag LOCUS_03970 33787 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 34810 33953 gene locus_tag LOCUS_03980 34810 33953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088420.1 protein_id gnl|my_center|LOCUS_03980 35550 34807 gene locus_tag LOCUS_03990 35550 34807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_03990 36542 35547 gene locus_tag LOCUS_04000 36542 35547 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_04000 37438 36539 gene locus_tag LOCUS_04010 37438 36539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 38744 37503 gene locus_tag LOCUS_04020 38744 37503 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_04020 39012 39560 gene locus_tag LOCUS_04030 39012 39560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 40380 39688 gene locus_tag LOCUS_04040 40380 39688 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_04040 41069 40410 gene locus_tag LOCUS_04050 gene senC 41069 40410 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_04050 42326 41298 gene locus_tag LOCUS_04060 42326 41298 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_04060 42387 43769 gene locus_tag LOCUS_04070 42387 43769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880043.1 protein_id gnl|my_center|LOCUS_04070 44691 43774 gene locus_tag LOCUS_04080 gene cyoE 44691 43774 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_04080 45307 44678 gene locus_tag LOCUS_04090 45307 44678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 46005 45307 gene locus_tag LOCUS_04100 46005 45307 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995706.1 protein_id gnl|my_center|LOCUS_04100 46306 46521 gene locus_tag LOCUS_04110 46306 46521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 47655 46783 gene locus_tag LOCUS_04120 47655 46783 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_04120 48272 47685 gene locus_tag LOCUS_04130 48272 47685 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_04130 48409 48269 gene locus_tag LOCUS_04140 48409 48269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 50016 48406 gene locus_tag LOCUS_04150 gene ctaD 50016 48406 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_04150 51167 50031 gene locus_tag LOCUS_04160 gene coxB 51167 50031 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948583.1 protein_id gnl|my_center|LOCUS_04160 51802 52611 gene locus_tag LOCUS_04170 51802 52611 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_04170 52897 54123 gene locus_tag LOCUS_04180 52897 54123 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_04180 54211 55473 gene locus_tag LOCUS_04190 gene lysA 54211 55473 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_04190 56625 55825 gene locus_tag LOCUS_04200 56625 55825 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_04200 57110 58528 gene locus_tag LOCUS_04210 57110 58528 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_04210 61677 59038 gene locus_tag LOCUS_04220 61677 59038 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_04220 62480 61692 gene locus_tag LOCUS_04230 gene map 62480 61692 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_04230 62861 63622 gene locus_tag LOCUS_04240 gene rpsB 62861 63622 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_04240 63879 64766 gene locus_tag LOCUS_04250 gene tsf 63879 64766 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_04250 65079 65804 gene locus_tag LOCUS_04260 gene pyrH 65079 65804 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_04260 65797 66354 gene locus_tag LOCUS_04270 gene frr 65797 66354 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_04270 66516 67280 gene locus_tag LOCUS_04280 gene uppS 66516 67280 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_04280 67283 68104 gene locus_tag LOCUS_04290 67283 68104 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_04290 68101 69279 gene locus_tag LOCUS_04300 gene ispC 68101 69279 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_04300 69289 70713 gene locus_tag LOCUS_04310 gene rseP 69289 70713 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_04310 70989 73298 gene locus_tag LOCUS_04320 gene bamA 70989 73298 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_04320 73315 73833 gene locus_tag LOCUS_04330 73315 73833 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_04330 73843 74901 gene locus_tag LOCUS_04340 gene lpxD 73843 74901 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_04340 75024 75464 gene locus_tag LOCUS_04350 gene fabZ 75024 75464 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_04350 75461 76231 gene locus_tag LOCUS_04360 gene lpxA 75461 76231 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314305.1 protein_id gnl|my_center|LOCUS_04360 76393 77550 gene locus_tag LOCUS_04370 gene lpxB 76393 77550 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266979.1 protein_id gnl|my_center|LOCUS_04370 77550 78128 gene locus_tag LOCUS_04380 gene rnhB 77550 78128 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_04380 78732 82304 gene locus_tag LOCUS_04390 gene dnaE 78732 82304 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_04390 82842 83798 gene locus_tag LOCUS_04400 gene accA 82842 83798 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_04400 84363 85724 gene locus_tag LOCUS_04410 gene tilS 84363 85724 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_04410 86026 86514 gene locus_tag LOCUS_04420 86026 86514 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 protein_id gnl|my_center|LOCUS_04420 87019 87447 gene locus_tag LOCUS_04430 87019 87447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 87632 88177 gene locus_tag LOCUS_04440 87632 88177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 88308 89243 gene locus_tag LOCUS_04450 88308 89243 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073804.1 protein_id gnl|my_center|LOCUS_04450 89240 89662 gene locus_tag LOCUS_04460 89240 89662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 89756 93658 gene locus_tag LOCUS_04470 89756 93658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 95233 94187 gene locus_tag LOCUS_04480 95233 94187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 95637 96701 gene locus_tag LOCUS_04490 gene prfB 95637 96701 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 protein_id gnl|my_center|LOCUS_04490 97035 98531 gene locus_tag LOCUS_04500 gene lysS 97035 98531 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_04500 99593 98760 gene locus_tag LOCUS_04510 99593 98760 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_04510 100944 99901 gene locus_tag LOCUS_04520 100944 99901 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 protein_id gnl|my_center|LOCUS_04520 101258 103048 gene locus_tag LOCUS_04530 101258 103048 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_04530 103239 103436 gene locus_tag LOCUS_04540 103239 103436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 103483 105297 gene locus_tag LOCUS_04550 103483 105297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 105299 105493 gene locus_tag LOCUS_04560 105299 105493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 106050 105517 gene locus_tag LOCUS_04570 gene ybaK 106050 105517 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943709.1 protein_id gnl|my_center|LOCUS_04570 106110 108629 gene locus_tag LOCUS_04580 gene hrpB 106110 108629 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_04580 109094 110002 gene locus_tag LOCUS_04590 109094 110002 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_04590 112504 110024 gene locus_tag LOCUS_04600 112504 110024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04600 112691 112942 gene locus_tag LOCUS_04610 112691 112942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 112939 114156 gene locus_tag LOCUS_04620 112939 114156 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_04620 115471 114410 gene locus_tag LOCUS_04630 115471 114410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 117046 115490 gene locus_tag LOCUS_04640 117046 115490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 118114 117056 gene locus_tag LOCUS_04650 118114 117056 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_04650 119070 118273 gene locus_tag LOCUS_04660 119070 118273 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence003 >Feature sequence004 <1 519 gene locus_tag LOCUS_04670 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004666649.1:IS21-like element ISPsy14 family transposase 541 1296 gene locus_tag LOCUS_04680 gene istB 541 1296 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence005 352 759 gene locus_tag LOCUS_04690 352 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 811 1164 gene locus_tag LOCUS_04700 811 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence006 95 1351 gene locus_tag LOCUS_04710 95 1351 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence007 >Feature sequence008 >Feature sequence009 >Feature sequence010 869 465 gene locus_tag LOCUS_04720 869 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence011 >Feature sequence012 >Feature sequence013 84 1061 gene locus_tag LOCUS_04730 gene fabD 84 1061 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_04730 1230 1412 gene locus_tag LOCUS_04740 1230 1412 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_04740 2330 1419 gene locus_tag LOCUS_04750 2330 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2430 2831 gene locus_tag LOCUS_04760 2430 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3118 4869 gene locus_tag LOCUS_04770 3118 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6405 5248 gene locus_tag LOCUS_04780 6405 5248 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_04780 7616 6405 gene locus_tag LOCUS_04790 7616 6405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_04790 7767 7627 gene locus_tag LOCUS_04800 7767 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9997 7838 gene locus_tag LOCUS_04810 9997 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 10897 10451 gene locus_tag LOCUS_04820 10897 10451 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_04820 11535 10894 gene locus_tag LOCUS_04830 gene can 11535 10894 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_04830 12041 11643 gene locus_tag LOCUS_04840 gene mce 12041 11643 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_04840 13424 12429 gene locus_tag LOCUS_04850 gene meaB 13424 12429 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_04850 15413 13431 gene locus_tag LOCUS_04860 15413 13431 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_04860 15856 15470 gene locus_tag LOCUS_04870 15856 15470 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_04870 17424 15892 gene locus_tag LOCUS_04880 17424 15892 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_04880 19849 17693 gene locus_tag LOCUS_04890 gene scpA 19849 17693 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_04890 21842 19947 gene locus_tag LOCUS_04900 21842 19947 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_04900 22302 22745 gene locus_tag LOCUS_04910 22302 22745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 23547 22774 gene locus_tag LOCUS_04920 23547 22774 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_04920 24422 23547 gene locus_tag LOCUS_04930 24422 23547 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_04930 24843 25274 gene locus_tag LOCUS_04940 24843 25274 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531344.1 protein_id gnl|my_center|LOCUS_04940 25345 26019 gene locus_tag LOCUS_04950 25345 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 26935 26309 gene locus_tag LOCUS_04960 26935 26309 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_04960 28304 27009 gene locus_tag LOCUS_04970 28304 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 29571 28468 gene locus_tag LOCUS_04980 gene tyrA 29571 28468 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 protein_id gnl|my_center|LOCUS_04980 30304 29690 gene locus_tag LOCUS_04990 30304 29690 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_04990 31470 30301 gene locus_tag LOCUS_05000 31470 30301 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_05000 31905 31474 gene locus_tag LOCUS_05010 31905 31474 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_05010 34018 32366 gene locus_tag LOCUS_05020 34018 32366 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879262.1 protein_id gnl|my_center|LOCUS_05020 34207 37914 gene locus_tag LOCUS_05030 gene metH 34207 37914 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_05030 38308 38772 gene locus_tag LOCUS_05040 38308 38772 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_05040 38881 41199 gene locus_tag LOCUS_05050 38881 41199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 41426 42307 gene locus_tag LOCUS_05060 41426 42307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 42327 42680 gene locus_tag LOCUS_05070 42327 42680 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137417.1 protein_id gnl|my_center|LOCUS_05070 42809 43912 gene locus_tag LOCUS_05080 gene zapE 42809 43912 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_05080 43909 44106 gene locus_tag LOCUS_05090 43909 44106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 44200 44418 gene locus_tag LOCUS_05100 44200 44418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 44406 45596 gene locus_tag LOCUS_05110 44406 45596 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_05110 45620 45754 gene locus_tag LOCUS_05120 45620 45754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 45929 46993 gene locus_tag LOCUS_05130 45929 46993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 48157 47132 gene locus_tag LOCUS_05140 gene hemE 48157 47132 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_05140 49120 48566 gene locus_tag LOCUS_05150 49120 48566 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266710.1 protein_id gnl|my_center|LOCUS_05150 50641 49178 gene locus_tag LOCUS_05160 50641 49178 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198129.1 protein_id gnl|my_center|LOCUS_05160 51834 50638 gene locus_tag LOCUS_05170 51834 50638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 52256 51831 gene locus_tag LOCUS_05180 52256 51831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 53999 52548 gene locus_tag LOCUS_05190 53999 52548 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_05190 58642 54002 gene locus_tag LOCUS_05200 gene gltB 58642 54002 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_05200 60695 58890 gene locus_tag LOCUS_05210 60695 58890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 61786 60692 gene locus_tag LOCUS_05220 gene aroB 61786 60692 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_05220 62574 62092 gene locus_tag LOCUS_05230 gene aroK 62574 62092 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_05230 65025 62986 gene locus_tag LOCUS_05240 65025 62986 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_05240 65803 65270 gene locus_tag LOCUS_05250 gene pilP 65803 65270 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_05250 66387 65803 gene locus_tag LOCUS_05260 66387 65803 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_05260 66941 66384 gene locus_tag LOCUS_05270 66941 66384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 68019 66943 gene locus_tag LOCUS_05280 68019 66943 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105329.1 protein_id gnl|my_center|LOCUS_05280 68244 70628 gene locus_tag LOCUS_05290 68244 70628 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_05290 70795 71400 gene locus_tag LOCUS_05300 70795 71400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 72692 71397 gene locus_tag LOCUS_05310 gene gltA 72692 71397 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975314.1 protein_id gnl|my_center|LOCUS_05310 73450 73247 gene locus_tag LOCUS_05320 gene rpmE 73450 73247 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946387.1 protein_id gnl|my_center|LOCUS_05320 73916 73554 gene locus_tag LOCUS_05330 73916 73554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 75407 74244 gene locus_tag LOCUS_05340 gene hemW 75407 74244 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_05340 75536 76726 gene locus_tag LOCUS_05350 75536 76726 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 protein_id gnl|my_center|LOCUS_05350 78078 77146 gene locus_tag LOCUS_05360 gene mdh 78078 77146 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 protein_id gnl|my_center|LOCUS_05360 78377 80665 gene locus_tag LOCUS_05370 78377 80665 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086918.1 protein_id gnl|my_center|LOCUS_05370 80949 82058 gene locus_tag LOCUS_05380 80949 82058 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_05380 83527 82148 gene locus_tag LOCUS_05390 83527 82148 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_05390 84078 83524 gene locus_tag LOCUS_05400 84078 83524 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_05400 84368 85756 gene locus_tag LOCUS_05410 84368 85756 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_05410 85765 86403 gene locus_tag LOCUS_05420 85765 86403 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390717.1 protein_id gnl|my_center|LOCUS_05420 86412 87080 gene locus_tag LOCUS_05430 gene rluA 86412 87080 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073570.1 protein_id gnl|my_center|LOCUS_05430 89818 87653 gene locus_tag LOCUS_05440 gene uvrD 89818 87653 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070819.1 protein_id gnl|my_center|LOCUS_05440 91704 90175 gene locus_tag LOCUS_05450 gene fadD5 91704 90175 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_05450 92689 92132 gene locus_tag LOCUS_05460 92689 92132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 92769 93098 gene locus_tag LOCUS_05470 92769 93098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 93342 94457 gene locus_tag LOCUS_05480 93342 94457 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_05480 94491 96203 gene locus_tag LOCUS_05490 94491 96203 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_05490 96333 97268 gene locus_tag LOCUS_05500 96333 97268 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_05500 97625 97834 gene locus_tag LOCUS_05510 97625 97834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 97872 98615 gene locus_tag LOCUS_05520 97872 98615 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_05520 99346 98678 gene locus_tag LOCUS_05530 99346 98678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 100376 99405 gene locus_tag LOCUS_05540 100376 99405 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087563.1 protein_id gnl|my_center|LOCUS_05540 100718 101290 gene locus_tag LOCUS_05550 100718 101290 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396060.1 protein_id gnl|my_center|LOCUS_05550 102018 101287 gene locus_tag LOCUS_05560 102018 101287 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088544.1 protein_id gnl|my_center|LOCUS_05560 102839 102324 gene locus_tag LOCUS_05570 102839 102324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 103445 102849 gene locus_tag LOCUS_05580 103445 102849 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635400.1 protein_id gnl|my_center|LOCUS_05580 105402 103882 gene locus_tag LOCUS_05590 gene nhaC 105402 103882 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338014.1 protein_id gnl|my_center|LOCUS_05590 107236 106310 gene locus_tag LOCUS_05600 107236 106310 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_05600 107917 107240 gene locus_tag LOCUS_05610 107917 107240 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172761.1 protein_id gnl|my_center|LOCUS_05610 108570 107926 gene locus_tag LOCUS_05620 gene cysC 108570 107926 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_05620 108861 109436 gene locus_tag LOCUS_05630 108861 109436 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 protein_id gnl|my_center|LOCUS_05630 109630 109454 gene locus_tag LOCUS_05640 109630 109454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 111034 109931 gene locus_tag LOCUS_05650 111034 109931 CDS product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_05650 112299 111031 gene locus_tag LOCUS_05660 112299 111031 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_05660 113257 112679 gene locus_tag LOCUS_05670 113257 112679 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528179.1 protein_id gnl|my_center|LOCUS_05670 114050 113337 gene locus_tag LOCUS_05680 114050 113337 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_05680 114215 114496 gene locus_tag LOCUS_05690 114215 114496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05690 114548 115237 gene locus_tag LOCUS_05700 114548 115237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05700 >Feature sequence014 549 1166 gene locus_tag LOCUS_05710 549 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 >Feature sequence015 >Feature sequence016 >Feature sequence017 88 990 gene locus_tag LOCUS_05720 88 990 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence018 <1 1144 gene locus_tag LOCUS_05730 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118084.1:group II intron reverse transcriptase/maturase >Feature sequence019 149 766 gene locus_tag LOCUS_05740 149 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence020 71 940 gene locus_tag LOCUS_05750 71 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence021 722 531 gene locus_tag LOCUS_05760 722 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence022 314 138 gene locus_tag LOCUS_05770 314 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 <878 311 gene locus_tag LOCUS_05780 <878 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030890.1:IS21-like element helper ATPase IstB >Feature sequence023 175 762 gene locus_tag LOCUS_05790 175 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence024 829 416 gene locus_tag LOCUS_05800 829 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1111 1329 gene locus_tag LOCUS_05810 1111 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2321 1542 gene locus_tag LOCUS_05820 2321 1542 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_05820 3015 2326 gene locus_tag LOCUS_05830 3015 2326 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_05830 3298 3876 gene locus_tag LOCUS_05840 3298 3876 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_05840 3903 4523 gene locus_tag LOCUS_05850 3903 4523 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_05850 4565 4957 gene locus_tag LOCUS_05860 4565 4957 CDS product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957756.1 protein_id gnl|my_center|LOCUS_05860 5455 4985 gene locus_tag LOCUS_05870 5455 4985 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_05870 5791 6168 gene locus_tag LOCUS_05880 5791 6168 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_05880 6270 6731 gene locus_tag LOCUS_05890 6270 6731 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 protein_id gnl|my_center|LOCUS_05890 6766 6957 gene locus_tag LOCUS_05900 6766 6957 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094945.1 protein_id gnl|my_center|LOCUS_05900 7047 8762 gene locus_tag LOCUS_05910 7047 8762 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_05910 8794 9084 gene locus_tag LOCUS_05920 8794 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9752 9090 gene locus_tag LOCUS_05930 9752 9090 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_05930 10725 9799 gene locus_tag LOCUS_05940 gene hemF 10725 9799 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 protein_id gnl|my_center|LOCUS_05940 11367 10753 gene locus_tag LOCUS_05950 11367 10753 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_05950 11424 11861 gene locus_tag LOCUS_05960 11424 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 11827 12030 gene locus_tag LOCUS_05970 11827 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 12312 12034 gene locus_tag LOCUS_05980 12312 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 12229 12462 gene locus_tag LOCUS_05990 12229 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 13189 12563 gene locus_tag LOCUS_06000 13189 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 13592 13786 gene locus_tag LOCUS_06010 13592 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 13821 14258 gene locus_tag LOCUS_06020 13821 14258 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_06020 14575 15150 gene locus_tag LOCUS_06030 14575 15150 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_06030 15467 16900 gene locus_tag LOCUS_06040 15467 16900 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_06040 16963 17985 gene locus_tag LOCUS_06050 16963 17985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_06050 17997 18875 gene locus_tag LOCUS_06060 17997 18875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967299.1 protein_id gnl|my_center|LOCUS_06060 19268 20224 gene locus_tag LOCUS_06070 19268 20224 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_06070 20225 20542 gene locus_tag LOCUS_06080 20225 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 20881 21168 gene locus_tag LOCUS_06090 20881 21168 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_06090 21165 21389 gene locus_tag LOCUS_06100 21165 21389 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_06100 21740 21910 gene locus_tag LOCUS_06110 21740 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 22007 22894 gene locus_tag LOCUS_06120 22007 22894 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568382.1 protein_id gnl|my_center|LOCUS_06120 23207 23692 gene locus_tag LOCUS_06130 23207 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 23853 25112 gene locus_tag LOCUS_06140 23853 25112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 25546 26634 gene locus_tag LOCUS_06150 25546 26634 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_06150 26631 27764 gene locus_tag LOCUS_06160 26631 27764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_06160 27782 28462 gene locus_tag LOCUS_06170 27782 28462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_06170 28478 29635 gene locus_tag LOCUS_06180 gene cfa 28478 29635 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258479.1 protein_id gnl|my_center|LOCUS_06180 29732 30619 gene locus_tag LOCUS_06190 29732 30619 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297705.1 protein_id gnl|my_center|LOCUS_06190 31492 30881 gene locus_tag LOCUS_06200 31492 30881 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482721.1 protein_id gnl|my_center|LOCUS_06200 32611 31913 gene locus_tag LOCUS_06210 32611 31913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 34607 32622 gene locus_tag LOCUS_06220 34607 32622 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_06220 35475 35822 gene locus_tag LOCUS_06230 35475 35822 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 protein_id gnl|my_center|LOCUS_06230 35923 36474 gene locus_tag LOCUS_06240 35923 36474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 37948 36629 gene locus_tag LOCUS_06250 37948 36629 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_06250 38460 37945 gene locus_tag LOCUS_06260 38460 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 39515 38457 gene locus_tag LOCUS_06270 39515 38457 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_06270 41141 39564 gene locus_tag LOCUS_06280 41141 39564 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_06280 42450 41485 gene locus_tag LOCUS_06290 42450 41485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 42659 43906 gene locus_tag LOCUS_06300 42659 43906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_06300 44183 46276 gene locus_tag LOCUS_06310 44183 46276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 47756 46542 gene locus_tag LOCUS_06320 47756 46542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 48344 47775 gene locus_tag LOCUS_06330 48344 47775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 48877 48341 gene locus_tag LOCUS_06340 48877 48341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 49095 49796 gene locus_tag LOCUS_06350 49095 49796 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 protein_id gnl|my_center|LOCUS_06350 49799 51874 gene locus_tag LOCUS_06360 49799 51874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 52314 51871 gene locus_tag LOCUS_06370 52314 51871 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_06370 52745 52437 gene locus_tag LOCUS_06380 52745 52437 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329228.1 protein_id gnl|my_center|LOCUS_06380 53028 54221 gene locus_tag LOCUS_06390 53028 54221 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_06390 54554 55060 gene locus_tag LOCUS_06400 54554 55060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 55066 55782 gene locus_tag LOCUS_06410 gene trmN 55066 55782 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302911.1 protein_id gnl|my_center|LOCUS_06410 55966 58569 gene locus_tag LOCUS_06420 gene ppc 55966 58569 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 protein_id gnl|my_center|LOCUS_06420 59621 59040 gene locus_tag LOCUS_06430 59621 59040 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_06430 60639 59662 gene locus_tag LOCUS_06440 gene tal 60639 59662 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 protein_id gnl|my_center|LOCUS_06440 61162 60689 gene locus_tag LOCUS_06450 61162 60689 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_06450 61643 62401 gene locus_tag LOCUS_06460 61643 62401 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258808.1 protein_id gnl|my_center|LOCUS_06460 62418 62609 gene locus_tag LOCUS_06470 62418 62609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 62698 63099 gene locus_tag LOCUS_06480 62698 63099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 63517 63248 gene locus_tag LOCUS_06490 63517 63248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 63687 64976 gene locus_tag LOCUS_06500 63687 64976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_06500 65177 65560 gene locus_tag LOCUS_06510 65177 65560 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036534.1 protein_id gnl|my_center|LOCUS_06510 65909 65565 gene locus_tag LOCUS_06520 65909 65565 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531026.1 protein_id gnl|my_center|LOCUS_06520 65820 66032 gene locus_tag LOCUS_06530 65820 66032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 67266 66022 gene locus_tag LOCUS_06540 67266 66022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_06540 67695 68588 gene locus_tag LOCUS_06550 67695 68588 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_06550 68728 69336 gene locus_tag LOCUS_06560 gene azoR3 68728 69336 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_06560 69392 70009 gene locus_tag LOCUS_06570 69392 70009 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_06570 70006 70584 gene locus_tag LOCUS_06580 70006 70584 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_06580 71185 71913 gene locus_tag LOCUS_06590 71185 71913 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_06590 72284 71925 gene locus_tag LOCUS_06600 72284 71925 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_06600 72362 72649 gene locus_tag LOCUS_06610 72362 72649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 72801 73241 gene locus_tag LOCUS_06620 72801 73241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 73734 73417 gene locus_tag LOCUS_06630 73734 73417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 75099 74464 gene locus_tag LOCUS_06640 75099 74464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 75903 75406 gene locus_tag LOCUS_06650 75903 75406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 79680 76501 gene locus_tag LOCUS_06660 79680 76501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 80121 79681 gene locus_tag LOCUS_06670 80121 79681 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_06670 82774 80114 gene locus_tag LOCUS_06680 82774 80114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 84673 82856 gene locus_tag LOCUS_06690 84673 82856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 85770 84676 gene locus_tag LOCUS_06700 85770 84676 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_06700 88379 86394 gene locus_tag LOCUS_06710 88379 86394 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_06710 89835 89353 gene locus_tag LOCUS_06720 89835 89353 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_06720 91278 89842 gene locus_tag LOCUS_06730 91278 89842 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_06730 93583 91814 gene locus_tag LOCUS_06740 93583 91814 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_06740 94071 93889 gene locus_tag LOCUS_06750 94071 93889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 95895 94690 gene locus_tag LOCUS_06760 95895 94690 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940289.1 protein_id gnl|my_center|LOCUS_06760 98012 95892 gene locus_tag LOCUS_06770 gene pta 98012 95892 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_06770 98524 100149 gene locus_tag LOCUS_06780 98524 100149 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_06780 101322 100153 gene locus_tag LOCUS_06790 101322 100153 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957591.1 protein_id gnl|my_center|LOCUS_06790 101620 101411 gene locus_tag LOCUS_06800 101620 101411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 101790 102281 gene locus_tag LOCUS_06810 101790 102281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 102454 103488 gene locus_tag LOCUS_06820 gene dmeF 102454 103488 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969625.1 protein_id gnl|my_center|LOCUS_06820 103534 103788 gene locus_tag LOCUS_06830 103534 103788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029251.1 protein_id gnl|my_center|LOCUS_06830 103867 104661 gene locus_tag LOCUS_06840 103867 104661 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_06840 104885 105214 gene locus_tag LOCUS_06850 104885 105214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 105725 105264 gene locus_tag LOCUS_06860 105725 105264 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 protein_id gnl|my_center|LOCUS_06860 107169 106066 gene locus_tag LOCUS_06870 107169 106066 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_06870 109690 107171 gene locus_tag LOCUS_06880 109690 107171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_06880 110391 109684 gene locus_tag LOCUS_06890 110391 109684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_06890 110479 111630 gene locus_tag LOCUS_06900 110479 111630 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 protein_id gnl|my_center|LOCUS_06900 111618 112385 gene locus_tag LOCUS_06910 111618 112385 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_06910 112722 112946 gene locus_tag LOCUS_06920 112722 112946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence025 >Feature sequence026 >Feature sequence027 >Feature sequence028 145 570 gene locus_tag LOCUS_06930 145 570 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence029 686 33 gene locus_tag LOCUS_06940 gene rpiA 686 33 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence030 >Feature sequence031 >Feature sequence032 291 548 gene locus_tag LOCUS_06950 291 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence033 >Feature sequence034 >Feature sequence035 378 1304 gene locus_tag LOCUS_06960 378 1304 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216609.1 protein_id gnl|my_center|LOCUS_06960 1524 1384 gene locus_tag LOCUS_06970 1524 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3175 2129 gene locus_tag LOCUS_06980 gene lipA 3175 2129 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 protein_id gnl|my_center|LOCUS_06980 5277 3193 gene locus_tag LOCUS_06990 gene lpdA 5277 3193 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_06990 6642 5311 gene locus_tag LOCUS_07000 6642 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9358 6671 gene locus_tag LOCUS_07010 gene aceE 9358 6671 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095425939.1 protein_id gnl|my_center|LOCUS_07010 9868 10578 gene locus_tag LOCUS_07020 gene pdhR 9868 10578 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 protein_id gnl|my_center|LOCUS_07020 13980 10972 gene locus_tag LOCUS_07030 13980 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 15079 14099 gene locus_tag LOCUS_07040 15079 14099 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136856750.1 protein_id gnl|my_center|LOCUS_07040 15616 16866 gene locus_tag LOCUS_07050 15616 16866 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_07050 16863 19964 gene locus_tag LOCUS_07060 16863 19964 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_07060 19961 21103 gene locus_tag LOCUS_07070 19961 21103 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_07070 21103 24195 gene locus_tag LOCUS_07080 21103 24195 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072762.1 protein_id gnl|my_center|LOCUS_07080 24434 24772 gene locus_tag LOCUS_07090 24434 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 26020 25100 gene locus_tag LOCUS_07100 26020 25100 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_07100 26408 28525 gene locus_tag LOCUS_07110 gene pqqU 26408 28525 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_07110 29731 28730 gene locus_tag LOCUS_07120 29731 28730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 30483 29734 gene locus_tag LOCUS_07130 30483 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 30982 31512 gene locus_tag LOCUS_07140 30982 31512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 32474 31602 gene locus_tag LOCUS_07150 32474 31602 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_07150 32630 32860 gene locus_tag LOCUS_07160 32630 32860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 32914 33585 gene locus_tag LOCUS_07170 32914 33585 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970221.1 protein_id gnl|my_center|LOCUS_07170 33895 34620 gene locus_tag LOCUS_07180 33895 34620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 35132 34755 gene locus_tag LOCUS_07190 35132 34755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 36336 35143 gene locus_tag LOCUS_07200 36336 35143 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_07200 36687 39269 gene locus_tag LOCUS_07210 gene fadE 36687 39269 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_07210 39566 40105 gene locus_tag LOCUS_07220 39566 40105 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183353796.1 protein_id gnl|my_center|LOCUS_07220 40305 40721 gene locus_tag LOCUS_07230 40305 40721 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_07230 40958 42424 gene locus_tag LOCUS_07240 40958 42424 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_07240 42442 42729 gene locus_tag LOCUS_07250 42442 42729 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_07250 42747 43355 gene locus_tag LOCUS_07260 42747 43355 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_07260 43827 43432 gene locus_tag LOCUS_07270 43827 43432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 44284 44904 gene locus_tag LOCUS_07280 44284 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 45131 45331 gene locus_tag LOCUS_07290 45131 45331 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105005.1 protein_id gnl|my_center|LOCUS_07290 45430 45693 gene locus_tag LOCUS_07300 45430 45693 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_07300 46050 45856 gene locus_tag LOCUS_07310 46050 45856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 46195 45983 gene locus_tag LOCUS_07320 46195 45983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 46194 46391 gene locus_tag LOCUS_07330 46194 46391 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814443.1 protein_id gnl|my_center|LOCUS_07330 46496 48181 gene locus_tag LOCUS_07340 46496 48181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 48514 49449 gene locus_tag LOCUS_07350 48514 49449 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_07350 49459 49647 gene locus_tag LOCUS_07360 49459 49647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 49706 50161 gene locus_tag LOCUS_07370 49706 50161 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_07370 52322 50217 gene locus_tag LOCUS_07380 52322 50217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 53130 52324 gene locus_tag LOCUS_07390 53130 52324 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970966.1 protein_id gnl|my_center|LOCUS_07390 53370 55208 gene locus_tag LOCUS_07400 53370 55208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 55768 55181 gene locus_tag LOCUS_07410 55768 55181 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258090.1 protein_id gnl|my_center|LOCUS_07410 56705 58870 gene locus_tag LOCUS_07420 56705 58870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 59342 61366 gene locus_tag LOCUS_07430 59342 61366 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269423.1 protein_id gnl|my_center|LOCUS_07430 61819 61469 gene locus_tag LOCUS_07440 61819 61469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 63267 61864 gene locus_tag LOCUS_07450 gene fumC 63267 61864 CDS product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 protein_id gnl|my_center|LOCUS_07450 63442 63909 gene locus_tag LOCUS_07460 63442 63909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 64998 64492 gene locus_tag LOCUS_07470 64998 64492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 65588 65127 gene locus_tag LOCUS_07480 gene nsrR 65588 65127 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_07480 65739 66488 gene locus_tag LOCUS_07490 65739 66488 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356729.1 protein_id gnl|my_center|LOCUS_07490 67233 66592 gene locus_tag LOCUS_07500 67233 66592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 68630 67251 gene locus_tag LOCUS_07510 68630 67251 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_07510 70434 68641 gene locus_tag LOCUS_07520 70434 68641 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_07520 71081 70437 gene locus_tag LOCUS_07530 71081 70437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 71434 71084 gene locus_tag LOCUS_07540 71434 71084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 71887 71444 gene locus_tag LOCUS_07550 71887 71444 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_07550 73886 71991 gene locus_tag LOCUS_07560 73886 71991 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_07560 74922 73879 gene locus_tag LOCUS_07570 74922 73879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 75264 74941 gene locus_tag LOCUS_07580 75264 74941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 75455 75838 gene locus_tag LOCUS_07590 75455 75838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 75919 76389 gene locus_tag LOCUS_07600 75919 76389 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039876.1 protein_id gnl|my_center|LOCUS_07600 76393 76773 gene locus_tag LOCUS_07610 76393 76773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 76878 77291 gene locus_tag LOCUS_07620 76878 77291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 77662 78855 gene locus_tag LOCUS_07630 77662 78855 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257345.1 protein_id gnl|my_center|LOCUS_07630 78949 79482 gene locus_tag LOCUS_07640 78949 79482 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 protein_id gnl|my_center|LOCUS_07640 80014 79661 gene locus_tag LOCUS_07650 80014 79661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 80269 80667 gene locus_tag LOCUS_07660 80269 80667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 80673 81275 gene locus_tag LOCUS_07670 80673 81275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 81732 81349 gene locus_tag LOCUS_07680 81732 81349 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263648.1 protein_id gnl|my_center|LOCUS_07680 82212 84014 gene locus_tag LOCUS_07690 82212 84014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 84206 86455 gene locus_tag LOCUS_07700 84206 86455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 86794 87276 gene locus_tag LOCUS_07710 86794 87276 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_07710 88869 87637 gene locus_tag LOCUS_07720 88869 87637 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_07720 88754 88990 gene locus_tag LOCUS_07730 88754 88990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 90175 89450 gene locus_tag LOCUS_07740 90175 89450 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 protein_id gnl|my_center|LOCUS_07740 90873 90172 gene locus_tag LOCUS_07750 90873 90172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419416.1 protein_id gnl|my_center|LOCUS_07750 91686 90880 gene locus_tag LOCUS_07760 91686 90880 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_07760 92324 92806 gene locus_tag LOCUS_07770 92324 92806 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_07770 92822 94672 gene locus_tag LOCUS_07780 92822 94672 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_07780 94791 96047 gene locus_tag LOCUS_07790 94791 96047 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_07790 96318 96566 gene locus_tag LOCUS_07800 96318 96566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 96563 96898 gene locus_tag LOCUS_07810 96563 96898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 97737 99452 gene locus_tag LOCUS_07820 97737 99452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 99905 100228 gene locus_tag LOCUS_07830 99905 100228 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_07830 100242 100838 gene locus_tag LOCUS_07840 gene recR 100242 100838 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 protein_id gnl|my_center|LOCUS_07840 100916 101227 gene locus_tag LOCUS_07850 100916 101227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 101838 106676 gene locus_tag LOCUS_07860 101838 106676 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_07860 106988 107260 gene locus_tag LOCUS_07870 106988 107260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 107730 108437 gene locus_tag LOCUS_07880 107730 108437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_07880 108431 109918 gene locus_tag LOCUS_07890 108431 109918 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence036 <1 585 gene locus_tag LOCUS_07900 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164993978.1:IS66 family transposase >Feature sequence037 >Feature sequence038 500 132 gene locus_tag LOCUS_07910 500 132 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence039 1650 313 gene locus_tag LOCUS_07920 1650 313 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_07920 2591 1812 gene locus_tag LOCUS_07930 gene gloB 2591 1812 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262416.1 protein_id gnl|my_center|LOCUS_07930 3197 2772 gene locus_tag LOCUS_07940 gene hisI 3197 2772 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_07940 3586 4017 gene locus_tag LOCUS_07950 gene fur 3586 4017 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_07950 4031 4360 gene locus_tag LOCUS_07960 4031 4360 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_07960 4293 4535 gene locus_tag LOCUS_07970 4293 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4727 5296 gene locus_tag LOCUS_07980 4727 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 5364 5819 gene locus_tag LOCUS_07990 5364 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6239 6544 gene locus_tag LOCUS_08000 gene bolA 6239 6544 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_08000 6636 7016 gene locus_tag LOCUS_08010 6636 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7021 7896 gene locus_tag LOCUS_08020 7021 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 8263 9258 gene locus_tag LOCUS_08030 8263 9258 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_08030 9262 9603 gene locus_tag LOCUS_08040 9262 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9600 10085 gene locus_tag LOCUS_08050 9600 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10324 11592 gene locus_tag LOCUS_08060 10324 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11670 11885 gene locus_tag LOCUS_08070 11670 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 12850 11924 gene locus_tag LOCUS_08080 12850 11924 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_08080 12928 15609 gene locus_tag LOCUS_08090 12928 15609 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_08090 16885 15995 gene locus_tag LOCUS_08100 16885 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 17654 16893 gene locus_tag LOCUS_08110 17654 16893 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_08110 18073 19542 gene locus_tag LOCUS_08120 18073 19542 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_08120 19650 20837 gene locus_tag LOCUS_08130 19650 20837 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_08130 20842 21720 gene locus_tag LOCUS_08140 20842 21720 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_08140 22917 22195 gene locus_tag LOCUS_08150 22917 22195 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094769.1 protein_id gnl|my_center|LOCUS_08150 23196 23435 gene locus_tag LOCUS_08160 23196 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 24288 23449 gene locus_tag LOCUS_08170 gene nadC 24288 23449 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 protein_id gnl|my_center|LOCUS_08170 24622 24290 gene locus_tag LOCUS_08180 24622 24290 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_08180 24539 24754 gene locus_tag LOCUS_08190 24539 24754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 27044 24774 gene locus_tag LOCUS_08200 27044 24774 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_08200 27314 28063 gene locus_tag LOCUS_08210 27314 28063 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_08210 28063 28851 gene locus_tag LOCUS_08220 28063 28851 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_08220 28854 29204 gene locus_tag LOCUS_08230 28854 29204 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_08230 29201 29599 gene locus_tag LOCUS_08240 29201 29599 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_08240 29596 30180 gene locus_tag LOCUS_08250 gene ampD 29596 30180 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_08250 31064 30600 gene locus_tag LOCUS_08260 gene lspA 31064 30600 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769261.1 protein_id gnl|my_center|LOCUS_08260 33944 31116 gene locus_tag LOCUS_08270 gene ileS 33944 31116 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_08270 34928 34071 gene locus_tag LOCUS_08280 gene ribF 34928 34071 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 protein_id gnl|my_center|LOCUS_08280 34914 35045 gene locus_tag LOCUS_08290 34914 35045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 36624 35095 gene locus_tag LOCUS_08300 gene murJ 36624 35095 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_08300 37063 37323 gene locus_tag LOCUS_08310 gene rpsT 37063 37323 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_08310 38938 37811 gene locus_tag LOCUS_08320 gene proB 38938 37811 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_08320 40026 38950 gene locus_tag LOCUS_08330 gene cgtA 40026 38950 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073450.1 protein_id gnl|my_center|LOCUS_08330 40376 40119 gene locus_tag LOCUS_08340 gene rpmA 40376 40119 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_08340 40707 40393 gene locus_tag LOCUS_08350 gene rplU 40707 40393 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_08350 41282 42250 gene locus_tag LOCUS_08360 gene ispB 41282 42250 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_08360 42261 42337 gene locus_tag LOCUS_t00030 42261 42337 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42555 42824 gene locus_tag LOCUS_08370 42555 42824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 42826 43932 gene locus_tag LOCUS_08380 42826 43932 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_08380 44199 47729 gene locus_tag LOCUS_08390 44199 47729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 47932 47732 gene locus_tag LOCUS_08400 47932 47732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 49445 48012 gene locus_tag LOCUS_08410 49445 48012 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_08410 49753 52386 gene locus_tag LOCUS_08420 49753 52386 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_08420 53766 52471 gene locus_tag LOCUS_08430 53766 52471 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_08430 54346 54918 gene locus_tag LOCUS_08440 54346 54918 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124788.1 protein_id gnl|my_center|LOCUS_08440 55451 55041 gene locus_tag LOCUS_08450 55451 55041 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_08450 55690 55451 gene locus_tag LOCUS_08460 55690 55451 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_08460 55943 55867 gene locus_tag LOCUS_t00040 55943 55867 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 57273 56182 gene locus_tag LOCUS_08470 gene ychF 57273 56182 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071416.1 protein_id gnl|my_center|LOCUS_08470 57742 57440 gene locus_tag LOCUS_08480 57742 57440 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_08480 58581 57823 gene locus_tag LOCUS_08490 58581 57823 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385472.1 protein_id gnl|my_center|LOCUS_08490 59133 58747 gene locus_tag LOCUS_08500 59133 58747 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_08500 61315 59123 gene locus_tag LOCUS_08510 61315 59123 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937715.1 protein_id gnl|my_center|LOCUS_08510 61253 61432 gene locus_tag LOCUS_08520 61253 61432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 61789 61631 gene locus_tag LOCUS_08530 61789 61631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 63882 61951 gene locus_tag LOCUS_08540 gene fusA 63882 61951 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 protein_id gnl|my_center|LOCUS_08540 64538 64463 gene locus_tag LOCUS_t00050 64538 64463 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65485 64559 gene locus_tag LOCUS_08550 65485 64559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 66261 65506 gene locus_tag LOCUS_08560 66261 65506 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768914.1 protein_id gnl|my_center|LOCUS_08560 67263 66283 gene locus_tag LOCUS_08570 gene birA 67263 66283 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658158.1 protein_id gnl|my_center|LOCUS_08570 69115 67289 gene locus_tag LOCUS_08580 69115 67289 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_08580 69357 69247 gene locus_tag LOCUS_r00010 69357 69247 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 72359 69475 gene locus_tag LOCUS_r00020 72359 69475 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 72696 72621 gene locus_tag LOCUS_t00060 72696 72621 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 72810 72734 gene locus_tag LOCUS_t00070 72810 72734 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 74414 72875 gene locus_tag LOCUS_r00030 74414 72875 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 75348 75497 gene locus_tag LOCUS_08590 75348 75497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 76170 76060 gene locus_tag LOCUS_r00040 76170 76060 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 79172 76288 gene locus_tag LOCUS_r00050 79172 76288 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 79509 79434 gene locus_tag LOCUS_t00080 79509 79434 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 79623 79547 gene locus_tag LOCUS_t00090 79623 79547 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 81227 79688 gene locus_tag LOCUS_r00060 81227 79688 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 82915 81719 gene locus_tag LOCUS_08600 gene tyrS 82915 81719 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_08600 83127 84749 gene locus_tag LOCUS_08610 83127 84749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 84919 86049 gene locus_tag LOCUS_08620 84919 86049 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_08620 86187 87386 gene locus_tag LOCUS_08630 86187 87386 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_08630 88157 87702 gene locus_tag LOCUS_08640 gene ssb 88157 87702 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_08640 89602 88214 gene locus_tag LOCUS_08650 89602 88214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_08650 89780 92614 gene locus_tag LOCUS_08660 gene uvrA 89780 92614 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_08660 93533 92640 gene locus_tag LOCUS_08670 93533 92640 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_08670 94152 93763 gene locus_tag LOCUS_08680 gene rplQ 94152 93763 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417273.1 protein_id gnl|my_center|LOCUS_08680 95207 94209 gene locus_tag LOCUS_08690 gene rpoA 95207 94209 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_08690 95850 95230 gene locus_tag LOCUS_08700 gene rpsD 95850 95230 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_08700 96256 95870 gene locus_tag LOCUS_08710 gene rpsK 96256 95870 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_08710 96668 96312 gene locus_tag LOCUS_08720 gene rpsM 96668 96312 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 protein_id gnl|my_center|LOCUS_08720 98263 96914 gene locus_tag LOCUS_08730 gene secY 98263 96914 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070629.1 protein_id gnl|my_center|LOCUS_08730 98698 98264 gene locus_tag LOCUS_08740 gene rplO 98698 98264 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213341.1 protein_id gnl|my_center|LOCUS_08740 98888 98700 gene locus_tag LOCUS_08750 gene rpmD 98888 98700 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_08750 99398 98892 gene locus_tag LOCUS_08760 gene rpsE 99398 98892 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_08760 99765 99409 gene locus_tag LOCUS_08770 gene rplR 99765 99409 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 protein_id gnl|my_center|LOCUS_08770 100310 99777 gene locus_tag LOCUS_08780 gene rplF 100310 99777 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_08780 100720 100325 gene locus_tag LOCUS_08790 gene rpsH 100720 100325 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704316.1 protein_id gnl|my_center|LOCUS_08790 101133 100828 gene locus_tag LOCUS_08800 gene rpsN 101133 100828 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_08800 101689 101150 gene locus_tag LOCUS_08810 gene rplE 101689 101150 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555477.1 protein_id gnl|my_center|LOCUS_08810 102023 101703 gene locus_tag LOCUS_08820 gene rplX 102023 101703 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_08820 102402 102034 gene locus_tag LOCUS_08830 gene rplN 102402 102034 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_08830 102722 102462 gene locus_tag LOCUS_08840 gene rpsQ 102722 102462 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461671.1 protein_id gnl|my_center|LOCUS_08840 102919 102719 gene locus_tag LOCUS_08850 gene rpmC 102919 102719 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 protein_id gnl|my_center|LOCUS_08850 103332 102919 gene locus_tag LOCUS_08860 gene rplP 103332 102919 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_08860 104028 103336 gene locus_tag LOCUS_08870 gene rpsC 104028 103336 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_08870 104370 104038 gene locus_tag LOCUS_08880 gene rplV 104370 104038 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_08880 104615 104385 gene locus_tag LOCUS_08890 gene rpsS 104615 104385 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 protein_id gnl|my_center|LOCUS_08890 105464 104682 gene locus_tag LOCUS_08900 gene rplB 105464 104682 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 protein_id gnl|my_center|LOCUS_08900 105845 105549 gene locus_tag LOCUS_08910 gene rplW 105845 105549 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_08910 106456 105842 gene locus_tag LOCUS_08920 gene rplD 106456 105842 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 protein_id gnl|my_center|LOCUS_08920 107080 106463 gene locus_tag LOCUS_08930 gene rplC 107080 106463 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 protein_id gnl|my_center|LOCUS_08930 107432 107121 gene locus_tag LOCUS_08940 gene rpsJ 107432 107121 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence040 1642 542 gene locus_tag LOCUS_08950 1642 542 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_08950 1979 1635 gene locus_tag LOCUS_08960 1979 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 4252 2426 gene locus_tag LOCUS_08970 gene glmS 4252 2426 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_08970 5770 4451 gene locus_tag LOCUS_08980 gene glmU 5770 4451 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 protein_id gnl|my_center|LOCUS_08980 6350 5871 gene locus_tag LOCUS_08990 6350 5871 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669747.1 protein_id gnl|my_center|LOCUS_08990 6837 7838 gene locus_tag LOCUS_09000 gene dctP 6837 7838 CDS product TRAP transporter solute-binding subunit DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476112.1 protein_id gnl|my_center|LOCUS_09000 7924 8550 gene locus_tag LOCUS_09010 7924 8550 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_09010 8553 9911 gene locus_tag LOCUS_09020 8553 9911 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 protein_id gnl|my_center|LOCUS_09020 9932 10510 gene locus_tag LOCUS_09030 9932 10510 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_09030 12282 10870 gene locus_tag LOCUS_09040 12282 10870 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 protein_id gnl|my_center|LOCUS_09040 14150 12279 gene locus_tag LOCUS_09050 14150 12279 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391770.1 protein_id gnl|my_center|LOCUS_09050 14939 14517 gene locus_tag LOCUS_09060 14939 14517 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770045.1 protein_id gnl|my_center|LOCUS_09060 16335 14959 gene locus_tag LOCUS_09070 gene atpD 16335 14959 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_09070 17284 16424 gene locus_tag LOCUS_09080 gene atpG 17284 16424 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_09080 18863 17322 gene locus_tag LOCUS_09090 gene atpA 18863 17322 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_09090 19416 18877 gene locus_tag LOCUS_09100 19416 18877 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_09100 19896 19426 gene locus_tag LOCUS_09110 19896 19426 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_09110 20194 19955 gene locus_tag LOCUS_09120 20194 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 21111 20251 gene locus_tag LOCUS_09130 gene atpB 21111 20251 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_09130 21507 21139 gene locus_tag LOCUS_09140 21507 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 22539 21655 gene locus_tag LOCUS_09150 22539 21655 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_09150 23377 22592 gene locus_tag LOCUS_09160 23377 22592 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377884.1 protein_id gnl|my_center|LOCUS_09160 23880 23587 gene locus_tag LOCUS_09170 23880 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 24061 24441 gene locus_tag LOCUS_09180 24061 24441 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212127.1 protein_id gnl|my_center|LOCUS_09180 25117 24668 gene locus_tag LOCUS_09190 25117 24668 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158145.1 protein_id gnl|my_center|LOCUS_09190 25964 25314 gene locus_tag LOCUS_09200 gene rsmG 25964 25314 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 protein_id gnl|my_center|LOCUS_09200 27832 25961 gene locus_tag LOCUS_09210 gene mnmG 27832 25961 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212259.1 protein_id gnl|my_center|LOCUS_09210 29058 27949 gene locus_tag LOCUS_09220 29058 27949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_09220 30176 29064 gene locus_tag LOCUS_09230 30176 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 31891 30173 gene locus_tag LOCUS_09240 31891 30173 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_09240 32923 31904 gene locus_tag LOCUS_09250 32923 31904 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_09250 33567 32920 gene locus_tag LOCUS_09260 33567 32920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 34015 33788 gene locus_tag LOCUS_09270 34015 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 36102 34081 gene locus_tag LOCUS_09280 36102 34081 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_09280 36682 37599 gene locus_tag LOCUS_09290 36682 37599 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_09290 37596 38546 gene locus_tag LOCUS_09300 37596 38546 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_09300 38543 40513 gene locus_tag LOCUS_09310 38543 40513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09310 41527 40949 gene locus_tag LOCUS_09320 41527 40949 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_09320 42456 41569 gene locus_tag LOCUS_09330 42456 41569 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_09330 43677 42568 gene locus_tag LOCUS_09340 43677 42568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 43838 44686 gene locus_tag LOCUS_09350 43838 44686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 45252 44683 gene locus_tag LOCUS_09360 45252 44683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 46702 45401 gene locus_tag LOCUS_09370 gene mnmE 46702 45401 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 protein_id gnl|my_center|LOCUS_09370 48461 46761 gene locus_tag LOCUS_09380 gene yidC 48461 46761 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_09380 48823 48560 gene locus_tag LOCUS_09390 48823 48560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 49474 50952 gene locus_tag LOCUS_09400 gene dnaA 49474 50952 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_09400 51237 52277 gene locus_tag LOCUS_09410 gene dnaN 51237 52277 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_09410 52377 53447 gene locus_tag LOCUS_09420 gene recF 52377 53447 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_09420 54028 56433 gene locus_tag LOCUS_09430 gene gyrB 54028 56433 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_09430 57245 56535 gene locus_tag LOCUS_09440 57245 56535 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_09440 57793 57242 gene locus_tag LOCUS_09450 gene gmhB 57793 57242 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_09450 60011 57864 gene locus_tag LOCUS_09460 gene glyS 60011 57864 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401442.1 protein_id gnl|my_center|LOCUS_09460 60849 60004 gene locus_tag LOCUS_09470 gene glyQ 60849 60004 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_09470 61306 62349 gene locus_tag LOCUS_09480 61306 62349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_09480 62346 62579 gene locus_tag LOCUS_09490 62346 62579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 62585 63736 gene locus_tag LOCUS_09500 62585 63736 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_09500 64081 65487 gene locus_tag LOCUS_09510 gene glnA 64081 65487 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_09510 65798 66487 gene locus_tag LOCUS_09520 65798 66487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 66679 67773 gene locus_tag LOCUS_09530 gene ntrB 66679 67773 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_09530 67760 69172 gene locus_tag LOCUS_09540 gene ntrC 67760 69172 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_09540 69413 69811 gene locus_tag LOCUS_09550 69413 69811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 70612 70091 gene locus_tag LOCUS_09560 gene resA 70612 70091 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_09560 71912 70650 gene locus_tag LOCUS_09570 71912 70650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 72989 72021 gene locus_tag LOCUS_09580 72989 72021 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369312.1 protein_id gnl|my_center|LOCUS_09580 73007 73501 gene locus_tag LOCUS_09590 gene trmL 73007 73501 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932351.1 protein_id gnl|my_center|LOCUS_09590 74490 73480 gene locus_tag LOCUS_09600 gene gpsA 74490 73480 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482209.1 protein_id gnl|my_center|LOCUS_09600 74976 74497 gene locus_tag LOCUS_09610 gene secB 74976 74497 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 protein_id gnl|my_center|LOCUS_09610 75442 75020 gene locus_tag LOCUS_09620 75442 75020 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_09620 76370 76002 gene locus_tag LOCUS_09630 76370 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 76757 78322 gene locus_tag LOCUS_09640 gene gpmI 76757 78322 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_09640 78322 79614 gene locus_tag LOCUS_09650 78322 79614 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_09650 79611 80930 gene locus_tag LOCUS_09660 gene cptA 79611 80930 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_09660 80932 81759 gene locus_tag LOCUS_09670 80932 81759 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_09670 81705 82253 gene locus_tag LOCUS_09680 81705 82253 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_09680 83877 82702 gene locus_tag LOCUS_09690 83877 82702 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_09690 84120 85586 gene locus_tag LOCUS_09700 84120 85586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 87611 85956 gene locus_tag LOCUS_09710 gene ubiB 87611 85956 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_09710 88240 87608 gene locus_tag LOCUS_09720 88240 87608 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_09720 89006 88257 gene locus_tag LOCUS_09730 gene ubiE 89006 88257 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 protein_id gnl|my_center|LOCUS_09730 89700 89335 gene locus_tag LOCUS_09740 89700 89335 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247553.1 protein_id gnl|my_center|LOCUS_09740 91044 89716 gene locus_tag LOCUS_09750 gene hslU 91044 89716 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_09750 91602 91057 gene locus_tag LOCUS_09760 gene hslV 91602 91057 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_09760 91713 92015 gene locus_tag LOCUS_09770 91713 92015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 92018 93013 gene locus_tag LOCUS_09780 92018 93013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 93321 94985 gene locus_tag LOCUS_09790 93321 94985 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 protein_id gnl|my_center|LOCUS_09790 95280 101489 gene locus_tag LOCUS_09800 95280 101489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 101486 102214 gene locus_tag LOCUS_09810 101486 102214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence041 501 411 gene locus_tag LOCUS_t00100 501 411 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1162 692 gene locus_tag LOCUS_09820 1162 692 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531541.1 protein_id gnl|my_center|LOCUS_09820 1400 2236 gene locus_tag LOCUS_09830 1400 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2384 3127 gene locus_tag LOCUS_09840 2384 3127 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_09840 3170 3508 gene locus_tag LOCUS_09850 3170 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3533 4309 gene locus_tag LOCUS_09860 3533 4309 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084305.1 protein_id gnl|my_center|LOCUS_09860 4336 6399 gene locus_tag LOCUS_09870 4336 6399 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_09870 7068 6814 gene locus_tag LOCUS_09880 7068 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7863 7114 gene locus_tag LOCUS_09890 7863 7114 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_09890 8268 7900 gene locus_tag LOCUS_09900 8268 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8765 9229 gene locus_tag LOCUS_09910 8765 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9295 11388 gene locus_tag LOCUS_09920 gene phaC 9295 11388 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_09920 12202 11534 gene locus_tag LOCUS_09930 12202 11534 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_09930 13287 12748 gene locus_tag LOCUS_09940 13287 12748 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_09940 14118 13342 gene locus_tag LOCUS_09950 14118 13342 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_09950 14724 14167 gene locus_tag LOCUS_09960 14724 14167 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270468.1 protein_id gnl|my_center|LOCUS_09960 14916 15599 gene locus_tag LOCUS_09970 gene modB 14916 15599 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_09970 15596 16675 gene locus_tag LOCUS_09980 gene modC 15596 16675 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 protein_id gnl|my_center|LOCUS_09980 17202 16672 gene locus_tag LOCUS_09990 17202 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 17947 17204 gene locus_tag LOCUS_10000 17947 17204 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_10000 18534 18223 gene locus_tag LOCUS_10010 18534 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 19469 19104 gene locus_tag LOCUS_10020 19469 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 19653 19480 gene locus_tag LOCUS_10030 19653 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 20162 19680 gene locus_tag LOCUS_10040 20162 19680 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_10040 20970 20236 gene locus_tag LOCUS_10050 20970 20236 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_10050 21767 20967 gene locus_tag LOCUS_10060 21767 20967 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_10060 22594 21764 gene locus_tag LOCUS_10070 gene motD 22594 21764 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_10070 23334 22594 gene locus_tag LOCUS_10080 23334 22594 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_10080 24385 23336 gene locus_tag LOCUS_10090 24385 23336 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985860.1 protein_id gnl|my_center|LOCUS_10090 26656 24470 gene locus_tag LOCUS_10100 26656 24470 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262350.1 protein_id gnl|my_center|LOCUS_10100 27382 26669 gene locus_tag LOCUS_10110 27382 26669 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 protein_id gnl|my_center|LOCUS_10110 27802 27416 gene locus_tag LOCUS_10120 gene cheY 27802 27416 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_10120 28587 27847 gene locus_tag LOCUS_10130 gene fliA 28587 27847 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_10130 29423 28584 gene locus_tag LOCUS_10140 gene fleN 29423 28584 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_10140 30705 29458 gene locus_tag LOCUS_10150 gene flhF 30705 29458 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114281.1 protein_id gnl|my_center|LOCUS_10150 33160 31058 gene locus_tag LOCUS_10160 gene flhA 33160 31058 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_10160 34316 33180 gene locus_tag LOCUS_10170 gene flhB 34316 33180 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_10170 35099 34320 gene locus_tag LOCUS_10180 gene fliR 35099 34320 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_10180 35384 35115 gene locus_tag LOCUS_10190 35384 35115 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554277.1 protein_id gnl|my_center|LOCUS_10190 36134 35397 gene locus_tag LOCUS_10200 gene fliP 36134 35397 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083052.1 protein_id gnl|my_center|LOCUS_10200 36556 36131 gene locus_tag LOCUS_10210 36556 36131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 36975 36553 gene locus_tag LOCUS_10220 gene fliN 36975 36553 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083049.1 protein_id gnl|my_center|LOCUS_10220 38013 37003 gene locus_tag LOCUS_10230 gene fliM 38013 37003 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 protein_id gnl|my_center|LOCUS_10230 38530 38018 gene locus_tag LOCUS_10240 gene fliL 38530 38018 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 protein_id gnl|my_center|LOCUS_10240 39661 38975 gene locus_tag LOCUS_10250 39661 38975 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_10250 40957 39665 gene locus_tag LOCUS_10260 40957 39665 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_10260 43759 40982 gene locus_tag LOCUS_10270 43759 40982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 44048 46366 gene locus_tag LOCUS_10280 44048 46366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 46382 47065 gene locus_tag LOCUS_10290 46382 47065 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_10290 47265 47453 gene locus_tag LOCUS_10300 47265 47453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 48539 47481 gene locus_tag LOCUS_10310 48539 47481 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_10310 48955 48566 gene locus_tag LOCUS_10320 48955 48566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 49872 48958 gene locus_tag LOCUS_10330 49872 48958 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_10330 50985 50050 gene locus_tag LOCUS_10340 50985 50050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 51263 52504 gene locus_tag LOCUS_10350 51263 52504 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_10350 53106 52627 gene locus_tag LOCUS_10360 53106 52627 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_10360 53380 53150 gene locus_tag LOCUS_10370 53380 53150 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568544.1 protein_id gnl|my_center|LOCUS_10370 53863 53543 gene locus_tag LOCUS_10380 53863 53543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 54310 55743 gene locus_tag LOCUS_10390 gene cysG 54310 55743 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_10390 55801 56349 gene locus_tag LOCUS_10400 55801 56349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 57403 56483 gene locus_tag LOCUS_10410 57403 56483 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_10410 58413 57418 gene locus_tag LOCUS_10420 58413 57418 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_10420 59011 59403 gene locus_tag LOCUS_10430 59011 59403 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272895.1 protein_id gnl|my_center|LOCUS_10430 60181 59423 gene locus_tag LOCUS_10440 gene anr 60181 59423 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_10440 61377 60403 gene locus_tag LOCUS_10450 gene rpoS 61377 60403 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_10450 62321 61422 gene locus_tag LOCUS_10460 62321 61422 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_10460 62950 62366 gene locus_tag LOCUS_10470 62950 62366 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_10470 63612 62950 gene locus_tag LOCUS_10480 63612 62950 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 protein_id gnl|my_center|LOCUS_10480 64361 63609 gene locus_tag LOCUS_10490 gene surE 64361 63609 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947013.1 protein_id gnl|my_center|LOCUS_10490 64576 65073 gene locus_tag LOCUS_10500 64576 65073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 66098 65031 gene locus_tag LOCUS_10510 gene truD 66098 65031 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_10510 68482 66557 gene locus_tag LOCUS_10520 68482 66557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 69111 68635 gene locus_tag LOCUS_10530 gene ispF 69111 68635 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266985.1 protein_id gnl|my_center|LOCUS_10530 69483 69827 gene locus_tag LOCUS_10540 69483 69827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 70555 69845 gene locus_tag LOCUS_10550 gene ispD 70555 69845 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_10550 70845 70552 gene locus_tag LOCUS_10560 gene ftsB 70845 70552 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377835.1 protein_id gnl|my_center|LOCUS_10560 72274 70997 gene locus_tag LOCUS_10570 gene eno 72274 70997 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_10570 73340 72507 gene locus_tag LOCUS_10580 gene kdsA 73340 72507 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_10580 74986 73337 gene locus_tag LOCUS_10590 74986 73337 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_10590 75556 76317 gene locus_tag LOCUS_10600 gene fnr 75556 76317 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077129.1 protein_id gnl|my_center|LOCUS_10600 77046 76321 gene locus_tag LOCUS_10610 gene dnaQ 77046 76321 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_10610 77491 77051 gene locus_tag LOCUS_10620 gene rnhA 77491 77051 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_10620 78280 77492 gene locus_tag LOCUS_10630 78280 77492 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_10630 78543 80219 gene locus_tag LOCUS_10640 78543 80219 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_10640 82649 80628 gene locus_tag LOCUS_10650 82649 80628 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_10650 84089 82677 gene locus_tag LOCUS_10660 84089 82677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958494.1 protein_id gnl|my_center|LOCUS_10660 85066 84089 gene locus_tag LOCUS_10670 85066 84089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_10670 87216 85063 gene locus_tag LOCUS_10680 87216 85063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_10680 87705 88481 gene locus_tag LOCUS_10690 gene fabI 87705 88481 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_10690 90463 88544 gene locus_tag LOCUS_10700 gene ppiD 90463 88544 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 protein_id gnl|my_center|LOCUS_10700 90619 90543 gene locus_tag LOCUS_t00110 90619 90543 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 90700 90625 gene locus_tag LOCUS_t00120 90700 90625 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 90984 90712 gene locus_tag LOCUS_10710 gene hupB 90984 90712 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_10710 93792 91339 gene locus_tag LOCUS_10720 gene lon 93792 91339 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_10720 95628 94357 gene locus_tag LOCUS_10730 gene clpX 95628 94357 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_10730 96446 95802 gene locus_tag LOCUS_10740 gene clpP 96446 95802 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_10740 97797 96472 gene locus_tag LOCUS_10750 gene tig 97797 96472 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence042 164 1696 gene locus_tag LOCUS_10760 164 1696 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_10760 1847 2140 gene locus_tag LOCUS_10770 1847 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2373 2134 gene locus_tag LOCUS_10780 2373 2134 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_10780 3148 3843 gene locus_tag LOCUS_10790 3148 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3836 4840 gene locus_tag LOCUS_10800 3836 4840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_10800 5031 5972 gene locus_tag LOCUS_10810 5031 5972 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_10810 5974 7503 gene locus_tag LOCUS_10820 5974 7503 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_10820 7508 7987 gene locus_tag LOCUS_10830 7508 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 7984 10620 gene locus_tag LOCUS_10840 7984 10620 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_10840 10636 11004 gene locus_tag LOCUS_10850 10636 11004 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_10850 12409 11237 gene locus_tag LOCUS_10860 12409 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 12508 13164 gene locus_tag LOCUS_10870 12508 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13740 13192 gene locus_tag LOCUS_10880 gene nudE 13740 13192 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 protein_id gnl|my_center|LOCUS_10880 13791 14444 gene locus_tag LOCUS_10890 gene yrfG 13791 14444 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_10890 14948 14571 gene locus_tag LOCUS_10900 14948 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16329 14953 gene locus_tag LOCUS_10910 16329 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 16668 17000 gene locus_tag LOCUS_10920 gene trxA 16668 17000 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_10920 17181 18437 gene locus_tag LOCUS_10930 gene rho 17181 18437 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769919.1 protein_id gnl|my_center|LOCUS_10930 18663 19607 gene locus_tag LOCUS_10940 18663 19607 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_10940 19597 19989 gene locus_tag LOCUS_10950 19597 19989 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504647.1 protein_id gnl|my_center|LOCUS_10950 20078 21550 gene locus_tag LOCUS_10960 20078 21550 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_10960 21882 22769 gene locus_tag LOCUS_10970 gene galU 21882 22769 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_10970 22889 23581 gene locus_tag LOCUS_10980 22889 23581 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_10980 23784 24074 gene locus_tag LOCUS_10990 23784 24074 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022662.1 protein_id gnl|my_center|LOCUS_10990 24128 25777 gene locus_tag LOCUS_11000 gene groL 24128 25777 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_11000 26366 26806 gene locus_tag LOCUS_11010 26366 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 26932 29778 gene locus_tag LOCUS_11020 gene glnE 26932 29778 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_11020 29956 30879 gene locus_tag LOCUS_11030 gene ilvE 29956 30879 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_11030 30921 31880 gene locus_tag LOCUS_11040 30921 31880 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_11040 31950 32837 gene locus_tag LOCUS_11050 31950 32837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 33105 34064 gene locus_tag LOCUS_11060 33105 34064 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_11060 34061 35074 gene locus_tag LOCUS_11070 34061 35074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 35098 36288 gene locus_tag LOCUS_11080 35098 36288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 36897 36310 gene locus_tag LOCUS_11090 gene gmhA 36897 36310 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194315.1 protein_id gnl|my_center|LOCUS_11090 37685 36894 gene locus_tag LOCUS_11100 37685 36894 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_11100 38869 37682 gene locus_tag LOCUS_11110 38869 37682 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_11110 40254 38866 gene locus_tag LOCUS_11120 gene hldE 40254 38866 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 protein_id gnl|my_center|LOCUS_11120 41542 40613 gene locus_tag LOCUS_11130 41542 40613 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267129.1 protein_id gnl|my_center|LOCUS_11130 43490 41733 gene locus_tag LOCUS_11140 gene msbA 43490 41733 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_11140 43832 44131 gene locus_tag LOCUS_11150 43832 44131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 44128 44646 gene locus_tag LOCUS_11160 44128 44646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 44893 45204 gene locus_tag LOCUS_11170 44893 45204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 45201 45704 gene locus_tag LOCUS_11180 45201 45704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 46357 45863 gene locus_tag LOCUS_11190 gene rfaH 46357 45863 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_11190 46709 47044 gene locus_tag LOCUS_11200 46709 47044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 47225 48274 gene locus_tag LOCUS_11210 gene wlbA 47225 48274 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_11210 48276 48857 gene locus_tag LOCUS_11220 gene wbpD 48276 48857 CDS product UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 protein_id gnl|my_center|LOCUS_11220 48854 49960 gene locus_tag LOCUS_11230 gene wlbC 48854 49960 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_11230 49965 51056 gene locus_tag LOCUS_11240 gene wecB 49965 51056 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_11240 51084 52022 gene locus_tag LOCUS_11250 51084 52022 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_11250 52037 52969 gene locus_tag LOCUS_11260 52037 52969 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038685.1 protein_id gnl|my_center|LOCUS_11260 52976 54034 gene locus_tag LOCUS_11270 52976 54034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447870.1 protein_id gnl|my_center|LOCUS_11270 54040 55254 gene locus_tag LOCUS_11280 54040 55254 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125470.1 protein_id gnl|my_center|LOCUS_11280 55255 56256 gene locus_tag LOCUS_11290 55255 56256 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957832.1 protein_id gnl|my_center|LOCUS_11290 56253 57437 gene locus_tag LOCUS_11300 56253 57437 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807055.1 protein_id gnl|my_center|LOCUS_11300 57437 59314 gene locus_tag LOCUS_11310 gene asnB 57437 59314 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927303.1 protein_id gnl|my_center|LOCUS_11310 59337 60029 gene locus_tag LOCUS_11320 59337 60029 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_11320 60026 61090 gene locus_tag LOCUS_11330 60026 61090 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_11330 61114 62274 gene locus_tag LOCUS_11340 61114 62274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 62723 62583 gene locus_tag LOCUS_11350 62723 62583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 62931 63647 gene locus_tag LOCUS_11360 62931 63647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 63644 64303 gene locus_tag LOCUS_11370 63644 64303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 64306 65013 gene locus_tag LOCUS_11380 64306 65013 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_11380 65111 66301 gene locus_tag LOCUS_11390 65111 66301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 66595 67458 gene locus_tag LOCUS_11400 66595 67458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 67455 68672 gene locus_tag LOCUS_11410 67455 68672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064740.1 protein_id gnl|my_center|LOCUS_11410 68672 69454 gene locus_tag LOCUS_11420 68672 69454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038682.1 protein_id gnl|my_center|LOCUS_11420 69470 70306 gene locus_tag LOCUS_11430 69470 70306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 70287 71603 gene locus_tag LOCUS_11440 70287 71603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 71646 73538 gene locus_tag LOCUS_11450 gene asnB 71646 73538 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_11450 73557 74873 gene locus_tag LOCUS_11460 73557 74873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 75087 75848 gene locus_tag LOCUS_11470 75087 75848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_11470 75845 76402 gene locus_tag LOCUS_11480 75845 76402 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 protein_id gnl|my_center|LOCUS_11480 76663 78258 gene locus_tag LOCUS_11490 gene pgi 76663 78258 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225136.1 protein_id gnl|my_center|LOCUS_11490 78483 78776 gene locus_tag LOCUS_11500 78483 78776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 78760 79278 gene locus_tag LOCUS_11510 78760 79278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_11510 79588 79887 gene locus_tag LOCUS_11520 79588 79887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 79884 80372 gene locus_tag LOCUS_11530 79884 80372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 80464 80628 gene locus_tag LOCUS_11540 80464 80628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 80687 82057 gene locus_tag LOCUS_11550 80687 82057 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_11550 82258 84207 gene locus_tag LOCUS_11560 82258 84207 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_11560 84415 85734 gene locus_tag LOCUS_11570 gene waaA 84415 85734 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_11570 85988 86260 gene locus_tag LOCUS_11580 85988 86260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 87274 86612 gene locus_tag LOCUS_11590 87274 86612 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_11590 87810 89174 gene locus_tag LOCUS_11600 87810 89174 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_11600 89631 91403 gene locus_tag LOCUS_11610 89631 91403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 94764 91867 gene locus_tag LOCUS_11620 gene rapA 94764 91867 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063652658.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence043 494 1165 gene locus_tag LOCUS_11630 494 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1481 1801 gene locus_tag LOCUS_11640 1481 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1903 2292 gene locus_tag LOCUS_11650 1903 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2681 3142 gene locus_tag LOCUS_11660 2681 3142 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368597.1 protein_id gnl|my_center|LOCUS_11660 3146 5308 gene locus_tag LOCUS_11670 3146 5308 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538282.1 protein_id gnl|my_center|LOCUS_11670 5368 6351 gene locus_tag LOCUS_11680 5368 6351 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_11680 6348 6953 gene locus_tag LOCUS_11690 6348 6953 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_11690 6943 7854 gene locus_tag LOCUS_11700 6943 7854 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_11700 8499 7945 gene locus_tag LOCUS_11710 8499 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 9692 8823 gene locus_tag LOCUS_11720 9692 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9891 10523 gene locus_tag LOCUS_11730 9891 10523 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389278.1 protein_id gnl|my_center|LOCUS_11730 11328 10582 gene locus_tag LOCUS_11740 11328 10582 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405475.1 protein_id gnl|my_center|LOCUS_11740 11947 11510 gene locus_tag LOCUS_11750 11947 11510 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_11750 13924 12050 gene locus_tag LOCUS_11760 13924 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 14713 14207 gene locus_tag LOCUS_11770 14713 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 15332 14718 gene locus_tag LOCUS_11780 15332 14718 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_11780 15877 15674 gene locus_tag LOCUS_11790 gene cspE 15877 15674 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221949.1 protein_id gnl|my_center|LOCUS_11790 17171 16176 gene locus_tag LOCUS_11800 17171 16176 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_11800 21349 17621 gene locus_tag LOCUS_11810 21349 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 23433 21484 gene locus_tag LOCUS_11820 23433 21484 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_11820 23868 23512 gene locus_tag LOCUS_11830 23868 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 24386 23886 gene locus_tag LOCUS_11840 24386 23886 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_11840 26014 24647 gene locus_tag LOCUS_11850 26014 24647 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_11850 26642 26019 gene locus_tag LOCUS_11860 26642 26019 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_11860 27787 26699 gene locus_tag LOCUS_11870 27787 26699 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_11870 29606 28209 gene locus_tag LOCUS_11880 29606 28209 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083712.1 protein_id gnl|my_center|LOCUS_11880 30955 30143 gene locus_tag LOCUS_11890 30955 30143 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_11890 31655 31050 gene locus_tag LOCUS_11900 gene cobO 31655 31050 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_11900 33230 32112 gene locus_tag LOCUS_11910 gene ald 33230 32112 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_11910 33632 34519 gene locus_tag LOCUS_11920 33632 34519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_11920 34523 35527 gene locus_tag LOCUS_11930 34523 35527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_11930 36147 35662 gene locus_tag LOCUS_11940 36147 35662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 36270 36827 gene locus_tag LOCUS_11950 gene sigZ 36270 36827 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 protein_id gnl|my_center|LOCUS_11950 36911 37705 gene locus_tag LOCUS_11960 36911 37705 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_11960 38210 37770 gene locus_tag LOCUS_11970 38210 37770 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 protein_id gnl|my_center|LOCUS_11970 39152 38547 gene locus_tag LOCUS_11980 39152 38547 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_11980 40588 39284 gene locus_tag LOCUS_11990 40588 39284 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_11990 40932 40582 gene locus_tag LOCUS_12000 40932 40582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 41314 43257 gene locus_tag LOCUS_12010 41314 43257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 43259 43822 gene locus_tag LOCUS_12020 43259 43822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 43819 45438 gene locus_tag LOCUS_12030 43819 45438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 45438 45875 gene locus_tag LOCUS_12040 45438 45875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_12040 45966 47693 gene locus_tag LOCUS_12050 45966 47693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 48661 47903 gene locus_tag LOCUS_12060 48661 47903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 49197 50774 gene locus_tag LOCUS_12070 49197 50774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 50776 51150 gene locus_tag LOCUS_12080 50776 51150 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_12080 51147 52343 gene locus_tag LOCUS_12090 51147 52343 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_12090 52345 52848 gene locus_tag LOCUS_12100 gene gigB 52345 52848 CDS product anti-anti-sigma factor GigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 protein_id gnl|my_center|LOCUS_12100 53530 52946 gene locus_tag LOCUS_12110 53530 52946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 54069 53542 gene locus_tag LOCUS_12120 54069 53542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 55039 54569 gene locus_tag LOCUS_12130 55039 54569 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_12130 55945 55298 gene locus_tag LOCUS_12140 gene narL 55945 55298 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_12140 57531 55945 gene locus_tag LOCUS_12150 57531 55945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 59049 57901 gene locus_tag LOCUS_12160 59049 57901 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113214.1 protein_id gnl|my_center|LOCUS_12160 61067 59259 gene locus_tag LOCUS_12170 61067 59259 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_12170 61123 61464 gene locus_tag LOCUS_12180 61123 61464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 62244 61498 gene locus_tag LOCUS_12190 62244 61498 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_12190 63851 62241 gene locus_tag LOCUS_12200 63851 62241 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_12200 66293 64200 gene locus_tag LOCUS_12210 66293 64200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 66761 66315 gene locus_tag LOCUS_12220 66761 66315 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_12220 69277 66758 gene locus_tag LOCUS_12230 69277 66758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 71300 69855 gene locus_tag LOCUS_12240 71300 69855 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_12240 71472 72983 gene locus_tag LOCUS_12250 71472 72983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 72989 73714 gene locus_tag LOCUS_12260 72989 73714 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 protein_id gnl|my_center|LOCUS_12260 74700 75941 gene locus_tag LOCUS_12270 74700 75941 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_12270 76094 79294 gene locus_tag LOCUS_12280 76094 79294 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_12280 79715 80071 gene locus_tag LOCUS_12290 79715 80071 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 protein_id gnl|my_center|LOCUS_12290 80674 81027 gene locus_tag LOCUS_12300 80674 81027 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_12300 81080 81451 gene locus_tag LOCUS_12310 81080 81451 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_12310 81494 81904 gene locus_tag LOCUS_12320 81494 81904 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529094.1 protein_id gnl|my_center|LOCUS_12320 81930 82334 gene locus_tag LOCUS_12330 81930 82334 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 protein_id gnl|my_center|LOCUS_12330 82341 83624 gene locus_tag LOCUS_12340 82341 83624 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_12340 85926 83998 gene locus_tag LOCUS_12350 85926 83998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 87321 86167 gene locus_tag LOCUS_12360 87321 86167 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975326.1 protein_id gnl|my_center|LOCUS_12360 89077 87326 gene locus_tag LOCUS_12370 gene ngg 89077 87326 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389741.1 protein_id gnl|my_center|LOCUS_12370 90861 89089 gene locus_tag LOCUS_12380 90861 89089 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_12380 91011 91541 gene locus_tag LOCUS_12390 91011 91541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 92638 91637 gene locus_tag LOCUS_12400 gene epmA 92638 91637 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_12400 93212 92640 gene locus_tag LOCUS_12410 gene efp 93212 92640 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_12410 93248 94255 gene locus_tag LOCUS_12420 gene epmB 93248 94255 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228125.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence044 3086 54 gene locus_tag LOCUS_12430 3086 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3278 4273 gene locus_tag LOCUS_12440 3278 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4315 5778 gene locus_tag LOCUS_12450 4315 5778 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_12450 6488 5811 gene locus_tag LOCUS_12460 6488 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 7328 6519 gene locus_tag LOCUS_12470 7328 6519 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_12470 8188 7427 gene locus_tag LOCUS_12480 8188 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 8499 8251 gene locus_tag LOCUS_12490 8499 8251 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_12490 9555 8590 gene locus_tag LOCUS_12500 9555 8590 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929493.1 protein_id gnl|my_center|LOCUS_12500 10395 9667 gene locus_tag LOCUS_12510 10395 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 11372 10395 gene locus_tag LOCUS_12520 11372 10395 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_12520 12581 11403 gene locus_tag LOCUS_12530 12581 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 14301 13291 gene locus_tag LOCUS_12540 14301 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 15722 14349 gene locus_tag LOCUS_12550 15722 14349 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_12550 18035 15723 gene locus_tag LOCUS_12560 18035 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 19942 18035 gene locus_tag LOCUS_12570 19942 18035 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_12570 21578 20037 gene locus_tag LOCUS_12580 gene xrtA 21578 20037 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_12580 22800 21583 gene locus_tag LOCUS_12590 22800 21583 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_12590 23861 22809 gene locus_tag LOCUS_12600 23861 22809 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_12600 24727 23861 gene locus_tag LOCUS_12610 24727 23861 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_12610 25865 24729 gene locus_tag LOCUS_12620 gene wecB 25865 24729 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_12620 27419 26031 gene locus_tag LOCUS_12630 27419 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 28463 27486 gene locus_tag LOCUS_12640 28463 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 29782 28460 gene locus_tag LOCUS_12650 29782 28460 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_12650 30725 30252 gene locus_tag LOCUS_12660 30725 30252 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_12660 34027 31442 gene locus_tag LOCUS_12670 34027 31442 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_12670 35972 34506 gene locus_tag LOCUS_12680 35972 34506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 36783 36010 gene locus_tag LOCUS_12690 36783 36010 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_12690 37757 38353 gene locus_tag LOCUS_12700 37757 38353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 39542 38409 gene locus_tag LOCUS_12710 39542 38409 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_12710 40468 39545 gene locus_tag LOCUS_12720 40468 39545 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_12720 40755 40465 gene locus_tag LOCUS_12730 40755 40465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 41013 41237 gene locus_tag LOCUS_12740 41013 41237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 42260 41250 gene locus_tag LOCUS_12750 gene galE 42260 41250 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_12750 42319 42543 gene locus_tag LOCUS_12760 42319 42543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 42704 43453 gene locus_tag LOCUS_12770 42704 43453 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_12770 43501 44424 gene locus_tag LOCUS_12780 43501 44424 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_12780 44515 45084 gene locus_tag LOCUS_12790 44515 45084 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_12790 45907 45137 gene locus_tag LOCUS_12800 45907 45137 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_12800 46332 47015 gene locus_tag LOCUS_12810 46332 47015 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462648.1 protein_id gnl|my_center|LOCUS_12810 47917 47246 gene locus_tag LOCUS_12820 47917 47246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 49555 48128 gene locus_tag LOCUS_12830 49555 48128 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088661.1 protein_id gnl|my_center|LOCUS_12830 49889 50803 gene locus_tag LOCUS_12840 49889 50803 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_12840 51974 51096 gene locus_tag LOCUS_12850 gene ppk2 51974 51096 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_12850 52505 52092 gene locus_tag LOCUS_12860 gene arfB 52505 52092 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_12860 53723 52515 gene locus_tag LOCUS_12870 53723 52515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 53686 53892 gene locus_tag LOCUS_12880 53686 53892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 54130 53957 gene locus_tag LOCUS_12890 54130 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 54547 54266 gene locus_tag LOCUS_12900 54547 54266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 54836 55681 gene locus_tag LOCUS_12910 54836 55681 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_12910 55688 56863 gene locus_tag LOCUS_12920 55688 56863 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089432.1 protein_id gnl|my_center|LOCUS_12920 57125 58555 gene locus_tag LOCUS_12930 gene ppnN 57125 58555 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_12930 60318 58951 gene locus_tag LOCUS_12940 60318 58951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 60541 60945 gene locus_tag LOCUS_12950 60541 60945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 62451 61195 gene locus_tag LOCUS_12960 62451 61195 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 protein_id gnl|my_center|LOCUS_12960 62600 63061 gene locus_tag LOCUS_12970 62600 63061 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626636.1 protein_id gnl|my_center|LOCUS_12970 63459 63280 gene locus_tag LOCUS_12980 63459 63280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 63713 64906 gene locus_tag LOCUS_12990 63713 64906 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_12990 66021 65413 gene locus_tag LOCUS_13000 66021 65413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 66743 66258 gene locus_tag LOCUS_13010 gene bfr 66743 66258 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_13010 67237 66770 gene locus_tag LOCUS_13020 gene bfr 67237 66770 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_13020 67394 67594 gene locus_tag LOCUS_13030 67394 67594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 67884 68078 gene locus_tag LOCUS_13040 67884 68078 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314023.1 protein_id gnl|my_center|LOCUS_13040 69120 68239 gene locus_tag LOCUS_13050 69120 68239 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_13050 70229 69117 gene locus_tag LOCUS_13060 gene hisC 70229 69117 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_13060 71348 70263 gene locus_tag LOCUS_13070 gene pheA 71348 70263 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_13070 72701 71526 gene locus_tag LOCUS_13080 72701 71526 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_13080 74223 73132 gene locus_tag LOCUS_13090 gene serC 74223 73132 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_13090 76859 74268 gene locus_tag LOCUS_13100 gene gyrA 76859 74268 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_13100 78142 77066 gene locus_tag LOCUS_13110 gene mtnA 78142 77066 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404235.1 protein_id gnl|my_center|LOCUS_13110 78203 79519 gene locus_tag LOCUS_13120 78203 79519 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_13120 79585 80058 gene locus_tag LOCUS_13130 79585 80058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 80142 80873 gene locus_tag LOCUS_13140 80142 80873 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_13140 80866 81561 gene locus_tag LOCUS_13150 gene gph 80866 81561 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_13150 81706 82446 gene locus_tag LOCUS_13160 81706 82446 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_13160 82826 83740 gene locus_tag LOCUS_13170 82826 83740 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_13170 84074 84673 gene locus_tag LOCUS_13180 84074 84673 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_13180 84717 85166 gene locus_tag LOCUS_13190 84717 85166 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_13190 85348 85929 gene locus_tag LOCUS_13200 85348 85929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 85926 86489 gene locus_tag LOCUS_13210 85926 86489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 86493 87584 gene locus_tag LOCUS_13220 gene mnmA 86493 87584 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109995.1 protein_id gnl|my_center|LOCUS_13220 87581 88198 gene locus_tag LOCUS_13230 gene hflD 87581 88198 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405097.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence045 27 428 gene locus_tag LOCUS_13240 27 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 507 1670 gene locus_tag LOCUS_13250 gene lapB 507 1670 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_13250 1724 2443 gene locus_tag LOCUS_13260 gene pyrF 1724 2443 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_13260 2621 5854 gene locus_tag LOCUS_13270 gene recC 2621 5854 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_13270 5856 9503 gene locus_tag LOCUS_13280 gene recB 5856 9503 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932747.1 protein_id gnl|my_center|LOCUS_13280 9500 11335 gene locus_tag LOCUS_13290 gene recD 9500 11335 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_13290 11690 12421 gene locus_tag LOCUS_13300 11690 12421 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_13300 12941 14128 gene locus_tag LOCUS_13310 gene sat 12941 14128 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_13310 14522 14857 gene locus_tag LOCUS_13320 14522 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 16232 14958 gene locus_tag LOCUS_13330 16232 14958 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_13330 17191 16340 gene locus_tag LOCUS_13340 17191 16340 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_13340 18518 17697 gene locus_tag LOCUS_13350 18518 17697 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_13350 19084 18557 gene locus_tag LOCUS_13360 19084 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 19542 19096 gene locus_tag LOCUS_13370 19542 19096 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064118.1 protein_id gnl|my_center|LOCUS_13370 20101 20742 gene locus_tag LOCUS_13380 20101 20742 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_13380 21108 20770 gene locus_tag LOCUS_13390 21108 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 23460 21130 gene locus_tag LOCUS_13400 23460 21130 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036078.1 protein_id gnl|my_center|LOCUS_13400 23830 24372 gene locus_tag LOCUS_13410 23830 24372 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_13410 24408 24716 gene locus_tag LOCUS_13420 24408 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 24726 25409 gene locus_tag LOCUS_13430 24726 25409 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_13430 25409 26758 gene locus_tag LOCUS_13440 25409 26758 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_13440 26940 27815 gene locus_tag LOCUS_13450 gene mshI 26940 27815 CDS product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 protein_id gnl|my_center|LOCUS_13450 27819 28433 gene locus_tag LOCUS_13460 27819 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 28430 29134 gene locus_tag LOCUS_13470 28430 29134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 29127 29504 gene locus_tag LOCUS_13480 29127 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 29600 31249 gene locus_tag LOCUS_13490 gene mshL 29600 31249 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_13490 31253 32146 gene locus_tag LOCUS_13500 31253 32146 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_13500 32143 33444 gene locus_tag LOCUS_13510 32143 33444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 33452 35194 gene locus_tag LOCUS_13520 gene mshE 33452 35194 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_13520 35229 36452 gene locus_tag LOCUS_13530 gene mshG 35229 36452 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_13530 37599 36613 gene locus_tag LOCUS_13540 37599 36613 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_13540 37833 39185 gene locus_tag LOCUS_13550 gene gorA 37833 39185 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209534.1 protein_id gnl|my_center|LOCUS_13550 40397 39381 gene locus_tag LOCUS_13560 gene rsgA 40397 39381 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_13560 40695 40408 gene locus_tag LOCUS_13570 40695 40408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 41966 40692 gene locus_tag LOCUS_13580 41966 40692 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_13580 42249 42821 gene locus_tag LOCUS_13590 gene orn 42249 42821 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_13590 43971 42910 gene locus_tag LOCUS_13600 gene queG 43971 42910 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_13600 44267 45769 gene locus_tag LOCUS_13610 44267 45769 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_13610 45770 46249 gene locus_tag LOCUS_13620 gene tsaE 45770 46249 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_13620 46302 47657 gene locus_tag LOCUS_13630 gene amiB 46302 47657 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_13630 48025 49830 gene locus_tag LOCUS_13640 gene mutL 48025 49830 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 protein_id gnl|my_center|LOCUS_13640 49830 50789 gene locus_tag LOCUS_13650 gene miaA 49830 50789 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 protein_id gnl|my_center|LOCUS_13650 50905 51159 gene locus_tag LOCUS_13660 gene hfq 50905 51159 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_13660 51485 52771 gene locus_tag LOCUS_13670 gene hflX 51485 52771 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209152.1 protein_id gnl|my_center|LOCUS_13670 52890 54038 gene locus_tag LOCUS_13680 gene hflK 52890 54038 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_13680 54038 54922 gene locus_tag LOCUS_13690 gene hflC 54038 54922 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_13690 55156 55341 gene locus_tag LOCUS_13700 55156 55341 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_13700 55354 56532 gene locus_tag LOCUS_13710 55354 56532 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_13710 56577 57872 gene locus_tag LOCUS_13720 56577 57872 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_13720 58072 59871 gene locus_tag LOCUS_13730 58072 59871 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_13730 60500 59934 gene locus_tag LOCUS_13740 gene yeiP 60500 59934 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 protein_id gnl|my_center|LOCUS_13740 61270 60833 gene locus_tag LOCUS_13750 gene nsrR 61270 60833 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_13750 61371 61697 gene locus_tag LOCUS_13760 61371 61697 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_13760 61727 61972 gene locus_tag LOCUS_13770 61727 61972 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264174.1 protein_id gnl|my_center|LOCUS_13770 62161 63267 gene locus_tag LOCUS_13780 62161 63267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_13780 63400 63326 gene locus_tag LOCUS_t00130 63400 63326 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 63522 64934 gene locus_tag LOCUS_13790 gene gltX 63522 64934 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 protein_id gnl|my_center|LOCUS_13790 64986 66674 gene locus_tag LOCUS_13800 gene glnS 64986 66674 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210354.1 protein_id gnl|my_center|LOCUS_13800 67091 67166 gene locus_tag LOCUS_t00140 67091 67166 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67237 67312 gene locus_tag LOCUS_t00150 67237 67312 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67566 69329 gene locus_tag LOCUS_13810 67566 69329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 69326 70711 gene locus_tag LOCUS_13820 69326 70711 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_13820 71092 72393 gene locus_tag LOCUS_13830 71092 72393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 72467 73090 gene locus_tag LOCUS_13840 72467 73090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 73114 73881 gene locus_tag LOCUS_13850 73114 73881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 73884 74816 gene locus_tag LOCUS_13860 gene nrfD 73884 74816 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_13860 74835 77369 gene locus_tag LOCUS_13870 74835 77369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 80095 77489 gene locus_tag LOCUS_13880 80095 77489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 80453 80528 gene locus_tag LOCUS_t00160 80453 80528 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 80594 80669 gene locus_tag LOCUS_t00170 80594 80669 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 81699 80785 gene locus_tag LOCUS_13890 81699 80785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 81899 83419 gene locus_tag LOCUS_13900 81899 83419 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_13900 83506 84141 gene locus_tag LOCUS_13910 83506 84141 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_13910 85237 84227 gene locus_tag LOCUS_13920 85237 84227 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_13920 86299 85358 gene locus_tag LOCUS_13930 86299 85358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 87072 86323 gene locus_tag LOCUS_13940 87072 86323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 90649 87158 gene locus_tag LOCUS_13950 gene mfd 90649 87158 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 protein_id gnl|my_center|LOCUS_13950 90888 91406 gene locus_tag LOCUS_13960 gene napF 90888 91406 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208536.1 protein_id gnl|my_center|LOCUS_13960 91430 91687 gene locus_tag LOCUS_13970 91430 91687 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 protein_id gnl|my_center|LOCUS_13970 91684 94245 gene locus_tag LOCUS_13980 gene napA 91684 94245 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_13980 94425 95201 gene locus_tag LOCUS_13990 gene napG 94425 95201 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_13990 95201 96115 gene locus_tag LOCUS_14000 gene napH 95201 96115 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_14000 96161 96601 gene locus_tag LOCUS_14010 96161 96601 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705484.1 protein_id gnl|my_center|LOCUS_14010 96790 97353 gene locus_tag LOCUS_14020 gene napC 96790 97353 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_14020 97565 98545 gene locus_tag LOCUS_14030 gene moaA 97565 98545 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074310.1 protein_id gnl|my_center|LOCUS_14030 98973 98674 gene locus_tag LOCUS_14040 98973 98674 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 protein_id gnl|my_center|LOCUS_14040 99531 98974 gene locus_tag LOCUS_14050 99531 98974 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947024.1 protein_id gnl|my_center|LOCUS_14050 99911 100768 gene locus_tag LOCUS_14060 99911 100768 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812407.1 protein_id gnl|my_center|LOCUS_14060 100820 101443 gene locus_tag LOCUS_14070 100820 101443 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_14070 101482 102165 gene locus_tag LOCUS_14080 101482 102165 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_14080 102278 103396 gene locus_tag LOCUS_14090 102278 103396 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_14090 103476 104309 gene locus_tag LOCUS_14100 103476 104309 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_14100 104396 105211 gene locus_tag LOCUS_14110 104396 105211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 105201 106040 gene locus_tag LOCUS_14120 105201 106040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 106037 106702 gene locus_tag LOCUS_14130 106037 106702 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_14130 106794 108050 gene locus_tag LOCUS_14140 gene icd 106794 108050 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_14140 108704 108492 gene locus_tag LOCUS_14150 108704 108492 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_14150 109231 109551 gene locus_tag LOCUS_14160 gene clpS 109231 109551 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_14160 109641 111899 gene locus_tag LOCUS_14170 gene clpA 109641 111899 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_14170 112155 111937 gene locus_tag LOCUS_14180 gene infA 112155 111937 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 protein_id gnl|my_center|LOCUS_14180 113039 112299 gene locus_tag LOCUS_14190 113039 112299 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_14190 113733 113029 gene locus_tag LOCUS_14200 gene aat 113733 113029 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767399.1 protein_id gnl|my_center|LOCUS_14200 113804 114475 gene locus_tag LOCUS_14210 113804 114475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 115641 114679 gene locus_tag LOCUS_14220 gene trxB 115641 114679 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_14220 116239 118542 gene locus_tag LOCUS_14230 116239 118542 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_14230 118562 119173 gene locus_tag LOCUS_14240 118562 119173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 119188 120519 gene locus_tag LOCUS_14250 119188 120519 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_14250 120612 120986 gene locus_tag LOCUS_14260 gene crcB 120612 120986 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_14260 120983 121294 gene locus_tag LOCUS_14270 120983 121294 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_14270 121298 122572 gene locus_tag LOCUS_14280 gene serS 121298 122572 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317946.1 protein_id gnl|my_center|LOCUS_14280 123052 122867 gene locus_tag LOCUS_14290 123052 122867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 123788 123117 gene locus_tag LOCUS_14300 123788 123117 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_14300 124006 124096 gene locus_tag LOCUS_t00180 124006 124096 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 124452 125411 gene locus_tag LOCUS_14310 124452 125411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_14310 125640 126284 gene locus_tag LOCUS_14320 gene uvrY 125640 126284 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553344.1 protein_id gnl|my_center|LOCUS_14320 126287 126916 gene locus_tag LOCUS_14330 126287 126916 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_14330 126924 128753 gene locus_tag LOCUS_14340 gene uvrC 126924 128753 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_14340 128760 129356 gene locus_tag LOCUS_14350 gene pgsA 128760 129356 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_14350 129400 129475 gene locus_tag LOCUS_t00190 129400 129475 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 129575 129648 gene locus_tag LOCUS_t00200 129575 129648 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 129672 129759 gene locus_tag LOCUS_t00210 129672 129759 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 130647 129772 gene locus_tag LOCUS_14360 gene glxR 130647 129772 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392230.1 protein_id gnl|my_center|LOCUS_14360 131220 132185 gene locus_tag LOCUS_14370 131220 132185 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_14370 132350 133513 gene locus_tag LOCUS_14380 132350 133513 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339252.1 protein_id gnl|my_center|LOCUS_14380 133778 134464 gene locus_tag LOCUS_14390 133778 134464 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339251.1 protein_id gnl|my_center|LOCUS_14390 134468 135892 gene locus_tag LOCUS_14400 134468 135892 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339250.1 protein_id gnl|my_center|LOCUS_14400 135882 137243 gene locus_tag LOCUS_14410 135882 137243 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339249.1 protein_id gnl|my_center|LOCUS_14410 137274 137450 gene locus_tag LOCUS_14420 137274 137450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 137921 137523 gene locus_tag LOCUS_14430 137921 137523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 139140 138268 gene locus_tag LOCUS_14440 139140 138268 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_14440 140764 139259 gene locus_tag LOCUS_14450 140764 139259 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_14450 142032 141343 gene locus_tag LOCUS_14460 142032 141343 CDS product ribonucleotide reductase system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704811.1 protein_id gnl|my_center|LOCUS_14460 144289 142133 gene locus_tag LOCUS_14470 144289 142133 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 protein_id gnl|my_center|LOCUS_14470 144870 145355 gene locus_tag LOCUS_14480 144870 145355 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_14480 145530 145961 gene locus_tag LOCUS_14490 145530 145961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 146060 147151 gene locus_tag LOCUS_14500 146060 147151 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_14500 147148 147810 gene locus_tag LOCUS_14510 147148 147810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 147807 149093 gene locus_tag LOCUS_14520 147807 149093 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_14520 149209 150930 gene locus_tag LOCUS_14530 149209 150930 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_14530 151370 151795 gene locus_tag LOCUS_14540 151370 151795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 151961 153091 gene locus_tag LOCUS_14550 151961 153091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 153088 155082 gene locus_tag LOCUS_14560 153088 155082 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_14560 155079 155582 gene locus_tag LOCUS_14570 155079 155582 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_14570 155582 156454 gene locus_tag LOCUS_14580 155582 156454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 156451 156864 gene locus_tag LOCUS_14590 156451 156864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 157887 157336 gene locus_tag LOCUS_14600 157887 157336 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_14600 158310 157972 gene locus_tag LOCUS_14610 158310 157972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 158538 161150 gene locus_tag LOCUS_14620 158538 161150 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083198953.1 protein_id gnl|my_center|LOCUS_14620 161250 161561 gene locus_tag LOCUS_14630 161250 161561 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_14630 162530 161811 gene locus_tag LOCUS_14640 162530 161811 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_14640 162869 163096 gene locus_tag LOCUS_14650 162869 163096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 163229 163420 gene locus_tag LOCUS_14660 163229 163420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 164185 164892 gene locus_tag LOCUS_14670 164185 164892 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_14670 166734 164944 gene locus_tag LOCUS_14680 166734 164944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 167795 166671 gene locus_tag LOCUS_14690 167795 166671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 168941 168033 gene locus_tag LOCUS_14700 168941 168033 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_14700 169766 168951 gene locus_tag LOCUS_14710 169766 168951 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210326921.1 protein_id gnl|my_center|LOCUS_14710 170193 170696 gene locus_tag LOCUS_14720 170193 170696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 170922 172124 gene locus_tag LOCUS_14730 170922 172124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 172196 172849 gene locus_tag LOCUS_14740 172196 172849 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_14740 174893 172806 gene locus_tag LOCUS_14750 174893 172806 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460617.1 protein_id gnl|my_center|LOCUS_14750 176551 174929 gene locus_tag LOCUS_14760 gene groL 176551 174929 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_14760 177117 176548 gene locus_tag LOCUS_14770 177117 176548 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_14770 177116 177424 gene locus_tag LOCUS_14780 177116 177424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 177462 177653 gene locus_tag LOCUS_14790 177462 177653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 178697 177849 gene locus_tag LOCUS_14800 178697 177849 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_14800 180192 178714 gene locus_tag LOCUS_14810 180192 178714 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268206.1 protein_id gnl|my_center|LOCUS_14810 180822 180481 gene locus_tag LOCUS_14820 180822 180481 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_14820 181134 183182 gene locus_tag LOCUS_14830 181134 183182 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266176.1 protein_id gnl|my_center|LOCUS_14830 183187 184821 gene locus_tag LOCUS_14840 183187 184821 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_14840 184818 185612 gene locus_tag LOCUS_14850 184818 185612 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_14850 185619 185873 gene locus_tag LOCUS_14860 185619 185873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 186128 186042 gene locus_tag LOCUS_t00220 186128 186042 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 186556 186263 gene locus_tag LOCUS_14870 186556 186263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 186443 188665 gene locus_tag LOCUS_14880 gene rnr 186443 188665 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_14880 188728 189474 gene locus_tag LOCUS_14890 gene rlmB 188728 189474 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_14890 190066 190482 gene locus_tag LOCUS_14900 gene rpsF 190066 190482 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_14900 190562 190786 gene locus_tag LOCUS_14910 gene rpsR 190562 190786 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_14910 190859 191779 gene locus_tag LOCUS_14920 190859 191779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_14920 191811 192263 gene locus_tag LOCUS_14930 gene rplI 191811 192263 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_14930 192534 193892 gene locus_tag LOCUS_14940 gene dnaB 192534 193892 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_14940 193892 194974 gene locus_tag LOCUS_14950 gene alr 193892 194974 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772336.1 protein_id gnl|my_center|LOCUS_14950 194978 196360 gene locus_tag LOCUS_14960 gene radA 194978 196360 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_14960 197301 196936 gene locus_tag LOCUS_14970 197301 196936 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770186.1 protein_id gnl|my_center|LOCUS_14970 198009 197332 gene locus_tag LOCUS_14980 198009 197332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 199711 198530 gene locus_tag LOCUS_14990 199711 198530 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_14990 200006 200530 gene locus_tag LOCUS_15000 200006 200530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 200786 202264 gene locus_tag LOCUS_15010 gene fleQ 200786 202264 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_15010 202390 203616 gene locus_tag LOCUS_15020 gene fleS 202390 203616 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_15020 203613 204956 gene locus_tag LOCUS_15030 gene fleR 203613 204956 CDS product sigma-54-dependent response regulator transcription factor FleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_15030 205017 205334 gene locus_tag LOCUS_15040 gene fliE 205017 205334 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_15040 205396 207051 gene locus_tag LOCUS_15050 gene fliF 205396 207051 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244370.1 protein_id gnl|my_center|LOCUS_15050 207038 208048 gene locus_tag LOCUS_15060 gene fliG 207038 208048 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268442.1 protein_id gnl|my_center|LOCUS_15060 208029 208727 gene locus_tag LOCUS_15070 gene fliH 208029 208727 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012402.1 protein_id gnl|my_center|LOCUS_15070 208724 210070 gene locus_tag LOCUS_15080 gene fliI 208724 210070 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_15080 210143 210574 gene locus_tag LOCUS_15090 210143 210574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 210878 210588 gene locus_tag LOCUS_15100 210878 210588 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947507.1 protein_id gnl|my_center|LOCUS_15100 212173 210875 gene locus_tag LOCUS_15110 212173 210875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence046 52 1014 gene locus_tag LOCUS_15120 gene rluC 52 1014 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_15120 1038 1691 gene locus_tag LOCUS_15130 1038 1691 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_15130 1783 2757 gene locus_tag LOCUS_15140 gene sppA 1783 2757 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_15140 3017 3379 gene locus_tag LOCUS_15150 3017 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3855 3652 gene locus_tag LOCUS_15160 3855 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3980 5425 gene locus_tag LOCUS_15170 3980 5425 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088661.1 protein_id gnl|my_center|LOCUS_15170 5422 6048 gene locus_tag LOCUS_15180 5422 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 6210 7598 gene locus_tag LOCUS_15190 6210 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7595 8524 gene locus_tag LOCUS_15200 7595 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9509 8535 gene locus_tag LOCUS_15210 9509 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10160 9549 gene locus_tag LOCUS_15220 10160 9549 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 protein_id gnl|my_center|LOCUS_15220 10538 10786 gene locus_tag LOCUS_15230 10538 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 10854 12635 gene locus_tag LOCUS_15240 gene oadA 10854 12635 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_15240 12637 13770 gene locus_tag LOCUS_15250 12637 13770 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_15250 13915 14379 gene locus_tag LOCUS_15260 13915 14379 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_15260 14420 14599 gene locus_tag LOCUS_15270 gene rpmF 14420 14599 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771287.1 protein_id gnl|my_center|LOCUS_15270 14778 15803 gene locus_tag LOCUS_15280 gene plsX 14778 15803 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_15280 15800 16768 gene locus_tag LOCUS_15290 15800 16768 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_15290 16969 17709 gene locus_tag LOCUS_15300 gene fabG 16969 17709 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_15300 17904 18137 gene locus_tag LOCUS_15310 gene acpP 17904 18137 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_15310 18272 19480 gene locus_tag LOCUS_15320 gene fabF 18272 19480 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_15320 19674 20492 gene locus_tag LOCUS_15330 gene pabC 19674 20492 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_15330 20605 21540 gene locus_tag LOCUS_15340 gene mltG 20605 21540 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_15340 21547 22191 gene locus_tag LOCUS_15350 gene tmk 21547 22191 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_15350 22184 23197 gene locus_tag LOCUS_15360 22184 23197 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_15360 23205 23564 gene locus_tag LOCUS_15370 23205 23564 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_15370 23618 24394 gene locus_tag LOCUS_15380 23618 24394 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_15380 24819 24418 gene locus_tag LOCUS_15390 24819 24418 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_15390 26043 24898 gene locus_tag LOCUS_15400 26043 24898 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_15400 26386 26757 gene locus_tag LOCUS_15410 26386 26757 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337696.1 protein_id gnl|my_center|LOCUS_15410 26750 27196 gene locus_tag LOCUS_15420 26750 27196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826739.1 protein_id gnl|my_center|LOCUS_15420 30333 27265 gene locus_tag LOCUS_15430 gene dnaE2 30333 27265 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_15430 31765 30344 gene locus_tag LOCUS_15440 31765 30344 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463506.1 protein_id gnl|my_center|LOCUS_15440 32378 31767 gene locus_tag LOCUS_15450 gene imuA 32378 31767 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962596.1 protein_id gnl|my_center|LOCUS_15450 34169 32652 gene locus_tag LOCUS_15460 34169 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 35247 34501 gene locus_tag LOCUS_15470 35247 34501 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_15470 35996 35391 gene locus_tag LOCUS_15480 35996 35391 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_15480 37432 36386 gene locus_tag LOCUS_15490 gene nagZ 37432 36386 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_15490 37525 37935 gene locus_tag LOCUS_15500 37525 37935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 38442 37942 gene locus_tag LOCUS_15510 38442 37942 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_15510 38903 38436 gene locus_tag LOCUS_15520 38903 38436 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_15520 40248 38917 gene locus_tag LOCUS_15530 gene rlmD 40248 38917 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_15530 41063 40449 gene locus_tag LOCUS_15540 41063 40449 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_15540 43458 41362 gene locus_tag LOCUS_15550 43458 41362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 44332 43439 gene locus_tag LOCUS_15560 gene cysM 44332 43439 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_15560 44521 46476 gene locus_tag LOCUS_15570 44521 46476 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_15570 46563 47561 gene locus_tag LOCUS_15580 46563 47561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 47558 50392 gene locus_tag LOCUS_15590 gene gacS 47558 50392 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_15590 50990 50460 gene locus_tag LOCUS_15600 gene dsbB 50990 50460 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227934.1 protein_id gnl|my_center|LOCUS_15600 52634 51531 gene locus_tag LOCUS_15610 52634 51531 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818337.1 protein_id gnl|my_center|LOCUS_15610 52823 54313 gene locus_tag LOCUS_15620 52823 54313 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404269.1 protein_id gnl|my_center|LOCUS_15620 56504 54318 gene locus_tag LOCUS_15630 56504 54318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 57487 56726 gene locus_tag LOCUS_15640 gene pdxJ 57487 56726 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571773.1 protein_id gnl|my_center|LOCUS_15640 58230 57511 gene locus_tag LOCUS_15650 gene recO 58230 57511 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_15650 59126 58227 gene locus_tag LOCUS_15660 gene era 59126 58227 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_15660 59796 59119 gene locus_tag LOCUS_15670 gene rnc 59796 59119 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 protein_id gnl|my_center|LOCUS_15670 60170 59793 gene locus_tag LOCUS_15680 60170 59793 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947590.1 protein_id gnl|my_center|LOCUS_15680 60906 60220 gene locus_tag LOCUS_15690 gene lepB 60906 60220 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071556.1 protein_id gnl|my_center|LOCUS_15690 62911 61106 gene locus_tag LOCUS_15700 gene lepA 62911 61106 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_15700 63602 63360 gene locus_tag LOCUS_15710 63602 63360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 65043 63610 gene locus_tag LOCUS_15720 gene mucD 65043 63610 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_15720 65592 65116 gene locus_tag LOCUS_15730 65592 65116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 66574 65609 gene locus_tag LOCUS_15740 66574 65609 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_15740 67158 66580 gene locus_tag LOCUS_15750 67158 66580 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_15750 67776 67201 gene locus_tag LOCUS_15760 gene rpoE 67776 67201 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_15760 67972 69600 gene locus_tag LOCUS_15770 gene nadB 67972 69600 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_15770 70030 69551 gene locus_tag LOCUS_15780 70030 69551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 70322 70074 gene locus_tag LOCUS_15790 70322 70074 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071548.1 protein_id gnl|my_center|LOCUS_15790 71031 70339 gene locus_tag LOCUS_15800 71031 70339 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040190.1 protein_id gnl|my_center|LOCUS_15800 72805 71042 gene locus_tag LOCUS_15810 gene sdhA 72805 71042 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_15810 73176 72832 gene locus_tag LOCUS_15820 gene sdhD 73176 72832 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223854.1 protein_id gnl|my_center|LOCUS_15820 73550 73173 gene locus_tag LOCUS_15830 gene sdhC 73550 73173 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_15830 74235 73717 gene locus_tag LOCUS_15840 gene yjgA 74235 73717 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457057.1 protein_id gnl|my_center|LOCUS_15840 75968 74238 gene locus_tag LOCUS_15850 gene recJ 75968 74238 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_15850 76630 75965 gene locus_tag LOCUS_15860 76630 75965 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397315.1 protein_id gnl|my_center|LOCUS_15860 76745 77443 gene locus_tag LOCUS_15870 76745 77443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 77700 78437 gene locus_tag LOCUS_15880 gene cysZ 77700 78437 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 protein_id gnl|my_center|LOCUS_15880 79592 78453 gene locus_tag LOCUS_15890 79592 78453 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 protein_id gnl|my_center|LOCUS_15890 80435 79668 gene locus_tag LOCUS_15900 80435 79668 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_15900 80628 81071 gene locus_tag LOCUS_15910 gene dksA 80628 81071 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_15910 81482 82378 gene locus_tag LOCUS_15920 gene gluQRS 81482 82378 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence047 673 2301 gene locus_tag LOCUS_15930 673 2301 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_15930 2393 4180 gene locus_tag LOCUS_15940 2393 4180 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_15940 4253 4702 gene locus_tag LOCUS_15950 4253 4702 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_15950 4988 5452 gene locus_tag LOCUS_15960 4988 5452 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417353.1 protein_id gnl|my_center|LOCUS_15960 5628 6350 gene locus_tag LOCUS_15970 5628 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 6379 8595 gene locus_tag LOCUS_15980 gene ppk1 6379 8595 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_15980 8860 9837 gene locus_tag LOCUS_15990 8860 9837 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258919.1 protein_id gnl|my_center|LOCUS_15990 11280 10174 gene locus_tag LOCUS_16000 11280 10174 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_16000 11782 11456 gene locus_tag LOCUS_16010 11782 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 protein_id gnl|my_center|LOCUS_16010 12489 11779 gene locus_tag LOCUS_16020 12489 11779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_16020 13414 12491 gene locus_tag LOCUS_16030 13414 12491 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_16030 14757 13411 gene locus_tag LOCUS_16040 gene livM 14757 13411 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389503.1 protein_id gnl|my_center|LOCUS_16040 15677 14763 gene locus_tag LOCUS_16050 15677 14763 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_16050 19180 15998 gene locus_tag LOCUS_16060 gene putA 19180 15998 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 protein_id gnl|my_center|LOCUS_16060 20487 19720 gene locus_tag LOCUS_16070 20487 19720 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741188.1 protein_id gnl|my_center|LOCUS_16070 20747 21541 gene locus_tag LOCUS_16080 20747 21541 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 protein_id gnl|my_center|LOCUS_16080 21687 22682 gene locus_tag LOCUS_16090 21687 22682 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_16090 22763 23503 gene locus_tag LOCUS_16100 gene cmoA 22763 23503 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661448.1 protein_id gnl|my_center|LOCUS_16100 23500 24477 gene locus_tag LOCUS_16110 gene cmoB 23500 24477 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_16110 25455 24571 gene locus_tag LOCUS_16120 25455 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 26180 26404 gene locus_tag LOCUS_16130 26180 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 26451 27371 gene locus_tag LOCUS_16140 gene nudC 26451 27371 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_16140 29141 27711 gene locus_tag LOCUS_16150 29141 27711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 29576 29229 gene locus_tag LOCUS_16160 29576 29229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 30235 29672 gene locus_tag LOCUS_16170 30235 29672 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_16170 30439 31398 gene locus_tag LOCUS_16180 30439 31398 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037718.1 protein_id gnl|my_center|LOCUS_16180 31994 31374 gene locus_tag LOCUS_16190 gene tesA 31994 31374 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_16190 32026 32724 gene locus_tag LOCUS_16200 32026 32724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_16200 32930 35419 gene locus_tag LOCUS_16210 32930 35419 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_16210 35419 37740 gene locus_tag LOCUS_16220 35419 37740 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104112.1 protein_id gnl|my_center|LOCUS_16220 38639 37773 gene locus_tag LOCUS_16230 38639 37773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 38818 39498 gene locus_tag LOCUS_16240 38818 39498 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_16240 39488 40765 gene locus_tag LOCUS_16250 39488 40765 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_16250 41061 41411 gene locus_tag LOCUS_16260 41061 41411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 41559 43412 gene locus_tag LOCUS_16270 41559 43412 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_16270 44855 43482 gene locus_tag LOCUS_16280 gene nhaA 44855 43482 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_16280 45391 45014 gene locus_tag LOCUS_16290 45391 45014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 45275 46531 gene locus_tag LOCUS_16300 gene atpD 45275 46531 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946152.1 protein_id gnl|my_center|LOCUS_16300 46528 46938 gene locus_tag LOCUS_16310 46528 46938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946788.1 protein_id gnl|my_center|LOCUS_16310 46935 47213 gene locus_tag LOCUS_16320 46935 47213 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946787.1 protein_id gnl|my_center|LOCUS_16320 47206 47901 gene locus_tag LOCUS_16330 47206 47901 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_16330 47898 48164 gene locus_tag LOCUS_16340 47898 48164 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019235654.1 protein_id gnl|my_center|LOCUS_16340 48177 48926 gene locus_tag LOCUS_16350 48177 48926 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946784.1 protein_id gnl|my_center|LOCUS_16350 48916 50409 gene locus_tag LOCUS_16360 48916 50409 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946783.1 protein_id gnl|my_center|LOCUS_16360 50393 51265 gene locus_tag LOCUS_16370 50393 51265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 51749 51591 gene locus_tag LOCUS_16380 51749 51591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 51730 52470 gene locus_tag LOCUS_16390 gene modA 51730 52470 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626059.1 protein_id gnl|my_center|LOCUS_16390 52477 55023 gene locus_tag LOCUS_16400 52477 55023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 55179 55388 gene locus_tag LOCUS_16410 55179 55388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 56053 55439 gene locus_tag LOCUS_16420 56053 55439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 56638 56372 gene locus_tag LOCUS_16430 56638 56372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 62849 56874 gene locus_tag LOCUS_16440 62849 56874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 63057 63290 gene locus_tag LOCUS_16450 63057 63290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 68673 63595 gene locus_tag LOCUS_16460 68673 63595 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_16460 69409 68696 gene locus_tag LOCUS_16470 69409 68696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_16470 70218 69421 gene locus_tag LOCUS_16480 70218 69421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 70730 71359 gene locus_tag LOCUS_16490 70730 71359 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_16490 71859 72176 gene locus_tag LOCUS_16500 71859 72176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 73165 72428 gene locus_tag LOCUS_16510 73165 72428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973993.1 protein_id gnl|my_center|LOCUS_16510 74647 73640 gene locus_tag LOCUS_16520 74647 73640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 75089 75727 gene locus_tag LOCUS_16530 75089 75727 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_16530 76683 75799 gene locus_tag LOCUS_16540 76683 75799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 78986 76824 gene locus_tag LOCUS_16550 78986 76824 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_16550 79842 80525 gene locus_tag LOCUS_16560 79842 80525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence048 381 1052 gene locus_tag LOCUS_16570 381 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1229 1705 gene locus_tag LOCUS_16580 1229 1705 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266668.1 protein_id gnl|my_center|LOCUS_16580 1827 3704 gene locus_tag LOCUS_16590 gene speA 1827 3704 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763203.1 protein_id gnl|my_center|LOCUS_16590 6465 3817 gene locus_tag LOCUS_16600 6465 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7157 6486 gene locus_tag LOCUS_16610 7157 6486 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965082.1 protein_id gnl|my_center|LOCUS_16610 7414 10146 gene locus_tag LOCUS_16620 gene polA 7414 10146 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_16620 11281 10655 gene locus_tag LOCUS_16630 gene yihA 11281 10655 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_16630 11926 11462 gene locus_tag LOCUS_16640 11926 11462 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_16640 12548 12066 gene locus_tag LOCUS_16650 gene moaC 12548 12066 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_16650 13087 12545 gene locus_tag LOCUS_16660 13087 12545 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_16660 13799 13251 gene locus_tag LOCUS_16670 gene ppa 13799 13251 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055070.1 protein_id gnl|my_center|LOCUS_16670 15451 14195 gene locus_tag LOCUS_16680 15451 14195 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_16680 16042 15698 gene locus_tag LOCUS_16690 16042 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 18008 16668 gene locus_tag LOCUS_16700 gene pmbA 18008 16668 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243694.1 protein_id gnl|my_center|LOCUS_16700 19497 18055 gene locus_tag LOCUS_16710 gene tldD 19497 18055 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_16710 20428 19643 gene locus_tag LOCUS_16720 20428 19643 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_16720 25118 20757 gene locus_tag LOCUS_16730 25118 20757 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_16730 26583 25129 gene locus_tag LOCUS_16740 gene rng 26583 25129 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_16740 27181 26576 gene locus_tag LOCUS_16750 27181 26576 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_16750 27853 27383 gene locus_tag LOCUS_16760 gene rlmH 27853 27383 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_16760 28202 27975 gene locus_tag LOCUS_16770 28202 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 28869 28510 gene locus_tag LOCUS_16780 gene rsfS 28869 28510 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 protein_id gnl|my_center|LOCUS_16780 29558 28944 gene locus_tag LOCUS_16790 gene nadD 29558 28944 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_16790 30844 29573 gene locus_tag LOCUS_16800 30844 29573 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_16800 32477 31425 gene locus_tag LOCUS_16810 gene holA 32477 31425 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_16810 32997 32497 gene locus_tag LOCUS_16820 32997 32497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 35670 33040 gene locus_tag LOCUS_16830 gene leuS 35670 33040 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_16830 36052 36582 gene locus_tag LOCUS_16840 36052 36582 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125919.1 protein_id gnl|my_center|LOCUS_16840 37005 36850 gene locus_tag LOCUS_16850 gene rpmG 37005 36850 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_16850 37253 37017 gene locus_tag LOCUS_16860 gene rpmB 37253 37017 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_16860 38141 37467 gene locus_tag LOCUS_16870 gene radC 38141 37467 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_16870 38515 39729 gene locus_tag LOCUS_16880 gene coaBC 38515 39729 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_16880 39782 40240 gene locus_tag LOCUS_16890 gene dut 39782 40240 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_16890 40532 43048 gene locus_tag LOCUS_16900 40532 43048 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 protein_id gnl|my_center|LOCUS_16900 43173 44069 gene locus_tag LOCUS_16910 gene argB 43173 44069 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_16910 44080 44670 gene locus_tag LOCUS_16920 gene slmA 44080 44670 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_16920 45957 44956 gene locus_tag LOCUS_16930 45957 44956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 46687 46046 gene locus_tag LOCUS_16940 gene pyrE 46687 46046 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_16940 46829 48367 gene locus_tag LOCUS_16950 46829 48367 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_16950 48379 49008 gene locus_tag LOCUS_16960 48379 49008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 49562 50383 gene locus_tag LOCUS_16970 gene mlaF 49562 50383 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_16970 50377 51156 gene locus_tag LOCUS_16980 gene mlaE 50377 51156 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436044.1 protein_id gnl|my_center|LOCUS_16980 51160 51636 gene locus_tag LOCUS_16990 gene mlaD 51160 51636 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16990 51629 52237 gene locus_tag LOCUS_17000 51629 52237 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_17000 52237 52545 gene locus_tag LOCUS_17010 52237 52545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 52965 54224 gene locus_tag LOCUS_17020 gene murA 52965 54224 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_17020 54415 55059 gene locus_tag LOCUS_17030 gene hisG 54415 55059 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261539.1 protein_id gnl|my_center|LOCUS_17030 55111 56409 gene locus_tag LOCUS_17040 gene hisD 55111 56409 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_17040 57670 56519 gene locus_tag LOCUS_17050 gene algW 57670 56519 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_17050 57754 58500 gene locus_tag LOCUS_17060 57754 58500 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 protein_id gnl|my_center|LOCUS_17060 58699 59283 gene locus_tag LOCUS_17070 gene petA 58699 59283 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_17070 59283 60500 gene locus_tag LOCUS_17080 59283 60500 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_17080 60497 61249 gene locus_tag LOCUS_17090 60497 61249 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_17090 61562 62155 gene locus_tag LOCUS_17100 gene sspA 61562 62155 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_17100 62171 62563 gene locus_tag LOCUS_17110 62171 62563 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_17110 62919 62575 gene locus_tag LOCUS_17120 62919 62575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 63362 63859 gene locus_tag LOCUS_17130 63362 63859 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092502.1 protein_id gnl|my_center|LOCUS_17130 64061 64279 gene locus_tag LOCUS_17140 64061 64279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 65280 64483 gene locus_tag LOCUS_17150 gene fetB 65280 64483 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_17150 65879 65280 gene locus_tag LOCUS_17160 65879 65280 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_17160 66538 65885 gene locus_tag LOCUS_17170 gene trmB 66538 65885 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_17170 66419 66814 gene locus_tag LOCUS_17180 66419 66814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 66830 66903 gene locus_tag LOCUS_t00230 66830 66903 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 66970 67281 gene locus_tag LOCUS_17190 66970 67281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 67572 69722 gene locus_tag LOCUS_17200 67572 69722 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_17200 69866 70150 gene locus_tag LOCUS_17210 69866 70150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 71449 70472 gene locus_tag LOCUS_17220 71449 70472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 71541 72638 gene locus_tag LOCUS_17230 gene mutY 71541 72638 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645253.1 protein_id gnl|my_center|LOCUS_17230 72613 72873 gene locus_tag LOCUS_17240 72613 72873 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 protein_id gnl|my_center|LOCUS_17240 73004 73079 gene locus_tag LOCUS_t00240 73004 73079 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 73462 73743 gene locus_tag LOCUS_17250 73462 73743 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_17250 75143 73755 gene locus_tag LOCUS_17260 75143 73755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence049 973 281 gene locus_tag LOCUS_17270 973 281 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970812.1 protein_id gnl|my_center|LOCUS_17270 1411 2562 gene locus_tag LOCUS_17280 1411 2562 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 protein_id gnl|my_center|LOCUS_17280 2857 5034 gene locus_tag LOCUS_17290 2857 5034 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269180.1 protein_id gnl|my_center|LOCUS_17290 6806 5181 gene locus_tag LOCUS_17300 gene pckA 6806 5181 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704536.1 protein_id gnl|my_center|LOCUS_17300 7168 7722 gene locus_tag LOCUS_17310 7168 7722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105376.1 protein_id gnl|my_center|LOCUS_17310 8191 7859 gene locus_tag LOCUS_17320 8191 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 9054 8269 gene locus_tag LOCUS_17330 9054 8269 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104937.1 protein_id gnl|my_center|LOCUS_17330 10565 9051 gene locus_tag LOCUS_17340 10565 9051 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267491.1 protein_id gnl|my_center|LOCUS_17340 10658 11275 gene locus_tag LOCUS_17350 10658 11275 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267492.1 protein_id gnl|my_center|LOCUS_17350 11360 12478 gene locus_tag LOCUS_17360 11360 12478 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035674.1 protein_id gnl|my_center|LOCUS_17360 12475 15576 gene locus_tag LOCUS_17370 12475 15576 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103298.1 protein_id gnl|my_center|LOCUS_17370 15938 15573 gene locus_tag LOCUS_17380 15938 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 18980 16095 gene locus_tag LOCUS_17390 18980 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 19921 18980 gene locus_tag LOCUS_17400 19921 18980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_17400 20462 21541 gene locus_tag LOCUS_17410 20462 21541 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 protein_id gnl|my_center|LOCUS_17410 21596 22132 gene locus_tag LOCUS_17420 21596 22132 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_17420 22151 23440 gene locus_tag LOCUS_17430 22151 23440 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_17430 23607 24956 gene locus_tag LOCUS_17440 23607 24956 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458065.1 protein_id gnl|my_center|LOCUS_17440 24977 25624 gene locus_tag LOCUS_17450 24977 25624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_17450 26997 25801 gene locus_tag LOCUS_17460 gene cfa 26997 25801 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210940.1 protein_id gnl|my_center|LOCUS_17460 27237 28601 gene locus_tag LOCUS_17470 27237 28601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_17470 28605 29531 gene locus_tag LOCUS_17480 28605 29531 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392264.1 protein_id gnl|my_center|LOCUS_17480 29658 30308 gene locus_tag LOCUS_17490 29658 30308 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_17490 30428 31543 gene locus_tag LOCUS_17500 30428 31543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 31555 32040 gene locus_tag LOCUS_17510 31555 32040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 32031 32564 gene locus_tag LOCUS_17520 32031 32564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17520 32573 32917 gene locus_tag LOCUS_17530 32573 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 32995 34656 gene locus_tag LOCUS_17540 gene panP 32995 34656 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942351.1 protein_id gnl|my_center|LOCUS_17540 35909 34914 gene locus_tag LOCUS_17550 gene glk 35909 34914 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259043.1 protein_id gnl|my_center|LOCUS_17550 37581 35920 gene locus_tag LOCUS_17560 gene pgi 37581 35920 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_17560 40337 37839 gene locus_tag LOCUS_17570 40337 37839 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_17570 41841 40342 gene locus_tag LOCUS_17580 gene malQ 41841 40342 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_17580 43550 41838 gene locus_tag LOCUS_17590 43550 41838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 44808 43540 gene locus_tag LOCUS_17600 gene glgC 44808 43540 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_17600 45002 44805 gene locus_tag LOCUS_17610 45002 44805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 45169 47421 gene locus_tag LOCUS_17620 gene glgB 45169 47421 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_17620 47418 48878 gene locus_tag LOCUS_17630 gene glgA 47418 48878 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 protein_id gnl|my_center|LOCUS_17630 49081 48875 gene locus_tag LOCUS_17640 49081 48875 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_17640 49824 49354 gene locus_tag LOCUS_17650 49824 49354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 50134 50658 gene locus_tag LOCUS_17660 50134 50658 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568255.1 protein_id gnl|my_center|LOCUS_17660 50655 51428 gene locus_tag LOCUS_17670 50655 51428 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_17670 54411 51571 gene locus_tag LOCUS_17680 54411 51571 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_17680 55158 54766 gene locus_tag LOCUS_17690 55158 54766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 55788 55321 gene locus_tag LOCUS_17700 55788 55321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 56531 56800 gene locus_tag LOCUS_17710 56531 56800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 57368 56913 gene locus_tag LOCUS_17720 57368 56913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 57649 58347 gene locus_tag LOCUS_17730 57649 58347 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_17730 59797 58667 gene locus_tag LOCUS_17740 59797 58667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 61327 60530 gene locus_tag LOCUS_17750 61327 60530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 61469 61936 gene locus_tag LOCUS_17760 gene nikR 61469 61936 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_17760 62878 62351 gene locus_tag LOCUS_17770 62878 62351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 63697 64467 gene locus_tag LOCUS_17780 63697 64467 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391248.1 protein_id gnl|my_center|LOCUS_17780 64694 64482 gene locus_tag LOCUS_17790 64694 64482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 64584 65114 gene locus_tag LOCUS_17800 gene cbiM 64584 65114 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_17800 65119 65730 gene locus_tag LOCUS_17810 65119 65730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339129.1 protein_id gnl|my_center|LOCUS_17810 65727 66488 gene locus_tag LOCUS_17820 65727 66488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 66485 67276 gene locus_tag LOCUS_17830 66485 67276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_17830 67402 70788 gene locus_tag LOCUS_17840 gene mscK 67402 70788 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208612.1 protein_id gnl|my_center|LOCUS_17840 70834 71157 gene locus_tag LOCUS_17850 70834 71157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 71167 73011 gene locus_tag LOCUS_17860 gene recQ 71167 73011 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_17860 73597 74940 gene locus_tag LOCUS_17870 73597 74940 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence050 603 205 gene locus_tag LOCUS_17880 603 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1128 691 gene locus_tag LOCUS_17890 1128 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1980 1252 gene locus_tag LOCUS_17900 1980 1252 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_17900 3969 2977 gene locus_tag LOCUS_17910 3969 2977 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070523.1 protein_id gnl|my_center|LOCUS_17910 4685 4398 gene locus_tag LOCUS_17920 4685 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4700 5317 gene locus_tag LOCUS_17930 4700 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5314 6105 gene locus_tag LOCUS_17940 5314 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17940 6225 7952 gene locus_tag LOCUS_17950 6225 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 8150 8761 gene locus_tag LOCUS_17960 8150 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 8816 9076 gene locus_tag LOCUS_17970 8816 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 9142 10290 gene locus_tag LOCUS_17980 9142 10290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 10287 19007 gene locus_tag LOCUS_17990 10287 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 19195 20478 gene locus_tag LOCUS_18000 19195 20478 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_18000 20475 22769 gene locus_tag LOCUS_18010 20475 22769 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_18010 22769 23959 gene locus_tag LOCUS_18020 22769 23959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 24592 25485 gene locus_tag LOCUS_18030 24592 25485 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_18030 25682 25951 gene locus_tag LOCUS_18040 25682 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 25944 26933 gene locus_tag LOCUS_18050 25944 26933 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_18050 28544 27441 gene locus_tag LOCUS_18060 28544 27441 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_18060 30160 28856 gene locus_tag LOCUS_18070 30160 28856 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_18070 31182 30157 gene locus_tag LOCUS_18080 31182 30157 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_18080 32404 31175 gene locus_tag LOCUS_18090 32404 31175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 33920 32397 gene locus_tag LOCUS_18100 33920 32397 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768668.1 protein_id gnl|my_center|LOCUS_18100 34896 33907 gene locus_tag LOCUS_18110 34896 33907 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_18110 35575 34898 gene locus_tag LOCUS_18120 35575 34898 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_18120 36860 35586 gene locus_tag LOCUS_18130 36860 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 38300 37236 gene locus_tag LOCUS_18140 gene fba 38300 37236 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_18140 39831 38398 gene locus_tag LOCUS_18150 gene pyk 39831 38398 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093930.1 protein_id gnl|my_center|LOCUS_18150 41063 39882 gene locus_tag LOCUS_18160 41063 39882 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_18160 42362 41364 gene locus_tag LOCUS_18170 gene gap 42362 41364 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_18170 44431 42446 gene locus_tag LOCUS_18180 gene tkt 44431 42446 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 protein_id gnl|my_center|LOCUS_18180 45386 44829 gene locus_tag LOCUS_18190 45386 44829 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_18190 45728 46900 gene locus_tag LOCUS_18200 gene metK 45728 46900 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035997.1 protein_id gnl|my_center|LOCUS_18200 47273 48688 gene locus_tag LOCUS_18210 gene ahcY 47273 48688 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 protein_id gnl|my_center|LOCUS_18210 48771 49628 gene locus_tag LOCUS_18220 gene metF 48771 49628 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 protein_id gnl|my_center|LOCUS_18220 50083 51207 gene locus_tag LOCUS_18230 50083 51207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 51437 52789 gene locus_tag LOCUS_18240 51437 52789 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_18240 52791 53525 gene locus_tag LOCUS_18250 gene rsmE 52791 53525 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071124.1 protein_id gnl|my_center|LOCUS_18250 54669 53794 gene locus_tag LOCUS_18260 gene ttcA 54669 53794 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 protein_id gnl|my_center|LOCUS_18260 55554 55039 gene locus_tag LOCUS_18270 55554 55039 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_18270 61379 55551 gene locus_tag LOCUS_18280 61379 55551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 63622 61568 gene locus_tag LOCUS_18290 gene pilJ 63622 61568 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_18290 64256 63714 gene locus_tag LOCUS_18300 64256 63714 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_18300 64689 64267 gene locus_tag LOCUS_18310 gene pilH 64689 64267 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_18310 65134 64739 gene locus_tag LOCUS_18320 gene pilG 65134 64739 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_18320 65403 65134 gene locus_tag LOCUS_18330 65403 65134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 66227 65499 gene locus_tag LOCUS_18340 66227 65499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 66605 66348 gene locus_tag LOCUS_18350 66605 66348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 67009 67959 gene locus_tag LOCUS_18360 gene gshB 67009 67959 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_18360 67956 69011 gene locus_tag LOCUS_18370 67956 69011 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_18370 69040 69927 gene locus_tag LOCUS_18380 69040 69927 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_18380 69978 70541 gene locus_tag LOCUS_18390 69978 70541 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 protein_id gnl|my_center|LOCUS_18390 70668 71069 gene locus_tag LOCUS_18400 gene ruvX 70668 71069 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_18400 71056 71601 gene locus_tag LOCUS_18410 gene pyrR 71056 71601 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_18410 71598 72575 gene locus_tag LOCUS_18420 71598 72575 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_18420 72572 73891 gene locus_tag LOCUS_18430 72572 73891 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_18430 73888 74781 gene locus_tag LOCUS_18440 73888 74781 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence051 162 1037 gene locus_tag LOCUS_18450 162 1037 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_18450 1024 1380 gene locus_tag LOCUS_18460 1024 1380 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_18460 1417 1641 gene locus_tag LOCUS_18470 1417 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1807 1992 gene locus_tag LOCUS_18480 1807 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3225 1924 gene locus_tag LOCUS_18490 3225 1924 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_18490 3474 4049 gene locus_tag LOCUS_18500 gene msrA 3474 4049 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_18500 4754 4077 gene locus_tag LOCUS_18510 4754 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 5656 4769 gene locus_tag LOCUS_18520 gene hslO 5656 4769 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_18520 7713 5665 gene locus_tag LOCUS_18530 gene fusA 7713 5665 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939087.1 protein_id gnl|my_center|LOCUS_18530 8066 8584 gene locus_tag LOCUS_18540 8066 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 9464 8655 gene locus_tag LOCUS_18550 gene trpC 9464 8655 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_18550 9546 10046 gene locus_tag LOCUS_18560 gene greB 9546 10046 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 protein_id gnl|my_center|LOCUS_18560 10630 10427 gene locus_tag LOCUS_18570 10630 10427 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209548.1 protein_id gnl|my_center|LOCUS_18570 11899 10712 gene locus_tag LOCUS_18580 11899 10712 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_18580 12012 12854 gene locus_tag LOCUS_18590 12012 12854 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087853.1 protein_id gnl|my_center|LOCUS_18590 13202 13630 gene locus_tag LOCUS_18600 13202 13630 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401060.1 protein_id gnl|my_center|LOCUS_18600 15046 13790 gene locus_tag LOCUS_18610 15046 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 16305 15058 gene locus_tag LOCUS_18620 16305 15058 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_18620 17432 16521 gene locus_tag LOCUS_18630 gene cysK 17432 16521 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057594.1 protein_id gnl|my_center|LOCUS_18630 17826 17470 gene locus_tag LOCUS_18640 17826 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 18199 19083 gene locus_tag LOCUS_18650 18199 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 20248 19226 gene locus_tag LOCUS_18660 gene trpD 20248 19226 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 protein_id gnl|my_center|LOCUS_18660 20858 20277 gene locus_tag LOCUS_18670 20858 20277 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_18670 22358 20865 gene locus_tag LOCUS_18680 gene trpE 22358 20865 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_18680 23244 22543 gene locus_tag LOCUS_18690 23244 22543 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_18690 23927 23241 gene locus_tag LOCUS_18700 gene rpe 23927 23241 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215694.1 protein_id gnl|my_center|LOCUS_18700 24142 24954 gene locus_tag LOCUS_18710 24142 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 25276 25752 gene locus_tag LOCUS_18720 25276 25752 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_18720 26154 27173 gene locus_tag LOCUS_18730 26154 27173 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_18730 27437 28627 gene locus_tag LOCUS_18740 27437 28627 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_18740 28631 29731 gene locus_tag LOCUS_18750 28631 29731 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_18750 29764 30543 gene locus_tag LOCUS_18760 29764 30543 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385286.1 protein_id gnl|my_center|LOCUS_18760 31771 30890 gene locus_tag LOCUS_18770 31771 30890 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_18770 33067 32186 gene locus_tag LOCUS_18780 33067 32186 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_18780 33681 33064 gene locus_tag LOCUS_18790 33681 33064 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_18790 34260 36464 gene locus_tag LOCUS_18800 34260 36464 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_18800 38364 36691 gene locus_tag LOCUS_18810 38364 36691 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113882.1 protein_id gnl|my_center|LOCUS_18810 38594 40354 gene locus_tag LOCUS_18820 gene argS 38594 40354 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_18820 40354 40986 gene locus_tag LOCUS_18830 40354 40986 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_18830 41441 41211 gene locus_tag LOCUS_18840 41441 41211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 43753 41441 gene locus_tag LOCUS_18850 gene feoB 43753 41441 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_18850 44050 43796 gene locus_tag LOCUS_18860 44050 43796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 44979 44260 gene locus_tag LOCUS_18870 44979 44260 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_18870 45301 47055 gene locus_tag LOCUS_18880 45301 47055 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_18880 47361 48071 gene locus_tag LOCUS_18890 47361 48071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 48216 48548 gene locus_tag LOCUS_18900 48216 48548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 49210 53073 gene locus_tag LOCUS_18910 49210 53073 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247146.1 protein_id gnl|my_center|LOCUS_18910 53784 53122 gene locus_tag LOCUS_18920 53784 53122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 54893 53790 gene locus_tag LOCUS_18930 54893 53790 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_18930 55309 54893 gene locus_tag LOCUS_18940 55309 54893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 55742 56941 gene locus_tag LOCUS_18950 55742 56941 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_18950 60454 57236 gene locus_tag LOCUS_18960 60454 57236 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_18960 61511 60447 gene locus_tag LOCUS_18970 61511 60447 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_18970 61753 62676 gene locus_tag LOCUS_18980 61753 62676 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 protein_id gnl|my_center|LOCUS_18980 62676 63140 gene locus_tag LOCUS_18990 62676 63140 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393537.1 protein_id gnl|my_center|LOCUS_18990 63287 64234 gene locus_tag LOCUS_19000 63287 64234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 65110 64457 gene locus_tag LOCUS_19010 gene crp 65110 64457 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_19010 65188 65643 gene locus_tag LOCUS_19020 65188 65643 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_19020 67096 65966 gene locus_tag LOCUS_19030 gene nspC 67096 65966 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_19030 68329 67115 gene locus_tag LOCUS_19040 68329 67115 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_19040 69839 68643 gene locus_tag LOCUS_19050 69839 68643 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_19050 70383 70811 gene locus_tag LOCUS_19060 gene rplM 70383 70811 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_19060 70854 71246 gene locus_tag LOCUS_19070 gene rpsI 70854 71246 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_19070 71287 71360 gene locus_tag LOCUS_t00250 71287 71360 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 71780 72010 gene locus_tag LOCUS_19080 gene vapB 71780 72010 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 protein_id gnl|my_center|LOCUS_19080 72019 72420 gene locus_tag LOCUS_19090 72019 72420 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 protein_id gnl|my_center|LOCUS_19090 72978 72724 gene locus_tag LOCUS_19100 72978 72724 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_19100 73534 74520 gene locus_tag LOCUS_19110 73534 74520 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525210.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence052 1460 495 gene locus_tag LOCUS_19120 1460 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1827 2072 gene locus_tag LOCUS_19130 1827 2072 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970279.1 protein_id gnl|my_center|LOCUS_19130 2090 4135 gene locus_tag LOCUS_19140 gene hyfB 2090 4135 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_19140 4120 5085 gene locus_tag LOCUS_19150 4120 5085 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_19150 5082 5774 gene locus_tag LOCUS_19160 5082 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_19160 5771 7249 gene locus_tag LOCUS_19170 5771 7249 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_19170 7246 8820 gene locus_tag LOCUS_19180 7246 8820 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089083.1 protein_id gnl|my_center|LOCUS_19180 9092 9613 gene locus_tag LOCUS_19190 9092 9613 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_19190 9786 11042 gene locus_tag LOCUS_19200 9786 11042 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_19200 11222 10980 gene locus_tag LOCUS_19210 11222 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 11424 12308 gene locus_tag LOCUS_19220 11424 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 12472 12705 gene locus_tag LOCUS_19230 12472 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 13618 12947 gene locus_tag LOCUS_19240 13618 12947 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064660.1 protein_id gnl|my_center|LOCUS_19240 14059 14472 gene locus_tag LOCUS_19250 14059 14472 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_19250 14484 15917 gene locus_tag LOCUS_19260 14484 15917 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_19260 15914 16891 gene locus_tag LOCUS_19270 gene meaB 15914 16891 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969975.1 protein_id gnl|my_center|LOCUS_19270 16884 18590 gene locus_tag LOCUS_19280 16884 18590 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210246.1 protein_id gnl|my_center|LOCUS_19280 18846 19322 gene locus_tag LOCUS_19290 18846 19322 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625985.1 protein_id gnl|my_center|LOCUS_19290 19802 19590 gene locus_tag LOCUS_19300 19802 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 19913 20581 gene locus_tag LOCUS_19310 19913 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 21186 20635 gene locus_tag LOCUS_19320 gene thpR 21186 20635 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_19320 21462 22931 gene locus_tag LOCUS_19330 21462 22931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 23627 22959 gene locus_tag LOCUS_19340 23627 22959 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_19340 23837 23688 gene locus_tag LOCUS_19350 23837 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 24637 24149 gene locus_tag LOCUS_19360 24637 24149 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_19360 25649 24615 gene locus_tag LOCUS_19370 gene thiL 25649 24615 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752121.1 protein_id gnl|my_center|LOCUS_19370 26479 26057 gene locus_tag LOCUS_19380 gene nusB 26479 26057 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_19380 26965 26495 gene locus_tag LOCUS_19390 gene ribE 26965 26495 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_19390 28147 27035 gene locus_tag LOCUS_19400 gene ribBA 28147 27035 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_19400 27743 27664 gene locus_tag LOCUS_t00260 27743 27664 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29324 28659 gene locus_tag LOCUS_19410 29324 28659 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_19410 30460 29324 gene locus_tag LOCUS_19420 gene ribD 30460 29324 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 protein_id gnl|my_center|LOCUS_19420 30965 30450 gene locus_tag LOCUS_19430 gene nrdR 30965 30450 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_19430 32530 31277 gene locus_tag LOCUS_19440 32530 31277 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_19440 32755 33660 gene locus_tag LOCUS_19450 32755 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 33791 34576 gene locus_tag LOCUS_19460 33791 34576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 35123 34629 gene locus_tag LOCUS_19470 35123 34629 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_19470 35869 35189 gene locus_tag LOCUS_19480 35869 35189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 36448 35957 gene locus_tag LOCUS_19490 36448 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 37449 36442 gene locus_tag LOCUS_19500 37449 36442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_19500 38129 37452 gene locus_tag LOCUS_19510 38129 37452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_19510 39264 38134 gene locus_tag LOCUS_19520 39264 38134 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_19520 39566 39264 gene locus_tag LOCUS_19530 39566 39264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 40872 39922 gene locus_tag LOCUS_19540 40872 39922 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158129.1 protein_id gnl|my_center|LOCUS_19540 42189 40906 gene locus_tag LOCUS_19550 gene clpX 42189 40906 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_19550 43394 42468 gene locus_tag LOCUS_19560 43394 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 43849 43394 gene locus_tag LOCUS_19570 43849 43394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 44180 43833 gene locus_tag LOCUS_19580 44180 43833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 44740 44213 gene locus_tag LOCUS_19590 44740 44213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 45525 44743 gene locus_tag LOCUS_19600 gene cysE 45525 44743 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_19600 46676 45522 gene locus_tag LOCUS_19610 gene nifV 46676 45522 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_19610 47485 48033 gene locus_tag LOCUS_19620 47485 48033 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054079727.1 protein_id gnl|my_center|LOCUS_19620 48033 49784 gene locus_tag LOCUS_19630 48033 49784 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_19630 49986 52553 gene locus_tag LOCUS_19640 49986 52553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 53012 52734 gene locus_tag LOCUS_19650 53012 52734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 53315 53016 gene locus_tag LOCUS_19660 53315 53016 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_19660 54990 53779 gene locus_tag LOCUS_19670 gene nifS 54990 53779 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_19670 55884 54994 gene locus_tag LOCUS_19680 gene nifU 55884 54994 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_19680 56226 55903 gene locus_tag LOCUS_19690 56226 55903 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565964.1 protein_id gnl|my_center|LOCUS_19690 57487 57065 gene locus_tag LOCUS_19700 57487 57065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 57821 57495 gene locus_tag LOCUS_19710 57821 57495 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_19710 58164 57832 gene locus_tag LOCUS_19720 gene fdxB 58164 57832 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_19720 58390 58175 gene locus_tag LOCUS_19730 58390 58175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 59319 58846 gene locus_tag LOCUS_19740 59319 58846 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_19740 59943 59428 gene locus_tag LOCUS_19750 59943 59428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 60449 59964 gene locus_tag LOCUS_19760 60449 59964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 61818 60415 gene locus_tag LOCUS_19770 gene nifN 61818 60415 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389940.1 protein_id gnl|my_center|LOCUS_19770 63315 61822 gene locus_tag LOCUS_19780 gene nifE 63315 61822 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence053 149 874 gene locus_tag LOCUS_19790 149 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 887 1105 gene locus_tag LOCUS_19800 887 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1209 1391 gene locus_tag LOCUS_19810 1209 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1716 2807 gene locus_tag LOCUS_19820 1716 2807 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_19820 2809 5892 gene locus_tag LOCUS_19830 2809 5892 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_19830 6179 7087 gene locus_tag LOCUS_19840 6179 7087 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 protein_id gnl|my_center|LOCUS_19840 8777 7146 gene locus_tag LOCUS_19850 8777 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 10107 8818 gene locus_tag LOCUS_19860 10107 8818 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_19860 12353 10104 gene locus_tag LOCUS_19870 12353 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 13150 12350 gene locus_tag LOCUS_19880 13150 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 13917 13228 gene locus_tag LOCUS_19890 13917 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 14105 13974 gene locus_tag LOCUS_19900 14105 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 15270 14128 gene locus_tag LOCUS_19910 gene cydB 15270 14128 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195344.1 protein_id gnl|my_center|LOCUS_19910 16869 15283 gene locus_tag LOCUS_19920 gene cydA 16869 15283 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979005.1 protein_id gnl|my_center|LOCUS_19920 17111 16881 gene locus_tag LOCUS_19930 17111 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 18638 17415 gene locus_tag LOCUS_19940 18638 17415 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_19940 20167 18635 gene locus_tag LOCUS_19950 20167 18635 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494115.1 protein_id gnl|my_center|LOCUS_19950 21479 20181 gene locus_tag LOCUS_19960 21479 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 21950 21495 gene locus_tag LOCUS_19970 21950 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 22981 21947 gene locus_tag LOCUS_19980 22981 21947 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_19980 25915 23000 gene locus_tag LOCUS_19990 25915 23000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 27034 26504 gene locus_tag LOCUS_20000 27034 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 28043 27138 gene locus_tag LOCUS_20010 28043 27138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 32199 28495 gene locus_tag LOCUS_20020 32199 28495 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113331.1 protein_id gnl|my_center|LOCUS_20020 33950 32217 gene locus_tag LOCUS_20030 33950 32217 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_20030 34421 34092 gene locus_tag LOCUS_20040 34421 34092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 35122 34658 gene locus_tag LOCUS_20050 35122 34658 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_20050 36182 35271 gene locus_tag LOCUS_20060 gene asd 36182 35271 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_20060 37086 36271 gene locus_tag LOCUS_20070 gene rhdA 37086 36271 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_20070 38684 37320 gene locus_tag LOCUS_20080 38684 37320 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809679.1 protein_id gnl|my_center|LOCUS_20080 39337 39251 gene locus_tag LOCUS_t00270 39337 39251 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39443 40474 gene locus_tag LOCUS_20090 gene queA 39443 40474 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_20090 40636 41730 gene locus_tag LOCUS_20100 gene tgt 40636 41730 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_20100 41919 42251 gene locus_tag LOCUS_20110 41919 42251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 42379 44196 gene locus_tag LOCUS_20120 gene secD 42379 44196 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880549.1 protein_id gnl|my_center|LOCUS_20120 44211 45149 gene locus_tag LOCUS_20130 gene secF 44211 45149 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_20130 45475 45230 gene locus_tag LOCUS_20140 45475 45230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 46545 45748 gene locus_tag LOCUS_20150 gene suhB 46545 45748 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_20150 46662 47390 gene locus_tag LOCUS_20160 gene trmJ 46662 47390 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_20160 47695 48522 gene locus_tag LOCUS_20170 gene cysE 47695 48522 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_20170 48582 49100 gene locus_tag LOCUS_20180 gene iscR 48582 49100 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 protein_id gnl|my_center|LOCUS_20180 49135 50349 gene locus_tag LOCUS_20190 49135 50349 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_20190 50452 50838 gene locus_tag LOCUS_20200 gene iscU 50452 50838 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117907.1 protein_id gnl|my_center|LOCUS_20200 50912 51235 gene locus_tag LOCUS_20210 gene iscA 50912 51235 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_20210 51313 51858 gene locus_tag LOCUS_20220 gene hscB 51313 51858 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 protein_id gnl|my_center|LOCUS_20220 51913 53784 gene locus_tag LOCUS_20230 gene hscA 51913 53784 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_20230 53807 54145 gene locus_tag LOCUS_20240 gene fdx 53807 54145 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_20240 54159 54359 gene locus_tag LOCUS_20250 gene iscX 54159 54359 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_20250 54689 55927 gene locus_tag LOCUS_20260 54689 55927 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_20260 56510 56169 gene locus_tag LOCUS_20270 56510 56169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 56618 58795 gene locus_tag LOCUS_20280 56618 58795 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_20280 58941 60230 gene locus_tag LOCUS_20290 58941 60230 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_20290 60220 60900 gene locus_tag LOCUS_20300 60220 60900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809051.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence054 2231 1392 gene locus_tag LOCUS_20310 gene dinD 2231 1392 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_20310 4648 2228 gene locus_tag LOCUS_20320 4648 2228 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20320 5316 4642 gene locus_tag LOCUS_20330 5316 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20330 7307 5682 gene locus_tag LOCUS_20340 gene ipdC 7307 5682 CDS product indolepyruvate/phenylpyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390529.1 protein_id gnl|my_center|LOCUS_20340 7549 8028 gene locus_tag LOCUS_20350 7549 8028 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 protein_id gnl|my_center|LOCUS_20350 9034 8246 gene locus_tag LOCUS_20360 9034 8246 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_20360 9741 9310 gene locus_tag LOCUS_20370 9741 9310 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276487.1 protein_id gnl|my_center|LOCUS_20370 12425 9813 gene locus_tag LOCUS_20380 12425 9813 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454675.1 protein_id gnl|my_center|LOCUS_20380 13642 12662 gene locus_tag LOCUS_20390 13642 12662 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_20390 14650 13835 gene locus_tag LOCUS_20400 14650 13835 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_20400 16815 14647 gene locus_tag LOCUS_20410 16815 14647 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541107.1 protein_id gnl|my_center|LOCUS_20410 17581 16817 gene locus_tag LOCUS_20420 17581 16817 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_20420 18519 17617 gene locus_tag LOCUS_20430 18519 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 18971 19174 gene locus_tag LOCUS_20440 18971 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 19595 19254 gene locus_tag LOCUS_20450 19595 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 21343 19613 gene locus_tag LOCUS_20460 21343 19613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 21965 22651 gene locus_tag LOCUS_20470 21965 22651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 22968 22690 gene locus_tag LOCUS_20480 22968 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 23456 23049 gene locus_tag LOCUS_20490 23456 23049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 24151 23927 gene locus_tag LOCUS_20500 24151 23927 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_20500 26603 24165 gene locus_tag LOCUS_20510 26603 24165 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_20510 27135 26734 gene locus_tag LOCUS_20520 27135 26734 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_20520 28284 27379 gene locus_tag LOCUS_20530 28284 27379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 28485 29201 gene locus_tag LOCUS_20540 28485 29201 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705478.1 protein_id gnl|my_center|LOCUS_20540 29460 30911 gene locus_tag LOCUS_20550 29460 30911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 31241 31059 gene locus_tag LOCUS_20560 31241 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 31211 31516 gene locus_tag LOCUS_20570 31211 31516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 31681 32067 gene locus_tag LOCUS_20580 31681 32067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 32137 32880 gene locus_tag LOCUS_20590 32137 32880 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531914.1 protein_id gnl|my_center|LOCUS_20590 32928 33359 gene locus_tag LOCUS_20600 32928 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 34280 34008 gene locus_tag LOCUS_20610 34280 34008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 34617 34348 gene locus_tag LOCUS_20620 34617 34348 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_20620 35348 34851 gene locus_tag LOCUS_20630 35348 34851 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096939.1 protein_id gnl|my_center|LOCUS_20630 36675 35458 gene locus_tag LOCUS_20640 36675 35458 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_20640 37147 36716 gene locus_tag LOCUS_20650 37147 36716 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 protein_id gnl|my_center|LOCUS_20650 37671 37198 gene locus_tag LOCUS_20660 37671 37198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 38063 37731 gene locus_tag LOCUS_20670 38063 37731 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_20670 39030 38056 gene locus_tag LOCUS_20680 39030 38056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 39494 40330 gene locus_tag LOCUS_20690 39494 40330 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_20690 40522 41286 gene locus_tag LOCUS_20700 40522 41286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 42366 41737 gene locus_tag LOCUS_20710 42366 41737 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894962.1 protein_id gnl|my_center|LOCUS_20710 42813 42394 gene locus_tag LOCUS_20720 42813 42394 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_20720 44090 43038 gene locus_tag LOCUS_20730 44090 43038 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 protein_id gnl|my_center|LOCUS_20730 44357 44235 gene locus_tag LOCUS_20740 44357 44235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 44669 45529 gene locus_tag LOCUS_20750 44669 45529 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_20750 46638 45856 gene locus_tag LOCUS_20760 46638 45856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 47679 48263 gene locus_tag LOCUS_20770 47679 48263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 48337 48822 gene locus_tag LOCUS_20780 48337 48822 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_20780 49698 48907 gene locus_tag LOCUS_20790 49698 48907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_20790 50199 49843 gene locus_tag LOCUS_20800 50199 49843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 50104 51207 gene locus_tag LOCUS_20810 50104 51207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 51927 51262 gene locus_tag LOCUS_20820 51927 51262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925885.1 protein_id gnl|my_center|LOCUS_20820 52217 52068 gene locus_tag LOCUS_20830 52217 52068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 53623 52349 gene locus_tag LOCUS_20840 53623 52349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 55341 54541 gene locus_tag LOCUS_20850 55341 54541 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_20850 56908 55895 gene locus_tag LOCUS_20860 gene ansA 56908 55895 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 protein_id gnl|my_center|LOCUS_20860 58311 56905 gene locus_tag LOCUS_20870 gene aspA 58311 56905 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 protein_id gnl|my_center|LOCUS_20870 60104 58629 gene locus_tag LOCUS_20880 60104 58629 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 protein_id gnl|my_center|LOCUS_20880 60321 61133 gene locus_tag LOCUS_20890 60321 61133 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 protein_id gnl|my_center|LOCUS_20890 61500 61745 gene locus_tag LOCUS_20900 61500 61745 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_20900 61745 62062 gene locus_tag LOCUS_20910 61745 62062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence055 770 204 gene locus_tag LOCUS_20920 770 204 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769752.1 protein_id gnl|my_center|LOCUS_20920 1283 783 gene locus_tag LOCUS_20930 gene purE 1283 783 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_20930 1493 3208 gene locus_tag LOCUS_20940 1493 3208 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_20940 3214 3879 gene locus_tag LOCUS_20950 3214 3879 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_20950 4045 4419 gene locus_tag LOCUS_20960 4045 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4434 5075 gene locus_tag LOCUS_20970 4434 5075 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_20970 8395 5150 gene locus_tag LOCUS_20980 8395 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 8801 10726 gene locus_tag LOCUS_20990 8801 10726 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 protein_id gnl|my_center|LOCUS_20990 11858 11010 gene locus_tag LOCUS_21000 11858 11010 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 protein_id gnl|my_center|LOCUS_21000 12388 12104 gene locus_tag LOCUS_21010 12388 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 12983 12747 gene locus_tag LOCUS_21020 gene vapB 12983 12747 CDS product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_21020 13547 13239 gene locus_tag LOCUS_21030 13547 13239 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_21030 13780 13541 gene locus_tag LOCUS_21040 13780 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 14202 13816 gene locus_tag LOCUS_21050 14202 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 14887 14639 gene locus_tag LOCUS_21060 gene yefM 14887 14639 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_21060 15300 14959 gene locus_tag LOCUS_21070 15300 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 15746 18395 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaaacacccccacgggcgtggggaagac 18715 18879 gene locus_tag LOCUS_21080 18715 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 19160 20689 gene locus_tag LOCUS_21090 gene istA 19160 20689 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_21090 20673 21497 gene locus_tag LOCUS_21100 20673 21497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 21494 21703 gene locus_tag LOCUS_21110 21494 21703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 21839 24794 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaaacacccccacgggcgtggggaagac 25982 25107 gene locus_tag LOCUS_21120 gene cas1e 25982 25107 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933633.1 protein_id gnl|my_center|LOCUS_21120 26698 25988 gene locus_tag LOCUS_21130 gene cas5e 26698 25988 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 protein_id gnl|my_center|LOCUS_21130 27735 26707 gene locus_tag LOCUS_21140 gene cas7e 27735 26707 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933631.1 protein_id gnl|my_center|LOCUS_21140 28394 27750 gene locus_tag LOCUS_21150 gene cas6e 28394 27750 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_21150 28945 28391 gene locus_tag LOCUS_21160 gene casB 28945 28391 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933629.1 protein_id gnl|my_center|LOCUS_21160 30458 28950 gene locus_tag LOCUS_21170 gene casA 30458 28950 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 protein_id gnl|my_center|LOCUS_21170 32242 30470 gene locus_tag LOCUS_21180 32242 30470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21180 34195 33230 gene locus_tag LOCUS_21190 34195 33230 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_21190 34821 35366 gene locus_tag LOCUS_21200 34821 35366 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881088.1 protein_id gnl|my_center|LOCUS_21200 35386 36705 gene locus_tag LOCUS_21210 35386 36705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 36705 37472 gene locus_tag LOCUS_21220 36705 37472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 38645 37638 gene locus_tag LOCUS_21230 38645 37638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 38993 38667 gene locus_tag LOCUS_21240 38993 38667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 39439 42174 gene locus_tag LOCUS_21250 39439 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 43132 42146 gene locus_tag LOCUS_21260 43132 42146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 43828 43433 gene locus_tag LOCUS_21270 43828 43433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 43987 44415 gene locus_tag LOCUS_21280 43987 44415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 44805 45227 gene locus_tag LOCUS_21290 44805 45227 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_21290 45654 46298 gene locus_tag LOCUS_21300 45654 46298 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_21300 46613 48190 gene locus_tag LOCUS_21310 46613 48190 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_21310 48475 48882 gene locus_tag LOCUS_21320 48475 48882 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_21320 48997 49506 gene locus_tag LOCUS_21330 48997 49506 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976395.1 protein_id gnl|my_center|LOCUS_21330 49852 50292 gene locus_tag LOCUS_21340 49852 50292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 51905 50424 gene locus_tag LOCUS_21350 51905 50424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 52294 51920 gene locus_tag LOCUS_21360 52294 51920 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_21360 55043 52266 gene locus_tag LOCUS_21370 55043 52266 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_21370 55284 55084 gene locus_tag LOCUS_21380 55284 55084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 55996 55613 gene locus_tag LOCUS_21390 gene gloA 55996 55613 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_21390 56901 56200 gene locus_tag LOCUS_21400 56901 56200 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_21400 57600 57043 gene locus_tag LOCUS_21410 57600 57043 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 protein_id gnl|my_center|LOCUS_21410 58168 57728 gene locus_tag LOCUS_21420 58168 57728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 58511 59875 gene locus_tag LOCUS_21430 58511 59875 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_21430 60114 60650 gene locus_tag LOCUS_21440 60114 60650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence056 462 3710 gene locus_tag LOCUS_21450 gene rne 462 3710 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419707.1 protein_id gnl|my_center|LOCUS_21450 4438 4034 gene locus_tag LOCUS_21460 4438 4034 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_21460 4763 5128 gene locus_tag LOCUS_21470 4763 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5290 5574 gene locus_tag LOCUS_21480 5290 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 6387 5611 gene locus_tag LOCUS_21490 gene kdsB 6387 5611 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 protein_id gnl|my_center|LOCUS_21490 6601 6419 gene locus_tag LOCUS_21500 6601 6419 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_21500 7592 6594 gene locus_tag LOCUS_21510 gene lpxK 7592 6594 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267144.1 protein_id gnl|my_center|LOCUS_21510 8025 7600 gene locus_tag LOCUS_21520 8025 7600 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_21520 8646 8032 gene locus_tag LOCUS_21530 8646 8032 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_21530 11311 8999 gene locus_tag LOCUS_21540 11311 8999 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_21540 11612 12124 gene locus_tag LOCUS_21550 11612 12124 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_21550 12824 12129 gene locus_tag LOCUS_21560 gene lolD 12824 12129 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_21560 14064 12817 gene locus_tag LOCUS_21570 14064 12817 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_21570 14386 14676 gene locus_tag LOCUS_21580 14386 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037342.1 protein_id gnl|my_center|LOCUS_21580 14727 15791 gene locus_tag LOCUS_21590 14727 15791 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275355.1 protein_id gnl|my_center|LOCUS_21590 15905 16816 gene locus_tag LOCUS_21600 15905 16816 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_21600 17085 16843 gene locus_tag LOCUS_21610 17085 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 18008 17130 gene locus_tag LOCUS_21620 18008 17130 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_21620 19592 18135 gene locus_tag LOCUS_21630 19592 18135 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932736.1 protein_id gnl|my_center|LOCUS_21630 19745 20581 gene locus_tag LOCUS_21640 19745 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 20693 21493 gene locus_tag LOCUS_21650 20693 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 21722 22447 gene locus_tag LOCUS_21660 21722 22447 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704890.1 protein_id gnl|my_center|LOCUS_21660 22520 22894 gene locus_tag LOCUS_21670 22520 22894 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_21670 23039 23962 gene locus_tag LOCUS_21680 23039 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 24920 23988 gene locus_tag LOCUS_21690 24920 23988 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_21690 25534 25091 gene locus_tag LOCUS_21700 25534 25091 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812126.1 protein_id gnl|my_center|LOCUS_21700 26573 25596 gene locus_tag LOCUS_21710 26573 25596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 27239 26841 gene locus_tag LOCUS_21720 27239 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 27445 28122 gene locus_tag LOCUS_21730 27445 28122 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 protein_id gnl|my_center|LOCUS_21730 30168 28132 gene locus_tag LOCUS_21740 30168 28132 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_21740 30504 31490 gene locus_tag LOCUS_21750 30504 31490 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162840014.1 protein_id gnl|my_center|LOCUS_21750 33717 31468 gene locus_tag LOCUS_21760 33717 31468 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036078.1 protein_id gnl|my_center|LOCUS_21760 36353 33894 gene locus_tag LOCUS_21770 36353 33894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 36970 37815 gene locus_tag LOCUS_21780 36970 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 39139 37826 gene locus_tag LOCUS_21790 39139 37826 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768856.1 protein_id gnl|my_center|LOCUS_21790 40329 39292 gene locus_tag LOCUS_21800 40329 39292 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064483.1 protein_id gnl|my_center|LOCUS_21800 40630 42702 gene locus_tag LOCUS_21810 gene prsK 40630 42702 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_21810 42720 44075 gene locus_tag LOCUS_21820 gene prsR 42720 44075 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_21820 45642 44254 gene locus_tag LOCUS_21830 45642 44254 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_21830 46617 46183 gene locus_tag LOCUS_21840 46617 46183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 47922 46939 gene locus_tag LOCUS_21850 gene cobD 47922 46939 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_21850 48817 47915 gene locus_tag LOCUS_21860 gene cbiB 48817 47915 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_21860 49554 48814 gene locus_tag LOCUS_21870 49554 48814 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_21870 50197 49559 gene locus_tag LOCUS_21880 50197 49559 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766688.1 protein_id gnl|my_center|LOCUS_21880 51243 50194 gene locus_tag LOCUS_21890 gene cobT 51243 50194 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268579.1 protein_id gnl|my_center|LOCUS_21890 51767 51240 gene locus_tag LOCUS_21900 gene cobU 51767 51240 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_21900 52110 52847 gene locus_tag LOCUS_21910 gene bluB 52110 52847 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969508.1 protein_id gnl|my_center|LOCUS_21910 53163 55169 gene locus_tag LOCUS_21920 53163 55169 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_21920 55444 55896 gene locus_tag LOCUS_21930 55444 55896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 56232 58022 gene locus_tag LOCUS_21940 56232 58022 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268439.1 protein_id gnl|my_center|LOCUS_21940 58102 58710 gene locus_tag LOCUS_21950 gene lexA 58102 58710 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036298.1 protein_id gnl|my_center|LOCUS_21950 59275 58934 gene locus_tag LOCUS_21960 59275 58934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 60453 59611 gene locus_tag LOCUS_21970 60453 59611 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_21970 60639 60797 gene locus_tag LOCUS_21980 60639 60797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 63130 60794 gene locus_tag LOCUS_21990 63130 60794 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_21990 63941 64144 gene locus_tag LOCUS_22000 63941 64144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 64790 64482 gene locus_tag LOCUS_22010 gene ihfB 64790 64482 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554561.1 protein_id gnl|my_center|LOCUS_22010 66546 64870 gene locus_tag LOCUS_22020 gene rpsA 66546 64870 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705690.1 protein_id gnl|my_center|LOCUS_22020 67315 66650 gene locus_tag LOCUS_22030 gene cmk 67315 66650 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_22030 68641 67316 gene locus_tag LOCUS_22040 68641 67316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 71020 69005 gene locus_tag LOCUS_22050 gene ligA 71020 69005 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 protein_id gnl|my_center|LOCUS_22050 71847 71017 gene locus_tag LOCUS_22060 71847 71017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 75457 71951 gene locus_tag LOCUS_22070 gene smc 75457 71951 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_22070 75669 76058 gene locus_tag LOCUS_22080 gene queF 75669 76058 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_22080 77258 76347 gene locus_tag LOCUS_22090 gene rdgC 77258 76347 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_22090 78430 77345 gene locus_tag LOCUS_22100 gene amrS 78430 77345 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_22100 79956 78505 gene locus_tag LOCUS_22110 79956 78505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 80695 80024 gene locus_tag LOCUS_22120 80695 80024 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_22120 80944 81342 gene locus_tag LOCUS_22130 80944 81342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 81712 82500 gene locus_tag LOCUS_22140 gene amrB 81712 82500 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_22140 82487 83068 gene locus_tag LOCUS_22150 82487 83068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 84126 83206 gene locus_tag LOCUS_22160 84126 83206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 84393 85301 gene locus_tag LOCUS_22170 84393 85301 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_22170 85407 86270 gene locus_tag LOCUS_22180 85407 86270 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_22180 86354 87076 gene locus_tag LOCUS_22190 86354 87076 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_22190 87249 90830 gene locus_tag LOCUS_22200 87249 90830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 91877 90939 gene locus_tag LOCUS_22210 91877 90939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 92612 92118 gene locus_tag LOCUS_22220 92612 92118 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945773.1 protein_id gnl|my_center|LOCUS_22220 93563 92859 gene locus_tag LOCUS_22230 93563 92859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 93961 93560 gene locus_tag LOCUS_22240 93961 93560 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_22240 94625 93951 gene locus_tag LOCUS_22250 94625 93951 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_22250 95374 94622 gene locus_tag LOCUS_22260 95374 94622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 96423 95371 gene locus_tag LOCUS_22270 96423 95371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 97250 96420 gene locus_tag LOCUS_22280 97250 96420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 99434 97263 gene locus_tag LOCUS_22290 99434 97263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 100201 102630 gene locus_tag LOCUS_22300 100201 102630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 102642 105767 gene locus_tag LOCUS_22310 102642 105767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 106050 106766 gene locus_tag LOCUS_22320 106050 106766 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_22320 107014 108192 gene locus_tag LOCUS_22330 107014 108192 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_22330 110310 108556 gene locus_tag LOCUS_22340 gene aceK 110310 108556 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_22340 110719 112350 gene locus_tag LOCUS_22350 gene aceB 110719 112350 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107325.1 protein_id gnl|my_center|LOCUS_22350 112447 113757 gene locus_tag LOCUS_22360 gene aceA 112447 113757 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_22360 114046 114540 gene locus_tag LOCUS_22370 gene rraA 114046 114540 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765718.1 protein_id gnl|my_center|LOCUS_22370 114728 115516 gene locus_tag LOCUS_22380 114728 115516 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080286.1 protein_id gnl|my_center|LOCUS_22380 115808 117370 gene locus_tag LOCUS_22390 115808 117370 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_22390 117770 118981 gene locus_tag LOCUS_22400 117770 118981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966696.1 protein_id gnl|my_center|LOCUS_22400 119065 119931 gene locus_tag LOCUS_22410 119065 119931 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_22410 119954 120937 gene locus_tag LOCUS_22420 119954 120937 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_22420 120940 121701 gene locus_tag LOCUS_22430 120940 121701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_22430 121828 122553 gene locus_tag LOCUS_22440 121828 122553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_22440 122798 124666 gene locus_tag LOCUS_22450 122798 124666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 124663 126003 gene locus_tag LOCUS_22460 124663 126003 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_22460 127453 126410 gene locus_tag LOCUS_22470 127453 126410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 128709 127615 gene locus_tag LOCUS_22480 128709 127615 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_22480 129075 129338 gene locus_tag LOCUS_22490 129075 129338 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720744.1 protein_id gnl|my_center|LOCUS_22490 129354 131099 gene locus_tag LOCUS_22500 129354 131099 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_22500 131171 133027 gene locus_tag LOCUS_22510 131171 133027 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_22510 133031 133729 gene locus_tag LOCUS_22520 133031 133729 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477841.1 protein_id gnl|my_center|LOCUS_22520 134671 133979 gene locus_tag LOCUS_22530 134671 133979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 135028 135750 gene locus_tag LOCUS_22540 gene phbB 135028 135750 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_22540 136241 135810 gene locus_tag LOCUS_22550 136241 135810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 136542 137987 gene locus_tag LOCUS_22560 136542 137987 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072336.1 protein_id gnl|my_center|LOCUS_22560 138350 138117 gene locus_tag LOCUS_22570 gene yidD 138350 138117 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_22570 138852 138385 gene locus_tag LOCUS_22580 gene zur 138852 138385 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_22580 139703 138849 gene locus_tag LOCUS_22590 139703 138849 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_22590 140447 139716 gene locus_tag LOCUS_22600 140447 139716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_22600 141319 140444 gene locus_tag LOCUS_22610 141319 140444 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_22610 141447 142031 gene locus_tag LOCUS_22620 141447 142031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 143948 142383 gene locus_tag LOCUS_22630 143948 142383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 144722 143952 gene locus_tag LOCUS_22640 144722 143952 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_22640 145398 144751 gene locus_tag LOCUS_22650 gene dsbA 145398 144751 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_22650 146486 145881 gene locus_tag LOCUS_22660 146486 145881 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_22660 146978 148249 gene locus_tag LOCUS_22670 146978 148249 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398674.1 protein_id gnl|my_center|LOCUS_22670 148242 149966 gene locus_tag LOCUS_22680 gene menD 148242 149966 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_22680 150268 151098 gene locus_tag LOCUS_22690 gene menB 150268 151098 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171617.1 protein_id gnl|my_center|LOCUS_22690 151117 151986 gene locus_tag LOCUS_22700 151117 151986 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_22700 151986 153047 gene locus_tag LOCUS_22710 gene menC 151986 153047 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838743.1 protein_id gnl|my_center|LOCUS_22710 153074 154072 gene locus_tag LOCUS_22720 153074 154072 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939915.1 protein_id gnl|my_center|LOCUS_22720 154080 154457 gene locus_tag LOCUS_22730 154080 154457 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_22730 154454 154723 gene locus_tag LOCUS_22740 154454 154723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 156366 154915 gene locus_tag LOCUS_22750 156366 154915 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_22750 156684 157376 gene locus_tag LOCUS_22760 156684 157376 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083419.1 protein_id gnl|my_center|LOCUS_22760 158041 157478 gene locus_tag LOCUS_22770 158041 157478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 158216 158476 gene locus_tag LOCUS_22780 158216 158476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 159907 158582 gene locus_tag LOCUS_22790 gene carS 159907 158582 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_22790 160572 159904 gene locus_tag LOCUS_22800 160572 159904 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_22800 160900 160607 gene locus_tag LOCUS_22810 160900 160607 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368558.1 protein_id gnl|my_center|LOCUS_22810 161223 161435 gene locus_tag LOCUS_22820 161223 161435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence057 717 1439 gene locus_tag LOCUS_22830 717 1439 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461975.1 protein_id gnl|my_center|LOCUS_22830 1451 2338 gene locus_tag LOCUS_22840 gene nrfD 1451 2338 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459139.1 protein_id gnl|my_center|LOCUS_22840 2349 5018 gene locus_tag LOCUS_22850 2349 5018 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_22850 5116 5838 gene locus_tag LOCUS_22860 5116 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5835 6989 gene locus_tag LOCUS_22870 5835 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 7384 7818 gene locus_tag LOCUS_22880 7384 7818 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392789.1 protein_id gnl|my_center|LOCUS_22880 7809 8972 gene locus_tag LOCUS_22890 7809 8972 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888504.1 protein_id gnl|my_center|LOCUS_22890 9115 9399 gene locus_tag LOCUS_22900 9115 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 9583 10665 gene locus_tag LOCUS_22910 gene apbC 9583 10665 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_22910 10662 11606 gene locus_tag LOCUS_22920 10662 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 11620 12372 gene locus_tag LOCUS_22930 11620 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 12369 12881 gene locus_tag LOCUS_22940 12369 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 13328 14044 gene locus_tag LOCUS_22950 13328 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 14233 15114 gene locus_tag LOCUS_22960 gene phnD 14233 15114 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272622.1 protein_id gnl|my_center|LOCUS_22960 15111 16550 gene locus_tag LOCUS_22970 15111 16550 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937430.1 protein_id gnl|my_center|LOCUS_22970 16547 17872 gene locus_tag LOCUS_22980 gene atoC 16547 17872 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_22980 18659 17964 gene locus_tag LOCUS_22990 18659 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 19356 18646 gene locus_tag LOCUS_23000 19356 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 21878 19353 gene locus_tag LOCUS_23010 gene phsA 21878 19353 CDS product thiosulfate reductase PhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073774.1 protein_id gnl|my_center|LOCUS_23010 22843 21890 gene locus_tag LOCUS_23020 gene nrfD 22843 21890 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_23020 23589 22846 gene locus_tag LOCUS_23030 23589 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 23957 24790 gene locus_tag LOCUS_23040 gene phnD 23957 24790 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_23040 24787 26250 gene locus_tag LOCUS_23050 24787 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 26247 27578 gene locus_tag LOCUS_23060 26247 27578 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_23060 29634 27592 gene locus_tag LOCUS_23070 29634 27592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 31087 29879 gene locus_tag LOCUS_23080 31087 29879 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_23080 31749 31297 gene locus_tag LOCUS_23090 31749 31297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 32792 32166 gene locus_tag LOCUS_23100 32792 32166 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928704.1 protein_id gnl|my_center|LOCUS_23100 32927 33865 gene locus_tag LOCUS_23110 32927 33865 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_23110 33885 34847 gene locus_tag LOCUS_23120 33885 34847 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_23120 34844 35581 gene locus_tag LOCUS_23130 34844 35581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_23130 35936 35643 gene locus_tag LOCUS_23140 35936 35643 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_23140 37136 36075 gene locus_tag LOCUS_23150 37136 36075 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_23150 37813 37283 gene locus_tag LOCUS_23160 37813 37283 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_23160 39170 37869 gene locus_tag LOCUS_23170 gene arsJ 39170 37869 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_23170 39613 39167 gene locus_tag LOCUS_23180 39613 39167 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_23180 40622 39615 gene locus_tag LOCUS_23190 40622 39615 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_23190 41669 40752 gene locus_tag LOCUS_23200 41669 40752 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_23200 42772 41672 gene locus_tag LOCUS_23210 gene arsB 42772 41672 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_23210 43157 42810 gene locus_tag LOCUS_23220 43157 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 43641 43565 gene locus_tag LOCUS_t00280 43641 43565 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 44086 44646 gene locus_tag LOCUS_23230 44086 44646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 46957 44948 gene locus_tag LOCUS_23240 gene rep 46957 44948 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 protein_id gnl|my_center|LOCUS_23240 47166 47879 gene locus_tag LOCUS_23250 47166 47879 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_23250 48267 48599 gene locus_tag LOCUS_23260 48267 48599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 48732 49430 gene locus_tag LOCUS_23270 gene phoB 48732 49430 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420619.1 protein_id gnl|my_center|LOCUS_23270 49427 50725 gene locus_tag LOCUS_23280 gene phoR 49427 50725 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_23280 50958 50749 gene locus_tag LOCUS_23290 50958 50749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 51461 52510 gene locus_tag LOCUS_23300 51461 52510 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_23300 52631 54019 gene locus_tag LOCUS_23310 gene pstC 52631 54019 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_23310 54012 55310 gene locus_tag LOCUS_23320 gene pstA 54012 55310 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_23320 55390 56274 gene locus_tag LOCUS_23330 gene pstB 55390 56274 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_23330 56278 57006 gene locus_tag LOCUS_23340 gene phoU 56278 57006 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378397.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence058 1339 155 gene locus_tag LOCUS_23350 1339 155 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393313.1 protein_id gnl|my_center|LOCUS_23350 2100 1468 gene locus_tag LOCUS_23360 2100 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2198 3031 gene locus_tag LOCUS_23370 gene tcdA 2198 3031 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_23370 4159 3857 gene locus_tag LOCUS_23380 4159 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 4813 4469 gene locus_tag LOCUS_23390 4813 4469 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_23390 5055 4843 gene locus_tag LOCUS_23400 5055 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 7981 5156 gene locus_tag LOCUS_23410 7981 5156 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 protein_id gnl|my_center|LOCUS_23410 8601 10757 gene locus_tag LOCUS_23420 8601 10757 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_23420 11131 11056 gene locus_tag LOCUS_t00290 11131 11056 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11340 12569 gene locus_tag LOCUS_23430 gene pcnB 11340 12569 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036939.1 protein_id gnl|my_center|LOCUS_23430 12606 13109 gene locus_tag LOCUS_23440 gene folK 12606 13109 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_23440 13102 13761 gene locus_tag LOCUS_23450 13102 13761 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_23450 13888 14685 gene locus_tag LOCUS_23460 gene panB 13888 14685 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_23460 14798 15649 gene locus_tag LOCUS_23470 gene panC 14798 15649 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_23470 17399 15951 gene locus_tag LOCUS_23480 17399 15951 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_23480 19088 17580 gene locus_tag LOCUS_23490 gene glgA 19088 17580 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125204.1 protein_id gnl|my_center|LOCUS_23490 20322 19369 gene locus_tag LOCUS_23500 20322 19369 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_23500 22244 20448 gene locus_tag LOCUS_23510 22244 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 22694 23638 gene locus_tag LOCUS_23520 22694 23638 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_23520 23722 24450 gene locus_tag LOCUS_23530 23722 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 24603 26000 gene locus_tag LOCUS_23540 gene asnS 24603 26000 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211301.1 protein_id gnl|my_center|LOCUS_23540 26473 26108 gene locus_tag LOCUS_23550 26473 26108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 27415 26654 gene locus_tag LOCUS_23560 27415 26654 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_23560 27683 28279 gene locus_tag LOCUS_23570 27683 28279 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_23570 29601 28411 gene locus_tag LOCUS_23580 29601 28411 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208982.1 protein_id gnl|my_center|LOCUS_23580 30752 29721 gene locus_tag LOCUS_23590 gene tdh 30752 29721 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422510.1 protein_id gnl|my_center|LOCUS_23590 31424 32389 gene locus_tag LOCUS_23600 gene msrP 31424 32389 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_23600 32405 33067 gene locus_tag LOCUS_23610 gene msrQ 32405 33067 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_23610 33181 33951 gene locus_tag LOCUS_23620 33181 33951 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_23620 34328 35662 gene locus_tag LOCUS_23630 34328 35662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 37192 36089 gene locus_tag LOCUS_23640 37192 36089 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_23640 39118 37766 gene locus_tag LOCUS_23650 39118 37766 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_23650 40136 39321 gene locus_tag LOCUS_23660 40136 39321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_23660 41563 40235 gene locus_tag LOCUS_23670 41563 40235 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_23670 42719 41640 gene locus_tag LOCUS_23680 42719 41640 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_23680 43715 42723 gene locus_tag LOCUS_23690 43715 42723 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_23690 44676 43891 gene locus_tag LOCUS_23700 44676 43891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_23700 46669 44693 gene locus_tag LOCUS_23710 46669 44693 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 protein_id gnl|my_center|LOCUS_23710 47902 47069 gene locus_tag LOCUS_23720 47902 47069 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_23720 49952 48513 gene locus_tag LOCUS_23730 49952 48513 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence059 <1 534 gene locus_tag LOCUS_23740 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931302.1:site-specific DNA-methyltransferase note possible pseudo, internal stop codon 559 1515 gene locus_tag LOCUS_23750 559 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23750 1512 3587 gene locus_tag LOCUS_23760 1512 3587 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_23760 4603 3680 gene locus_tag LOCUS_23770 4603 3680 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_23770 5191 4802 gene locus_tag LOCUS_23780 5191 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5430 6902 gene locus_tag LOCUS_23790 5430 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 7070 8032 gene locus_tag LOCUS_23800 7070 8032 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063815.1 protein_id gnl|my_center|LOCUS_23800 8230 8892 gene locus_tag LOCUS_23810 8230 8892 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_23810 8932 9999 gene locus_tag LOCUS_23820 8932 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 11389 10124 gene locus_tag LOCUS_23830 gene fabF 11389 10124 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895556.1 protein_id gnl|my_center|LOCUS_23830 11648 12310 gene locus_tag LOCUS_23840 11648 12310 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_23840 12422 13153 gene locus_tag LOCUS_23850 12422 13153 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064825.1 protein_id gnl|my_center|LOCUS_23850 13235 14116 gene locus_tag LOCUS_23860 13235 14116 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_23860 14799 14113 gene locus_tag LOCUS_23870 14799 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 15042 15329 gene locus_tag LOCUS_23880 15042 15329 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049831911.1 protein_id gnl|my_center|LOCUS_23880 15808 15389 gene locus_tag LOCUS_23890 15808 15389 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_23890 16712 15798 gene locus_tag LOCUS_23900 16712 15798 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_23900 17970 17275 gene locus_tag LOCUS_23910 gene narI 17970 17275 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160113.1 protein_id gnl|my_center|LOCUS_23910 18498 17983 gene locus_tag LOCUS_23920 18498 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 20079 18514 gene locus_tag LOCUS_23930 gene narH 20079 18514 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_23930 23907 20146 gene locus_tag LOCUS_23940 23907 20146 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 protein_id gnl|my_center|LOCUS_23940 25674 24070 gene locus_tag LOCUS_23950 25674 24070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 27174 25735 gene locus_tag LOCUS_23960 27174 25735 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_23960 27464 29446 gene locus_tag LOCUS_23970 gene narX 27464 29446 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_23970 29759 30412 gene locus_tag LOCUS_23980 gene narL 29759 30412 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_23980 31580 30696 gene locus_tag LOCUS_23990 31580 30696 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_23990 31993 33396 gene locus_tag LOCUS_24000 gene leuC 31993 33396 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_24000 33396 34040 gene locus_tag LOCUS_24010 gene leuD 33396 34040 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_24010 34281 35363 gene locus_tag LOCUS_24020 gene leuB 34281 35363 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_24020 35520 36635 gene locus_tag LOCUS_24030 gene asd 35520 36635 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_24030 37087 38097 gene locus_tag LOCUS_24040 37087 38097 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_24040 38199 41129 gene locus_tag LOCUS_24050 gene fimV 38199 41129 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_24050 41391 42167 gene locus_tag LOCUS_24060 gene truA 41391 42167 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770596.1 protein_id gnl|my_center|LOCUS_24060 42315 42899 gene locus_tag LOCUS_24070 42315 42899 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_24070 42877 44094 gene locus_tag LOCUS_24080 gene trpB 42877 44094 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_24080 44091 44897 gene locus_tag LOCUS_24090 gene trpA 44091 44897 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_24090 44962 45864 gene locus_tag LOCUS_24100 gene accD 44962 45864 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037670.1 protein_id gnl|my_center|LOCUS_24100 46392 47666 gene locus_tag LOCUS_24110 gene folC 46392 47666 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_24110 48020 48622 gene locus_tag LOCUS_24120 48020 48622 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957873.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence060 1019 606 gene locus_tag LOCUS_24130 1019 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1302 1036 gene locus_tag LOCUS_24140 1302 1036 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_24140 1668 1952 gene locus_tag LOCUS_24150 1668 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1949 3196 gene locus_tag LOCUS_24160 1949 3196 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_24160 3458 3382 gene locus_tag LOCUS_t00300 3458 3382 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3616 3526 gene locus_tag LOCUS_t00310 3616 3526 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4110 3913 gene locus_tag LOCUS_24170 gene csrA 4110 3913 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305164.1 protein_id gnl|my_center|LOCUS_24170 5589 4357 gene locus_tag LOCUS_24180 5589 4357 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_24180 8316 5710 gene locus_tag LOCUS_24190 gene alaS 8316 5710 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_24190 8535 9053 gene locus_tag LOCUS_24200 8535 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 9771 9277 gene locus_tag LOCUS_24210 gene recX 9771 9277 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 protein_id gnl|my_center|LOCUS_24210 10807 9773 gene locus_tag LOCUS_24220 gene recA 10807 9773 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_24220 11012 12313 gene locus_tag LOCUS_24230 11012 12313 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_24230 13009 12527 gene locus_tag LOCUS_24240 gene pncC 13009 12527 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301974.1 protein_id gnl|my_center|LOCUS_24240 13149 13421 gene locus_tag LOCUS_24250 13149 13421 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_24250 13464 16046 gene locus_tag LOCUS_24260 gene mutS 13464 16046 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_24260 16771 16109 gene locus_tag LOCUS_24270 16771 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 17558 16809 gene locus_tag LOCUS_24280 17558 16809 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 protein_id gnl|my_center|LOCUS_24280 18581 17826 gene locus_tag LOCUS_24290 18581 17826 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_24290 19065 18583 gene locus_tag LOCUS_24300 19065 18583 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 protein_id gnl|my_center|LOCUS_24300 20015 19113 gene locus_tag LOCUS_24310 gene xerD 20015 19113 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_24310 20502 21521 gene locus_tag LOCUS_24320 gene hemH 20502 21521 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367903.1 protein_id gnl|my_center|LOCUS_24320 21646 22824 gene locus_tag LOCUS_24330 21646 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 24386 23115 gene locus_tag LOCUS_24340 24386 23115 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_24340 25157 24588 gene locus_tag LOCUS_24350 25157 24588 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085258.1 protein_id gnl|my_center|LOCUS_24350 25908 28877 gene locus_tag LOCUS_24360 gene cbrA 25908 28877 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_24360 28855 30210 gene locus_tag LOCUS_24370 gene cbrB 28855 30210 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_24370 30444 32429 gene locus_tag LOCUS_24380 30444 32429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 32599 32832 gene locus_tag LOCUS_24390 32599 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 32825 33520 gene locus_tag LOCUS_24400 32825 33520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 33702 33538 gene locus_tag LOCUS_24410 33702 33538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 33818 35698 gene locus_tag LOCUS_24420 33818 35698 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881379.1 protein_id gnl|my_center|LOCUS_24420 35828 36556 gene locus_tag LOCUS_24430 35828 36556 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068132808.1 protein_id gnl|my_center|LOCUS_24430 36677 38617 gene locus_tag LOCUS_24440 gene acs 36677 38617 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_24440 39046 41382 gene locus_tag LOCUS_24450 39046 41382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 41632 42450 gene locus_tag LOCUS_24460 41632 42450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 43029 42457 gene locus_tag LOCUS_24470 43029 42457 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_24470 43322 43840 gene locus_tag LOCUS_24480 gene sixA 43322 43840 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979596.1 protein_id gnl|my_center|LOCUS_24480 43984 45504 gene locus_tag LOCUS_24490 gene ppx 43984 45504 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_24490 45764 46306 gene locus_tag LOCUS_24500 45764 46306 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_24500 46306 48225 gene locus_tag LOCUS_24510 46306 48225 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence061 424 218 gene locus_tag LOCUS_24520 424 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1130 474 gene locus_tag LOCUS_24530 1130 474 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_24530 1317 1841 gene locus_tag LOCUS_24540 gene rppH 1317 1841 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 protein_id gnl|my_center|LOCUS_24540 1845 4112 gene locus_tag LOCUS_24550 gene ptsP 1845 4112 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958293.1 protein_id gnl|my_center|LOCUS_24550 5660 4533 gene locus_tag LOCUS_24560 5660 4533 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 protein_id gnl|my_center|LOCUS_24560 6281 7210 gene locus_tag LOCUS_24570 6281 7210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_24570 7207 7983 gene locus_tag LOCUS_24580 7207 7983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_24580 10100 7980 gene locus_tag LOCUS_24590 gene pdsS 10100 7980 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_24590 10807 10097 gene locus_tag LOCUS_24600 gene pdsR 10807 10097 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_24600 11455 10877 gene locus_tag LOCUS_24610 11455 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 12091 13458 gene locus_tag LOCUS_24620 12091 13458 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_24620 13657 15747 gene locus_tag LOCUS_24630 13657 15747 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 protein_id gnl|my_center|LOCUS_24630 16251 16499 gene locus_tag LOCUS_24640 16251 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 17437 16523 gene locus_tag LOCUS_24650 17437 16523 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029299489.1 protein_id gnl|my_center|LOCUS_24650 18157 18906 gene locus_tag LOCUS_24660 18157 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 19256 21499 gene locus_tag LOCUS_24670 19256 21499 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_24670 21496 22152 gene locus_tag LOCUS_24680 21496 22152 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_24680 22633 22355 gene locus_tag LOCUS_24690 22633 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 23766 22735 gene locus_tag LOCUS_24700 gene moaA 23766 22735 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_24700 24073 24612 gene locus_tag LOCUS_24710 24073 24612 CDS product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812677.1 protein_id gnl|my_center|LOCUS_24710 24605 25234 gene locus_tag LOCUS_24720 24605 25234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 25227 26849 gene locus_tag LOCUS_24730 25227 26849 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933836.1 protein_id gnl|my_center|LOCUS_24730 26944 27609 gene locus_tag LOCUS_24740 26944 27609 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261957.1 protein_id gnl|my_center|LOCUS_24740 27648 27869 gene locus_tag LOCUS_24750 27648 27869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 27901 30795 gene locus_tag LOCUS_24760 27901 30795 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 protein_id gnl|my_center|LOCUS_24760 30812 31441 gene locus_tag LOCUS_24770 gene fdh3B 30812 31441 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 protein_id gnl|my_center|LOCUS_24770 31776 32903 gene locus_tag LOCUS_24780 31776 32903 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 protein_id gnl|my_center|LOCUS_24780 32900 33541 gene locus_tag LOCUS_24790 32900 33541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 33556 34851 gene locus_tag LOCUS_24800 33556 34851 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_24800 37152 35077 gene locus_tag LOCUS_24810 37152 35077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 37583 38308 gene locus_tag LOCUS_24820 37583 38308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 40106 38811 gene locus_tag LOCUS_24830 40106 38811 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_24830 40781 40119 gene locus_tag LOCUS_24840 40781 40119 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818147.1 protein_id gnl|my_center|LOCUS_24840 41862 40921 gene locus_tag LOCUS_24850 41862 40921 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_24850 42396 41902 gene locus_tag LOCUS_24860 gene napC 42396 41902 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_24860 44704 42869 gene locus_tag LOCUS_24870 44704 42869 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_24870 45714 44707 gene locus_tag LOCUS_24880 45714 44707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 46649 45819 gene locus_tag LOCUS_24890 gene nirQ 46649 45819 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_24890 46951 46676 gene locus_tag LOCUS_24900 46951 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 47569 46961 gene locus_tag LOCUS_24910 47569 46961 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence062 1127 462 gene locus_tag LOCUS_24920 1127 462 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_24920 1335 2714 gene locus_tag LOCUS_24930 gene cpsG 1335 2714 CDS product phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 protein_id gnl|my_center|LOCUS_24930 3493 2888 gene locus_tag LOCUS_24940 3493 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 3972 4835 gene locus_tag LOCUS_24950 3972 4835 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_24950 4935 7286 gene locus_tag LOCUS_24960 gene hypF 4935 7286 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 protein_id gnl|my_center|LOCUS_24960 7744 7307 gene locus_tag LOCUS_24970 7744 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 8006 8653 gene locus_tag LOCUS_24980 8006 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 8770 9192 gene locus_tag LOCUS_24990 8770 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 9321 11069 gene locus_tag LOCUS_25000 9321 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 12728 11334 gene locus_tag LOCUS_25010 12728 11334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_25010 13456 12725 gene locus_tag LOCUS_25020 13456 12725 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252794.1 protein_id gnl|my_center|LOCUS_25020 13640 14155 gene locus_tag LOCUS_25030 13640 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 16160 14208 gene locus_tag LOCUS_25040 16160 14208 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_25040 16343 16708 gene locus_tag LOCUS_25050 16343 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 17762 16683 gene locus_tag LOCUS_25060 gene hppD 17762 16683 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_25060 18775 18134 gene locus_tag LOCUS_25070 gene maiA 18775 18134 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_25070 19788 18772 gene locus_tag LOCUS_25080 19788 18772 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454824.1 protein_id gnl|my_center|LOCUS_25080 20729 20193 gene locus_tag LOCUS_25090 20729 20193 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_25090 21167 20946 gene locus_tag LOCUS_25100 21167 20946 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186154.1 protein_id gnl|my_center|LOCUS_25100 22854 21181 gene locus_tag LOCUS_25110 22854 21181 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_25110 23875 22919 gene locus_tag LOCUS_25120 23875 22919 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_25120 24800 24309 gene locus_tag LOCUS_25130 24800 24309 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_25130 25266 26456 gene locus_tag LOCUS_25140 gene dinB 25266 26456 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_25140 28908 26737 gene locus_tag LOCUS_25150 28908 26737 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_25150 29223 30344 gene locus_tag LOCUS_25160 29223 30344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 30732 30523 gene locus_tag LOCUS_25170 30732 30523 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_25170 32072 31122 gene locus_tag LOCUS_25180 32072 31122 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_25180 32301 33176 gene locus_tag LOCUS_25190 32301 33176 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_25190 33246 38162 gene locus_tag LOCUS_25200 33246 38162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 38349 38849 gene locus_tag LOCUS_25210 gene tpx 38349 38849 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195100.1 protein_id gnl|my_center|LOCUS_25210 38979 40277 gene locus_tag LOCUS_25220 gene rsxC 38979 40277 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082948.1 protein_id gnl|my_center|LOCUS_25220 40582 41652 gene locus_tag LOCUS_25230 40582 41652 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_25230 41649 42338 gene locus_tag LOCUS_25240 41649 42338 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940060.1 protein_id gnl|my_center|LOCUS_25240 42349 43011 gene locus_tag LOCUS_25250 42349 43011 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_25250 43001 43591 gene locus_tag LOCUS_25260 gene rsxA 43001 43591 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_25260 43795 44649 gene locus_tag LOCUS_25270 43795 44649 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142292.1 protein_id gnl|my_center|LOCUS_25270 44857 46302 gene locus_tag LOCUS_25280 gene rhlE 44857 46302 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence063 199 1566 gene locus_tag LOCUS_25290 199 1566 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_25290 2889 1669 gene locus_tag LOCUS_25300 gene ispG 2889 1669 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_25300 3154 2894 gene locus_tag LOCUS_25310 3154 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4289 3168 gene locus_tag LOCUS_25320 4289 3168 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_25320 6444 4807 gene locus_tag LOCUS_25330 6444 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 7693 6914 gene locus_tag LOCUS_25340 7693 6914 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_25340 9447 7993 gene locus_tag LOCUS_25350 gene lpdA 9447 7993 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957594.1 protein_id gnl|my_center|LOCUS_25350 11142 9769 gene locus_tag LOCUS_25360 gene aceF 11142 9769 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 protein_id gnl|my_center|LOCUS_25360 13852 11204 gene locus_tag LOCUS_25370 gene aceE 13852 11204 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444499.1 protein_id gnl|my_center|LOCUS_25370 14928 14359 gene locus_tag LOCUS_25380 14928 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 15430 15086 gene locus_tag LOCUS_25390 15430 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 16523 15801 gene locus_tag LOCUS_25400 16523 15801 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_25400 17537 16641 gene locus_tag LOCUS_25410 17537 16641 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970375.1 protein_id gnl|my_center|LOCUS_25410 18068 18730 gene locus_tag LOCUS_25420 gene rnt 18068 18730 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_25420 19213 18896 gene locus_tag LOCUS_25430 gene grxD 19213 18896 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_25430 19783 19334 gene locus_tag LOCUS_25440 19783 19334 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_25440 21847 20066 gene locus_tag LOCUS_25450 21847 20066 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_25450 22074 22652 gene locus_tag LOCUS_25460 gene sodB 22074 22652 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366881.1 protein_id gnl|my_center|LOCUS_25460 22792 23244 gene locus_tag LOCUS_25470 22792 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 24432 23605 gene locus_tag LOCUS_25480 gene rsmI 24432 23605 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_25480 24480 26510 gene locus_tag LOCUS_25490 24480 26510 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_25490 26515 26916 gene locus_tag LOCUS_25500 26515 26916 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479720.1 protein_id gnl|my_center|LOCUS_25500 26917 27504 gene locus_tag LOCUS_25510 26917 27504 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_25510 27698 28279 gene locus_tag LOCUS_25520 gene dolP 27698 28279 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 protein_id gnl|my_center|LOCUS_25520 28266 29702 gene locus_tag LOCUS_25530 28266 29702 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_25530 29699 30346 gene locus_tag LOCUS_25540 29699 30346 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_25540 30557 32005 gene locus_tag LOCUS_25550 gene nhaD 30557 32005 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_25550 32332 33783 gene locus_tag LOCUS_25560 gene nhaD 32332 33783 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_25560 36275 34296 gene locus_tag LOCUS_25570 36275 34296 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_25570 36869 37762 gene locus_tag LOCUS_25580 36869 37762 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_25580 39551 38157 gene locus_tag LOCUS_25590 39551 38157 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244153.1 protein_id gnl|my_center|LOCUS_25590 41700 39841 gene locus_tag LOCUS_25600 gene dxs 41700 39841 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816906.1 protein_id gnl|my_center|LOCUS_25600 42827 42024 gene locus_tag LOCUS_25610 42827 42024 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_25610 43113 44498 gene locus_tag LOCUS_25620 43113 44498 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence064 806 1261 gene locus_tag LOCUS_25630 gene mraZ 806 1261 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213343.1 protein_id gnl|my_center|LOCUS_25630 1264 2199 gene locus_tag LOCUS_25640 gene rsmH 1264 2199 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 protein_id gnl|my_center|LOCUS_25640 2196 2468 gene locus_tag LOCUS_25650 gene ftsL 2196 2468 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_25650 2470 4233 gene locus_tag LOCUS_25660 2470 4233 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_25660 4233 5756 gene locus_tag LOCUS_25670 4233 5756 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769454.1 protein_id gnl|my_center|LOCUS_25670 5756 7129 gene locus_tag LOCUS_25680 5756 7129 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_25680 7131 8213 gene locus_tag LOCUS_25690 gene mraY 7131 8213 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_25690 8245 9597 gene locus_tag LOCUS_25700 gene murD 8245 9597 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_25700 9594 10775 gene locus_tag LOCUS_25710 gene ftsW 9594 10775 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 protein_id gnl|my_center|LOCUS_25710 10775 11839 gene locus_tag LOCUS_25720 gene murG 10775 11839 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_25720 11836 13281 gene locus_tag LOCUS_25730 gene murC 11836 13281 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_25730 13278 13439 gene locus_tag LOCUS_25740 13278 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 13439 14344 gene locus_tag LOCUS_25750 gene murB 13439 14344 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_25750 14341 15264 gene locus_tag LOCUS_25760 14341 15264 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_25760 15264 16004 gene locus_tag LOCUS_25770 15264 16004 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_25770 16138 17373 gene locus_tag LOCUS_25780 gene ftsA 16138 17373 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_25780 17442 18611 gene locus_tag LOCUS_25790 gene ftsZ 17442 18611 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766576.1 protein_id gnl|my_center|LOCUS_25790 18985 19845 gene locus_tag LOCUS_25800 gene lpxC 18985 19845 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_25800 20664 20218 gene locus_tag LOCUS_25810 20664 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 20737 21669 gene locus_tag LOCUS_25820 20737 21669 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_25820 22157 24967 gene locus_tag LOCUS_25830 gene secA 22157 24967 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262629.1 protein_id gnl|my_center|LOCUS_25830 25044 25226 gene locus_tag LOCUS_25840 25044 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 25349 26557 gene locus_tag LOCUS_25850 gene argJ 25349 26557 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_25850 26676 26897 gene locus_tag LOCUS_25860 26676 26897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 26927 27874 gene locus_tag LOCUS_25870 26927 27874 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_25870 28031 28264 gene locus_tag LOCUS_25880 28031 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 28251 28514 gene locus_tag LOCUS_25890 28251 28514 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_25890 29010 28813 gene locus_tag LOCUS_25900 29010 28813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 29795 29016 gene locus_tag LOCUS_25910 gene zapD 29795 29016 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957406.1 protein_id gnl|my_center|LOCUS_25910 30478 29885 gene locus_tag LOCUS_25920 gene coaE 30478 29885 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_25920 31204 30965 gene locus_tag LOCUS_25930 31204 30965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 32209 31331 gene locus_tag LOCUS_25940 32209 31331 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_25940 33483 32242 gene locus_tag LOCUS_25950 33483 32242 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_25950 35138 33489 gene locus_tag LOCUS_25960 gene pilB 35138 33489 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103350.1 protein_id gnl|my_center|LOCUS_25960 36251 35718 gene locus_tag LOCUS_25970 36251 35718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 37929 37489 gene locus_tag LOCUS_25980 37929 37489 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_25980 38742 38356 gene locus_tag LOCUS_25990 38742 38356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 39049 38735 gene locus_tag LOCUS_26000 39049 38735 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_26000 39389 39667 gene locus_tag LOCUS_26010 39389 39667 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928947.1 protein_id gnl|my_center|LOCUS_26010 39673 40170 gene locus_tag LOCUS_26020 39673 40170 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_26020 40489 40310 gene locus_tag LOCUS_26030 40489 40310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 42115 40721 gene locus_tag LOCUS_26040 42115 40721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 42506 42916 gene locus_tag LOCUS_26050 42506 42916 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_26050 43174 43455 gene locus_tag LOCUS_26060 43174 43455 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_26060 43467 43769 gene locus_tag LOCUS_26070 43467 43769 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence065 92 1339 gene locus_tag LOCUS_26080 92 1339 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809346.1 protein_id gnl|my_center|LOCUS_26080 1705 2187 gene locus_tag LOCUS_26090 gene tadA 1705 2187 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706618.1 protein_id gnl|my_center|LOCUS_26090 3968 2580 gene locus_tag LOCUS_26100 gene mltF 3968 2580 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_26100 4407 4496 gene locus_tag LOCUS_t00320 4407 4496 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4679 4969 gene locus_tag LOCUS_26110 4679 4969 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_26110 4962 5309 gene locus_tag LOCUS_26120 4962 5309 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_26120 5333 6775 gene locus_tag LOCUS_26130 5333 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 6765 7421 gene locus_tag LOCUS_26140 6765 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 7411 11049 gene locus_tag LOCUS_26150 7411 11049 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_26150 11116 12267 gene locus_tag LOCUS_26160 11116 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 12656 12339 gene locus_tag LOCUS_26170 12656 12339 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551036.1 protein_id gnl|my_center|LOCUS_26170 12993 13703 gene locus_tag LOCUS_26180 gene tsaA 12993 13703 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 protein_id gnl|my_center|LOCUS_26180 14795 13938 gene locus_tag LOCUS_26190 14795 13938 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_26190 14864 15103 gene locus_tag LOCUS_26200 14864 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 15181 15606 gene locus_tag LOCUS_26210 gene trxC 15181 15606 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_26210 15794 16912 gene locus_tag LOCUS_26220 gene carA 15794 16912 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_26220 16968 20174 gene locus_tag LOCUS_26230 gene carB 16968 20174 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 protein_id gnl|my_center|LOCUS_26230 20226 20702 gene locus_tag LOCUS_26240 gene greA 20226 20702 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 protein_id gnl|my_center|LOCUS_26240 21216 20917 gene locus_tag LOCUS_26250 gene yhbY 21216 20917 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_26250 21372 21992 gene locus_tag LOCUS_26260 gene rlmE 21372 21992 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313635.1 protein_id gnl|my_center|LOCUS_26260 22131 24068 gene locus_tag LOCUS_26270 gene ftsH 22131 24068 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_26270 24151 24933 gene locus_tag LOCUS_26280 gene folP 24151 24933 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707079.1 protein_id gnl|my_center|LOCUS_26280 25088 26389 gene locus_tag LOCUS_26290 gene glmM 25088 26389 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_26290 26718 27470 gene locus_tag LOCUS_26300 gene tpiA 26718 27470 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 protein_id gnl|my_center|LOCUS_26300 27917 28330 gene locus_tag LOCUS_26310 gene secG 27917 28330 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_26310 28361 28445 gene locus_tag LOCUS_t00330 28361 28445 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28642 28998 gene locus_tag LOCUS_26320 28642 28998 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_26320 28989 29471 gene locus_tag LOCUS_26330 28989 29471 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_26330 29484 30203 gene locus_tag LOCUS_26340 29484 30203 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_26340 30196 31449 gene locus_tag LOCUS_26350 30196 31449 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_26350 31449 31979 gene locus_tag LOCUS_26360 gene nuoE 31449 31979 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_26360 31985 33253 gene locus_tag LOCUS_26370 gene nuoF 31985 33253 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522413.1 protein_id gnl|my_center|LOCUS_26370 33308 35614 gene locus_tag LOCUS_26380 gene nuoG 33308 35614 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_26380 35618 36670 gene locus_tag LOCUS_26390 gene nuoH 35618 36670 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_26390 36684 37175 gene locus_tag LOCUS_26400 gene nuoI 36684 37175 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_26400 37210 37809 gene locus_tag LOCUS_26410 37210 37809 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_26410 37821 38126 gene locus_tag LOCUS_26420 gene nuoK 37821 38126 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_26420 38129 40117 gene locus_tag LOCUS_26430 gene nuoL 38129 40117 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_26430 40137 41654 gene locus_tag LOCUS_26440 40137 41654 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_26440 41686 43122 gene locus_tag LOCUS_26450 gene nuoN 41686 43122 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186468.1 protein_id gnl|my_center|LOCUS_26450 43471 43547 gene locus_tag LOCUS_t00340 43471 43547 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 564 10 gene locus_tag LOCUS_26460 564 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 992 639 gene locus_tag LOCUS_26470 992 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 1210 1563 gene locus_tag LOCUS_26480 1210 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2423 1734 gene locus_tag LOCUS_26490 2423 1734 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707792.1 protein_id gnl|my_center|LOCUS_26490 3000 2509 gene locus_tag LOCUS_26500 3000 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3938 3117 gene locus_tag LOCUS_26510 3938 3117 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_26510 7410 4288 gene locus_tag LOCUS_26520 7410 4288 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_26520 8759 7407 gene locus_tag LOCUS_26530 8759 7407 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015670.1 protein_id gnl|my_center|LOCUS_26530 9111 9518 gene locus_tag LOCUS_26540 gene merR 9111 9518 CDS product Hg(II)-responsive transcriptional regulator MerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425271.1 protein_id gnl|my_center|LOCUS_26540 12123 9844 gene locus_tag LOCUS_26550 gene topA 12123 9844 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948299.1 protein_id gnl|my_center|LOCUS_26550 12882 12406 gene locus_tag LOCUS_26560 12882 12406 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_26560 14160 12973 gene locus_tag LOCUS_26570 gene dprA 14160 12973 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_26570 15416 14379 gene locus_tag LOCUS_26580 15416 14379 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_26580 15549 16076 gene locus_tag LOCUS_26590 gene def 15549 16076 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 protein_id gnl|my_center|LOCUS_26590 16165 17103 gene locus_tag LOCUS_26600 gene fmt 16165 17103 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 protein_id gnl|my_center|LOCUS_26600 17128 18432 gene locus_tag LOCUS_26610 gene rsmB 17128 18432 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_26610 18439 19035 gene locus_tag LOCUS_26620 18439 19035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 19017 21248 gene locus_tag LOCUS_26630 19017 21248 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_26630 21245 22618 gene locus_tag LOCUS_26640 21245 22618 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_26640 22746 24077 gene locus_tag LOCUS_26650 gene trkA 22746 24077 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_26650 24145 25596 gene locus_tag LOCUS_26660 24145 25596 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 protein_id gnl|my_center|LOCUS_26660 25605 27134 gene locus_tag LOCUS_26670 gene glcD 25605 27134 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_26670 27136 28218 gene locus_tag LOCUS_26680 gene glcE 27136 28218 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_26680 28218 29435 gene locus_tag LOCUS_26690 gene glcF 28218 29435 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194805.1 protein_id gnl|my_center|LOCUS_26690 29503 29700 gene locus_tag LOCUS_26700 29503 29700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 30119 29721 gene locus_tag LOCUS_26710 30119 29721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 30658 30125 gene locus_tag LOCUS_26720 30658 30125 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 protein_id gnl|my_center|LOCUS_26720 32329 30950 gene locus_tag LOCUS_26730 32329 30950 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_26730 32758 32366 gene locus_tag LOCUS_26740 32758 32366 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_26740 33372 32755 gene locus_tag LOCUS_26750 33372 32755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 33693 34160 gene locus_tag LOCUS_26760 gene aprB 33693 34160 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_26760 34217 36214 gene locus_tag LOCUS_26770 gene aprA 34217 36214 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_26770 36550 37440 gene locus_tag LOCUS_26780 36550 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 38330 38659 gene locus_tag LOCUS_26790 38330 38659 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_26790 38844 39212 gene locus_tag LOCUS_26800 38844 39212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 39695 39294 gene locus_tag LOCUS_26810 39695 39294 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389345.1 protein_id gnl|my_center|LOCUS_26810 40046 40492 gene locus_tag LOCUS_26820 40046 40492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 40823 41323 gene locus_tag LOCUS_26830 40823 41323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence067 555 4 gene locus_tag LOCUS_26840 555 4 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_26840 734 928 gene locus_tag LOCUS_26850 734 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1403 1747 gene locus_tag LOCUS_26860 1403 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1753 3072 gene locus_tag LOCUS_26870 gene rimO 1753 3072 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_26870 3662 3456 gene locus_tag LOCUS_26880 3662 3456 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_26880 3767 5497 gene locus_tag LOCUS_26890 3767 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6041 5526 gene locus_tag LOCUS_26900 6041 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 6413 6054 gene locus_tag LOCUS_26910 6413 6054 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_26910 7375 6407 gene locus_tag LOCUS_26920 gene dusA 7375 6407 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_26920 8014 7715 gene locus_tag LOCUS_26930 8014 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8390 8112 gene locus_tag LOCUS_26940 8390 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 9000 12020 gene locus_tag LOCUS_26950 9000 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 12406 12038 gene locus_tag LOCUS_26960 12406 12038 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_26960 13848 12556 gene locus_tag LOCUS_26970 13848 12556 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_26970 14526 15314 gene locus_tag LOCUS_26980 14526 15314 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100934544.1 protein_id gnl|my_center|LOCUS_26980 15311 16432 gene locus_tag LOCUS_26990 15311 16432 CDS product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_26990 16458 17942 gene locus_tag LOCUS_27000 16458 17942 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_27000 18579 19301 gene locus_tag LOCUS_27010 18579 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 19387 19977 gene locus_tag LOCUS_27020 gene napC 19387 19977 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_27020 20011 21333 gene locus_tag LOCUS_27030 20011 21333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 24724 22463 gene locus_tag LOCUS_27040 24724 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 25567 24770 gene locus_tag LOCUS_27050 25567 24770 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327924.1 protein_id gnl|my_center|LOCUS_27050 26650 25682 gene locus_tag LOCUS_27060 26650 25682 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 protein_id gnl|my_center|LOCUS_27060 27456 26761 gene locus_tag LOCUS_27070 gene urtE 27456 26761 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 protein_id gnl|my_center|LOCUS_27070 28198 27449 gene locus_tag LOCUS_27080 gene urtD 28198 27449 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 protein_id gnl|my_center|LOCUS_27080 29304 28198 gene locus_tag LOCUS_27090 gene urtC 29304 28198 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 protein_id gnl|my_center|LOCUS_27090 30183 29314 gene locus_tag LOCUS_27100 gene urtB 30183 29314 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215689.1 protein_id gnl|my_center|LOCUS_27100 31494 30307 gene locus_tag LOCUS_27110 31494 30307 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 protein_id gnl|my_center|LOCUS_27110 32351 31743 gene locus_tag LOCUS_27120 32351 31743 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313570.1 protein_id gnl|my_center|LOCUS_27120 33505 32351 gene locus_tag LOCUS_27130 33505 32351 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 protein_id gnl|my_center|LOCUS_27130 34562 33987 gene locus_tag LOCUS_27140 34562 33987 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_27140 34985 34584 gene locus_tag LOCUS_27150 34985 34584 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074112.1 protein_id gnl|my_center|LOCUS_27150 35587 35006 gene locus_tag LOCUS_27160 35587 35006 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388998.1 protein_id gnl|my_center|LOCUS_27160 36021 35707 gene locus_tag LOCUS_27170 36021 35707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 36841 36047 gene locus_tag LOCUS_27180 36841 36047 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967226.1 protein_id gnl|my_center|LOCUS_27180 37416 36838 gene locus_tag LOCUS_27190 37416 36838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 38646 37426 gene locus_tag LOCUS_27200 38646 37426 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530417.1 protein_id gnl|my_center|LOCUS_27200 38922 40055 gene locus_tag LOCUS_27210 38922 40055 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_27210 40055 41881 gene locus_tag LOCUS_27220 40055 41881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 42859 41894 gene locus_tag LOCUS_27230 42859 41894 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 protein_id gnl|my_center|LOCUS_27230 43889 43116 gene locus_tag LOCUS_27240 43889 43116 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 protein_id gnl|my_center|LOCUS_27240 44183 46981 gene locus_tag LOCUS_27250 44183 46981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 47126 47950 gene locus_tag LOCUS_27260 47126 47950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 49409 48048 gene locus_tag LOCUS_27270 gene mgtE 49409 48048 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_27270 50882 49554 gene locus_tag LOCUS_27280 gene argA 50882 49554 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 protein_id gnl|my_center|LOCUS_27280 51485 51207 gene locus_tag LOCUS_27290 51485 51207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 52032 51541 gene locus_tag LOCUS_27300 52032 51541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 52237 53106 gene locus_tag LOCUS_27310 52237 53106 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_27310 53180 53620 gene locus_tag LOCUS_27320 53180 53620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 55068 53923 gene locus_tag LOCUS_27330 gene argE 55068 53923 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_27330 55824 55246 gene locus_tag LOCUS_27340 55824 55246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_27340 55929 57011 gene locus_tag LOCUS_27350 55929 57011 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_27350 57358 59208 gene locus_tag LOCUS_27360 gene ilvD 57358 59208 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_27360 60353 59685 gene locus_tag LOCUS_27370 60353 59685 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174130.1 protein_id gnl|my_center|LOCUS_27370 60845 62683 gene locus_tag LOCUS_27380 gene typA 60845 62683 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_27380 62960 63397 gene locus_tag LOCUS_27390 gene dtd 62960 63397 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 protein_id gnl|my_center|LOCUS_27390 63769 64359 gene locus_tag LOCUS_27400 gene hisB 63769 64359 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_27400 64387 65028 gene locus_tag LOCUS_27410 gene hisH 64387 65028 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931644.1 protein_id gnl|my_center|LOCUS_27410 65112 65807 gene locus_tag LOCUS_27420 gene hisA 65112 65807 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_27420 65841 66611 gene locus_tag LOCUS_27430 gene hisF 65841 66611 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767116.1 protein_id gnl|my_center|LOCUS_27430 66608 66925 gene locus_tag LOCUS_27440 66608 66925 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_27440 67072 67320 gene locus_tag LOCUS_27450 67072 67320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 67362 67733 gene locus_tag LOCUS_27460 gene tatB 67362 67733 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448907.1 protein_id gnl|my_center|LOCUS_27460 67749 68921 gene locus_tag LOCUS_27470 67749 68921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 69656 69318 gene locus_tag LOCUS_27480 69656 69318 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266665.1 protein_id gnl|my_center|LOCUS_27480 69818 70228 gene locus_tag LOCUS_27490 69818 70228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 73455 70708 gene locus_tag LOCUS_27500 gene fdhF 73455 70708 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_27500 75141 73459 gene locus_tag LOCUS_27510 75141 73459 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_27510 76932 75226 gene locus_tag LOCUS_27520 76932 75226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 78074 77070 gene locus_tag LOCUS_27530 78074 77070 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_27530 81676 78077 gene locus_tag LOCUS_27540 gene nifJ 81676 78077 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_27540 81860 82222 gene locus_tag LOCUS_27550 81860 82222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 82219 82965 gene locus_tag LOCUS_27560 82219 82965 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_27560 86376 83323 gene locus_tag LOCUS_27570 86376 83323 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_27570 86041 85949 gene locus_tag LOCUS_t00350 86041 85949 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 88561 86435 gene locus_tag LOCUS_27580 88561 86435 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166873.1 protein_id gnl|my_center|LOCUS_27580 88775 89227 gene locus_tag LOCUS_27590 88775 89227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 89227 89793 gene locus_tag LOCUS_27600 89227 89793 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_27600 90191 90889 gene locus_tag LOCUS_27610 90191 90889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 90985 91941 gene locus_tag LOCUS_27620 90985 91941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 92047 92370 gene locus_tag LOCUS_27630 92047 92370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 92360 92851 gene locus_tag LOCUS_27640 92360 92851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 92976 93365 gene locus_tag LOCUS_27650 92976 93365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098605.1 protein_id gnl|my_center|LOCUS_27650 93621 94703 gene locus_tag LOCUS_27660 93621 94703 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182199.1 protein_id gnl|my_center|LOCUS_27660 94708 95214 gene locus_tag LOCUS_27670 94708 95214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 95617 95384 gene locus_tag LOCUS_27680 95617 95384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 96455 95700 gene locus_tag LOCUS_27690 gene istB 96455 95700 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_27690 97949 96474 gene locus_tag LOCUS_27700 gene istA 97949 96474 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_27700 98741 98373 gene locus_tag LOCUS_27710 98741 98373 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010015189.1 protein_id gnl|my_center|LOCUS_27710 98935 98738 gene locus_tag LOCUS_27720 98935 98738 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_27720 99288 99212 gene locus_tag LOCUS_t00360 99288 99212 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 101168 99303 gene locus_tag LOCUS_27730 gene rpoD 101168 99303 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_27730 103079 101304 gene locus_tag LOCUS_27740 gene dnaG 103079 101304 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817223.1 protein_id gnl|my_center|LOCUS_27740 103617 103201 gene locus_tag LOCUS_27750 103617 103201 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_27750 103886 103671 gene locus_tag LOCUS_27760 gene rpsU 103886 103671 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_27760 104166 105206 gene locus_tag LOCUS_27770 gene tsaD 104166 105206 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704779.1 protein_id gnl|my_center|LOCUS_27770 105825 105217 gene locus_tag LOCUS_27780 gene plsY 105825 105217 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217581.1 protein_id gnl|my_center|LOCUS_27780 106074 106451 gene locus_tag LOCUS_27790 gene folB 106074 106451 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_27790 106453 106959 gene locus_tag LOCUS_27800 gene folK 106453 106959 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_27800 107709 106966 gene locus_tag LOCUS_27810 107709 106966 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_27810 107994 109202 gene locus_tag LOCUS_27820 107994 109202 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_27820 109189 109899 gene locus_tag LOCUS_27830 109189 109899 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814000.1 protein_id gnl|my_center|LOCUS_27830 109993 110244 gene locus_tag LOCUS_27840 109993 110244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 110365 111291 gene locus_tag LOCUS_27850 110365 111291 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 protein_id gnl|my_center|LOCUS_27850 111435 112124 gene locus_tag LOCUS_27860 111435 112124 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_27860 112331 113494 gene locus_tag LOCUS_27870 112331 113494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 114507 113773 gene locus_tag LOCUS_27880 114507 113773 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_27880 114808 115374 gene locus_tag LOCUS_27890 114808 115374 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_27890 115771 115544 gene locus_tag LOCUS_27900 115771 115544 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462097.1 protein_id gnl|my_center|LOCUS_27900 117153 115789 gene locus_tag LOCUS_27910 117153 115789 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_27910 117345 118529 gene locus_tag LOCUS_27920 117345 118529 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205908.1 protein_id gnl|my_center|LOCUS_27920 118759 121107 gene locus_tag LOCUS_27930 118759 121107 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_27930 123050 121419 gene locus_tag LOCUS_27940 123050 121419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 124287 123055 gene locus_tag LOCUS_27950 124287 123055 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707495.1 protein_id gnl|my_center|LOCUS_27950 124351 125397 gene locus_tag LOCUS_27960 124351 125397 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_27960 125916 125404 gene locus_tag LOCUS_27970 125916 125404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 126060 126509 gene locus_tag LOCUS_27980 126060 126509 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_27980 126542 128986 gene locus_tag LOCUS_27990 126542 128986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 131144 129141 gene locus_tag LOCUS_28000 gene slt 131144 129141 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_28000 131288 132121 gene locus_tag LOCUS_28010 131288 132121 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 protein_id gnl|my_center|LOCUS_28010 132379 132822 gene locus_tag LOCUS_28020 132379 132822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 133960 132902 gene locus_tag LOCUS_28030 gene aroG 133960 132902 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 protein_id gnl|my_center|LOCUS_28030 134097 134771 gene locus_tag LOCUS_28040 134097 134771 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_28040 134942 135121 gene locus_tag LOCUS_28050 134942 135121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 135137 136291 gene locus_tag LOCUS_28060 135137 136291 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_28060 136288 136890 gene locus_tag LOCUS_28070 136288 136890 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_28070 137440 136910 gene locus_tag LOCUS_28080 137440 136910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 137855 137505 gene locus_tag LOCUS_28090 137855 137505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 138108 139634 gene locus_tag LOCUS_28100 gene qseE 138108 139634 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309666.1 protein_id gnl|my_center|LOCUS_28100 139631 140176 gene locus_tag LOCUS_28110 139631 140176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 140163 141557 gene locus_tag LOCUS_28120 gene glrR 140163 141557 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017348.1 protein_id gnl|my_center|LOCUS_28120 142080 142325 gene locus_tag LOCUS_28130 142080 142325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence068 1332 55 gene locus_tag LOCUS_28140 1332 55 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_28140 1709 1371 gene locus_tag LOCUS_28150 gene glnK 1709 1371 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_28150 2189 2446 gene locus_tag LOCUS_28160 2189 2446 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_28160 2503 4014 gene locus_tag LOCUS_28170 2503 4014 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_28170 4121 4576 gene locus_tag LOCUS_28180 4121 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 4792 6711 gene locus_tag LOCUS_28190 4792 6711 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_28190 6832 7191 gene locus_tag LOCUS_28200 6832 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 7263 8090 gene locus_tag LOCUS_28210 7263 8090 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388937.1 protein_id gnl|my_center|LOCUS_28210 8340 8606 gene locus_tag LOCUS_28220 8340 8606 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_28220 11918 8856 gene locus_tag LOCUS_28230 11918 8856 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_28230 13018 11915 gene locus_tag LOCUS_28240 13018 11915 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_28240 13737 13015 gene locus_tag LOCUS_28250 13737 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 13927 14568 gene locus_tag LOCUS_28260 13927 14568 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119576.1 protein_id gnl|my_center|LOCUS_28260 15609 14809 gene locus_tag LOCUS_28270 15609 14809 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_28270 15812 16927 gene locus_tag LOCUS_28280 15812 16927 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_28280 17135 17401 gene locus_tag LOCUS_28290 17135 17401 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_28290 17432 17716 gene locus_tag LOCUS_28300 17432 17716 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_28300 17720 18931 gene locus_tag LOCUS_28310 gene serB 17720 18931 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010528670.1 protein_id gnl|my_center|LOCUS_28310 18968 19414 gene locus_tag LOCUS_28320 18968 19414 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 protein_id gnl|my_center|LOCUS_28320 20431 19631 gene locus_tag LOCUS_28330 gene djlA 20431 19631 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_28330 24065 20553 gene locus_tag LOCUS_28340 24065 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 24289 24065 gene locus_tag LOCUS_28350 24289 24065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 24593 24799 gene locus_tag LOCUS_28360 24593 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 29692 24911 gene locus_tag LOCUS_28370 29692 24911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 30061 31599 gene locus_tag LOCUS_28380 30061 31599 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_28380 31795 32274 gene locus_tag LOCUS_28390 31795 32274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 32937 32464 gene locus_tag LOCUS_28400 32937 32464 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_28400 34854 33088 gene locus_tag LOCUS_28410 34854 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 35267 36553 gene locus_tag LOCUS_28420 35267 36553 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_28420 36558 38804 gene locus_tag LOCUS_28430 36558 38804 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_28430 38817 39440 gene locus_tag LOCUS_28440 38817 39440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 39523 40356 gene locus_tag LOCUS_28450 39523 40356 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_28450 41060 40470 gene locus_tag LOCUS_28460 gene msrA 41060 40470 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence069 <1 3792 gene locus_tag LOCUS_28470 <1 3792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 5034 6488 gene locus_tag LOCUS_28480 5034 6488 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_28480 7023 9245 gene locus_tag LOCUS_28490 gene relA 7023 9245 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_28490 9540 9968 gene locus_tag LOCUS_28500 gene ndk 9540 9968 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_28500 10243 11319 gene locus_tag LOCUS_28510 10243 11319 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_28510 11321 12118 gene locus_tag LOCUS_28520 gene pilW 11321 12118 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799875.1 protein_id gnl|my_center|LOCUS_28520 12118 13152 gene locus_tag LOCUS_28530 12118 13152 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 protein_id gnl|my_center|LOCUS_28530 13224 14492 gene locus_tag LOCUS_28540 gene hisS 13224 14492 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_28540 14527 15189 gene locus_tag LOCUS_28550 14527 15189 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_28550 15206 16372 gene locus_tag LOCUS_28560 gene bamB 15206 16372 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_28560 16426 17814 gene locus_tag LOCUS_28570 gene der 16426 17814 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_28570 19274 18036 gene locus_tag LOCUS_28580 19274 18036 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_28580 21109 19751 gene locus_tag LOCUS_28590 gene xseA 21109 19751 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_28590 21505 22971 gene locus_tag LOCUS_28600 gene guaB 21505 22971 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_28600 23074 24657 gene locus_tag LOCUS_28610 gene guaA 23074 24657 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_28610 26019 24850 gene locus_tag LOCUS_28620 26019 24850 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_28620 27771 26653 gene locus_tag LOCUS_28630 27771 26653 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391150.1 protein_id gnl|my_center|LOCUS_28630 28673 27807 gene locus_tag LOCUS_28640 gene cysW 28673 27807 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530874.1 protein_id gnl|my_center|LOCUS_28640 29536 28670 gene locus_tag LOCUS_28650 gene cysT 29536 28670 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_28650 30238 29591 gene locus_tag LOCUS_28660 30238 29591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074244.1 protein_id gnl|my_center|LOCUS_28660 30504 30280 gene locus_tag LOCUS_28670 30504 30280 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191306.1 protein_id gnl|my_center|LOCUS_28670 31582 30563 gene locus_tag LOCUS_28680 31582 30563 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928929.1 protein_id gnl|my_center|LOCUS_28680 31985 31779 gene locus_tag LOCUS_28690 31985 31779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 32188 33738 gene locus_tag LOCUS_28700 32188 33738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 33795 35570 gene locus_tag LOCUS_28710 33795 35570 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_28710 37273 36020 gene locus_tag LOCUS_28720 37273 36020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 38302 37280 gene locus_tag LOCUS_28730 38302 37280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 39474 38299 gene locus_tag LOCUS_28740 39474 38299 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence070 779 189 gene locus_tag LOCUS_28750 gene mobA 779 189 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_28750 1645 776 gene locus_tag LOCUS_28760 1645 776 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 protein_id gnl|my_center|LOCUS_28760 2078 2323 gene locus_tag LOCUS_28770 2078 2323 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_28770 2349 4016 gene locus_tag LOCUS_28780 gene ggt 2349 4016 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_28780 4148 4402 gene locus_tag LOCUS_28790 4148 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 5551 4739 gene locus_tag LOCUS_28800 gene mutM 5551 4739 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_28800 6407 5553 gene locus_tag LOCUS_28810 6407 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 7780 6422 gene locus_tag LOCUS_28820 7780 6422 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_28820 8516 7770 gene locus_tag LOCUS_28830 8516 7770 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_28830 9457 8513 gene locus_tag LOCUS_28840 9457 8513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_28840 9885 9718 gene locus_tag LOCUS_28850 9885 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 13036 10085 gene locus_tag LOCUS_28860 13036 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 13267 13758 gene locus_tag LOCUS_28870 13267 13758 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_28870 13777 14289 gene locus_tag LOCUS_28880 13777 14289 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338683.1 protein_id gnl|my_center|LOCUS_28880 14307 14855 gene locus_tag LOCUS_28890 14307 14855 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_28890 15346 15065 gene locus_tag LOCUS_28900 15346 15065 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_28900 16839 15481 gene locus_tag LOCUS_28910 gene mgtE 16839 15481 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_28910 19046 17331 gene locus_tag LOCUS_28920 gene ptsP 19046 17331 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686967.1 protein_id gnl|my_center|LOCUS_28920 19312 19043 gene locus_tag LOCUS_28930 19312 19043 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_28930 20324 19455 gene locus_tag LOCUS_28940 gene rapZ 20324 19455 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_28940 20983 20507 gene locus_tag LOCUS_28950 gene ptsN 20983 20507 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_28950 21334 20999 gene locus_tag LOCUS_28960 gene hpf 21334 20999 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_28960 22789 21359 gene locus_tag LOCUS_28970 22789 21359 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_28970 23702 22977 gene locus_tag LOCUS_28980 gene lptB 23702 22977 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_28980 24224 23709 gene locus_tag LOCUS_28990 gene lptA 24224 23709 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424523.1 protein_id gnl|my_center|LOCUS_28990 24777 24208 gene locus_tag LOCUS_29000 24777 24208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 25365 24832 gene locus_tag LOCUS_29010 gene kdsC 25365 24832 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_29010 26400 25402 gene locus_tag LOCUS_29020 26400 25402 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400250.1 protein_id gnl|my_center|LOCUS_29020 27419 26397 gene locus_tag LOCUS_29030 27419 26397 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_29030 27735 27550 gene locus_tag LOCUS_29040 27735 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 28183 27737 gene locus_tag LOCUS_29050 28183 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 30283 28301 gene locus_tag LOCUS_29060 30283 28301 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_29060 30681 30391 gene locus_tag LOCUS_29070 gene yggU 30681 30391 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707385.1 protein_id gnl|my_center|LOCUS_29070 31278 30700 gene locus_tag LOCUS_29080 31278 30700 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_29080 32114 31278 gene locus_tag LOCUS_29090 gene proC 32114 31278 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_29090 32912 32214 gene locus_tag LOCUS_29100 32912 32214 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_29100 33093 34133 gene locus_tag LOCUS_29110 33093 34133 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_29110 34182 35306 gene locus_tag LOCUS_29120 gene pilU 34182 35306 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence071 149 637 gene locus_tag LOCUS_29130 149 637 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705745.1 protein_id gnl|my_center|LOCUS_29130 669 2183 gene locus_tag LOCUS_29140 gene purF 669 2183 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_29140 3008 2559 gene locus_tag LOCUS_29150 3008 2559 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_29150 3456 2995 gene locus_tag LOCUS_29160 3456 2995 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072666.1 protein_id gnl|my_center|LOCUS_29160 4094 3483 gene locus_tag LOCUS_29170 4094 3483 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018313.1 protein_id gnl|my_center|LOCUS_29170 4546 4175 gene locus_tag LOCUS_29180 4546 4175 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_29180 4756 5964 gene locus_tag LOCUS_29190 gene alaC 4756 5964 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 protein_id gnl|my_center|LOCUS_29190 6027 7340 gene locus_tag LOCUS_29200 6027 7340 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_29200 7706 8698 gene locus_tag LOCUS_29210 7706 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_29210 8747 9220 gene locus_tag LOCUS_29220 8747 9220 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_29220 9342 9193 gene locus_tag LOCUS_29230 9342 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 10086 9511 gene locus_tag LOCUS_29240 10086 9511 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_29240 11928 10234 gene locus_tag LOCUS_29250 11928 10234 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337736.1 protein_id gnl|my_center|LOCUS_29250 14230 12089 gene locus_tag LOCUS_29260 14230 12089 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482598.1 protein_id gnl|my_center|LOCUS_29260 16116 14332 gene locus_tag LOCUS_29270 16116 14332 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_29270 16785 16279 gene locus_tag LOCUS_29280 16785 16279 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268598.1 protein_id gnl|my_center|LOCUS_29280 18075 17419 gene locus_tag LOCUS_29290 18075 17419 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_29290 19486 18068 gene locus_tag LOCUS_29300 19486 18068 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939070.1 protein_id gnl|my_center|LOCUS_29300 20237 19470 gene locus_tag LOCUS_29310 20237 19470 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_29310 21534 20794 gene locus_tag LOCUS_29320 gene pdhR 21534 20794 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_29320 21890 22975 gene locus_tag LOCUS_29330 21890 22975 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 protein_id gnl|my_center|LOCUS_29330 23197 23835 gene locus_tag LOCUS_29340 23197 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 23839 25227 gene locus_tag LOCUS_29350 23839 25227 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_29350 25350 28178 gene locus_tag LOCUS_29360 25350 28178 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_29360 28271 29257 gene locus_tag LOCUS_29370 28271 29257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560783.1 protein_id gnl|my_center|LOCUS_29370 29339 30013 gene locus_tag LOCUS_29380 29339 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 30165 32051 gene locus_tag LOCUS_29390 30165 32051 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383592.1 protein_id gnl|my_center|LOCUS_29390 32796 33770 gene locus_tag LOCUS_29400 32796 33770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 34095 34616 gene locus_tag LOCUS_29410 34095 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 34744 35151 gene locus_tag LOCUS_29420 34744 35151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence072 383 1465 gene locus_tag LOCUS_29430 383 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1453 2322 gene locus_tag LOCUS_29440 1453 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2879 2658 gene locus_tag LOCUS_29450 2879 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3037 3954 gene locus_tag LOCUS_29460 3037 3954 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195802.1 protein_id gnl|my_center|LOCUS_29460 5364 4255 gene locus_tag LOCUS_29470 5364 4255 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_29470 6483 5776 gene locus_tag LOCUS_29480 gene fabG 6483 5776 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_29480 7408 6494 gene locus_tag LOCUS_29490 7408 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 7903 7661 gene locus_tag LOCUS_29500 7903 7661 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_29500 8772 7930 gene locus_tag LOCUS_29510 8772 7930 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943157.1 protein_id gnl|my_center|LOCUS_29510 10094 8775 gene locus_tag LOCUS_29520 10094 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 11400 10108 gene locus_tag LOCUS_29530 gene hadB 11400 10108 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986696.1 protein_id gnl|my_center|LOCUS_29530 12568 11408 gene locus_tag LOCUS_29540 gene hadC 12568 11408 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_29540 13341 12571 gene locus_tag LOCUS_29550 13341 12571 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_29550 14481 13345 gene locus_tag LOCUS_29560 14481 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 15568 14495 gene locus_tag LOCUS_29570 gene adhP 15568 14495 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_29570 15777 17540 gene locus_tag LOCUS_29580 15777 17540 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_29580 17540 18379 gene locus_tag LOCUS_29590 17540 18379 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_29590 18376 18894 gene locus_tag LOCUS_29600 18376 18894 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 protein_id gnl|my_center|LOCUS_29600 18942 19190 gene locus_tag LOCUS_29610 18942 19190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 19623 20027 gene locus_tag LOCUS_29620 19623 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 20040 22778 gene locus_tag LOCUS_29630 20040 22778 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_29630 22775 23428 gene locus_tag LOCUS_29640 22775 23428 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_29640 23425 24312 gene locus_tag LOCUS_29650 23425 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 24309 24908 gene locus_tag LOCUS_29660 24309 24908 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_29660 24905 25198 gene locus_tag LOCUS_29670 24905 25198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 25198 26436 gene locus_tag LOCUS_29680 25198 26436 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393422.1 protein_id gnl|my_center|LOCUS_29680 26447 27700 gene locus_tag LOCUS_29690 26447 27700 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_29690 27716 29047 gene locus_tag LOCUS_29700 27716 29047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 29230 30540 gene locus_tag LOCUS_29710 29230 30540 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389729.1 protein_id gnl|my_center|LOCUS_29710 30638 30850 gene locus_tag LOCUS_29720 30638 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 31205 33529 gene locus_tag LOCUS_29730 31205 33529 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_29730 33784 34677 gene locus_tag LOCUS_29740 33784 34677 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence073 3652 371 gene locus_tag LOCUS_29750 3652 371 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_29750 4270 3671 gene locus_tag LOCUS_29760 4270 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 5840 4455 gene locus_tag LOCUS_29770 5840 4455 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_29770 8275 5840 gene locus_tag LOCUS_29780 8275 5840 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 protein_id gnl|my_center|LOCUS_29780 8533 8327 gene locus_tag LOCUS_29790 8533 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 9909 8530 gene locus_tag LOCUS_29800 9909 8530 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_29800 11221 10151 gene locus_tag LOCUS_29810 11221 10151 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_29810 11760 11434 gene locus_tag LOCUS_29820 11760 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 12213 14201 gene locus_tag LOCUS_29830 12213 14201 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_29830 15403 14789 gene locus_tag LOCUS_29840 15403 14789 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 protein_id gnl|my_center|LOCUS_29840 17342 15969 gene locus_tag LOCUS_29850 gene mpl 17342 15969 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_29850 17862 17344 gene locus_tag LOCUS_29860 17862 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 18033 19196 gene locus_tag LOCUS_29870 gene rnd 18033 19196 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_29870 19215 19457 gene locus_tag LOCUS_29880 19215 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 19667 19879 gene locus_tag LOCUS_29890 19667 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 21321 19777 gene locus_tag LOCUS_29900 gene lnt 21321 19777 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 protein_id gnl|my_center|LOCUS_29900 22186 21326 gene locus_tag LOCUS_29910 22186 21326 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_29910 22659 22183 gene locus_tag LOCUS_29920 gene ybeY 22659 22183 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084465.1 protein_id gnl|my_center|LOCUS_29920 23669 22656 gene locus_tag LOCUS_29930 23669 22656 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_29930 25012 23666 gene locus_tag LOCUS_29940 gene miaB 25012 23666 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771098.1 protein_id gnl|my_center|LOCUS_29940 25221 27332 gene locus_tag LOCUS_29950 25221 27332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 27608 28846 gene locus_tag LOCUS_29960 gene egtB 27608 28846 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_29960 28846 29802 gene locus_tag LOCUS_29970 gene egtD 28846 29802 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_29970 30183 30995 gene locus_tag LOCUS_29980 gene rsmA 30183 30995 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_29980 31089 33473 gene locus_tag LOCUS_29990 gene lon 31089 33473 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence074 925 3012 gene locus_tag LOCUS_30000 gene fimX 925 3012 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_30000 3024 4103 gene locus_tag LOCUS_30010 3024 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 5327 4557 gene locus_tag LOCUS_30020 5327 4557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366478.1 protein_id gnl|my_center|LOCUS_30020 6082 5324 gene locus_tag LOCUS_30030 6082 5324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_30030 7223 6087 gene locus_tag LOCUS_30040 7223 6087 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_30040 8241 7225 gene locus_tag LOCUS_30050 8241 7225 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_30050 9677 8322 gene locus_tag LOCUS_30060 9677 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 10778 10356 gene locus_tag LOCUS_30070 10778 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 11581 11003 gene locus_tag LOCUS_30080 11581 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 12429 11797 gene locus_tag LOCUS_30090 gene parA 12429 11797 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836937.1 protein_id gnl|my_center|LOCUS_30090 13050 12502 gene locus_tag LOCUS_30100 13050 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 14441 13671 gene locus_tag LOCUS_30110 14441 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 14969 14526 gene locus_tag LOCUS_30120 14969 14526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 19131 15160 gene locus_tag LOCUS_30130 19131 15160 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_30130 20383 19205 gene locus_tag LOCUS_30140 20383 19205 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_30140 21012 20617 gene locus_tag LOCUS_30150 21012 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 21517 23052 gene locus_tag LOCUS_30160 21517 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 23072 23980 gene locus_tag LOCUS_30170 23072 23980 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_30170 25180 23993 gene locus_tag LOCUS_30180 25180 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 26242 25376 gene locus_tag LOCUS_30190 26242 25376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 26410 27078 gene locus_tag LOCUS_30200 26410 27078 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_30200 27104 28156 gene locus_tag LOCUS_30210 gene nadA 27104 28156 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115295.1 protein_id gnl|my_center|LOCUS_30210 28958 28251 gene locus_tag LOCUS_30220 gene dnr 28958 28251 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_30220 29380 29162 gene locus_tag LOCUS_30230 29380 29162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 30849 29491 gene locus_tag LOCUS_30240 30849 29491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_30240 31293 31036 gene locus_tag LOCUS_30250 31293 31036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 31727 31293 gene locus_tag LOCUS_30260 31727 31293 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence075 740 102 gene locus_tag LOCUS_30270 gene ureG 740 102 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098772.1 protein_id gnl|my_center|LOCUS_30270 1440 754 gene locus_tag LOCUS_30280 1440 754 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_30280 1900 1424 gene locus_tag LOCUS_30290 gene ureE 1900 1424 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 protein_id gnl|my_center|LOCUS_30290 3702 1993 gene locus_tag LOCUS_30300 gene ureC 3702 1993 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_30300 4515 3877 gene locus_tag LOCUS_30310 4515 3877 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_30310 5458 4631 gene locus_tag LOCUS_30320 5458 4631 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_30320 6396 5701 gene locus_tag LOCUS_30330 gene urtE 6396 5701 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_30330 7495 6599 gene locus_tag LOCUS_30340 gene urtD 7495 6599 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_30340 8580 7492 gene locus_tag LOCUS_30350 gene urtC 8580 7492 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_30350 10197 8584 gene locus_tag LOCUS_30360 gene urtB 10197 8584 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_30360 11832 10543 gene locus_tag LOCUS_30370 gene urtA 11832 10543 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_30370 12072 15464 gene locus_tag LOCUS_30380 12072 15464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_30380 15454 16359 gene locus_tag LOCUS_30390 15454 16359 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 protein_id gnl|my_center|LOCUS_30390 16778 17662 gene locus_tag LOCUS_30400 16778 17662 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_30400 18760 17732 gene locus_tag LOCUS_30410 18760 17732 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 protein_id gnl|my_center|LOCUS_30410 18881 19684 gene locus_tag LOCUS_30420 18881 19684 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204214875.1 protein_id gnl|my_center|LOCUS_30420 19935 21203 gene locus_tag LOCUS_30430 19935 21203 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_30430 22283 21264 gene locus_tag LOCUS_30440 22283 21264 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_30440 23855 22314 gene locus_tag LOCUS_30450 23855 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 24434 24994 gene locus_tag LOCUS_30460 24434 24994 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_30460 25388 25699 gene locus_tag LOCUS_30470 25388 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 25702 26172 gene locus_tag LOCUS_30480 25702 26172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 26474 26229 gene locus_tag LOCUS_30490 26474 26229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 26890 26594 gene locus_tag LOCUS_30500 26890 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 27658 26951 gene locus_tag LOCUS_30510 27658 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 28613 27987 gene locus_tag LOCUS_30520 28613 27987 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_30520 30226 28940 gene locus_tag LOCUS_30530 30226 28940 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826413.1 protein_id gnl|my_center|LOCUS_30530 31087 30329 gene locus_tag LOCUS_30540 31087 30329 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence076 253 567 gene locus_tag LOCUS_30550 253 567 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_30550 1100 1771 gene locus_tag LOCUS_30560 1100 1771 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_30560 2132 4519 gene locus_tag LOCUS_30570 2132 4519 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927044.1 protein_id gnl|my_center|LOCUS_30570 4781 4581 gene locus_tag LOCUS_30580 4781 4581 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296638.1 protein_id gnl|my_center|LOCUS_30580 5168 5013 gene locus_tag LOCUS_30590 5168 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 13915 5165 gene locus_tag LOCUS_30600 13915 5165 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_30600 14484 14023 gene locus_tag LOCUS_30610 14484 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 14790 15326 gene locus_tag LOCUS_30620 14790 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 15641 15363 gene locus_tag LOCUS_30630 15641 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 16030 15638 gene locus_tag LOCUS_30640 16030 15638 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185460.1 protein_id gnl|my_center|LOCUS_30640 16357 16043 gene locus_tag LOCUS_30650 16357 16043 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400563.1 protein_id gnl|my_center|LOCUS_30650 16617 16405 gene locus_tag LOCUS_30660 16617 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 16893 16747 gene locus_tag LOCUS_30670 16893 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 17174 17013 gene locus_tag LOCUS_30680 17174 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 18032 17334 gene locus_tag LOCUS_30690 18032 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 19781 18090 gene locus_tag LOCUS_30700 19781 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 21577 20291 gene locus_tag LOCUS_30710 21577 20291 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972769.1 protein_id gnl|my_center|LOCUS_30710 24251 21618 gene locus_tag LOCUS_30720 24251 21618 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088605.1 protein_id gnl|my_center|LOCUS_30720 24637 24876 gene locus_tag LOCUS_30730 24637 24876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 25828 26256 gene locus_tag LOCUS_30740 25828 26256 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_30740 26657 26839 gene locus_tag LOCUS_30750 26657 26839 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_30750 27138 28271 gene locus_tag LOCUS_30760 27138 28271 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30760 >Feature sequence077 2000 48 gene locus_tag LOCUS_30770 2000 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2610 3638 gene locus_tag LOCUS_30780 2610 3638 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_30780 3853 5505 gene locus_tag LOCUS_30790 gene ilvG 3853 5505 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038423.1 protein_id gnl|my_center|LOCUS_30790 5502 5798 gene locus_tag LOCUS_30800 5502 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6101 6943 gene locus_tag LOCUS_30810 gene nfo 6101 6943 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 protein_id gnl|my_center|LOCUS_30810 7227 7303 gene locus_tag LOCUS_t00370 7227 7303 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8675 7554 gene locus_tag LOCUS_30820 8675 7554 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_30820 9462 8662 gene locus_tag LOCUS_30830 9462 8662 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_30830 10543 9515 gene locus_tag LOCUS_30840 10543 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 10739 10978 gene locus_tag LOCUS_30850 10739 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 11947 11279 gene locus_tag LOCUS_30860 11947 11279 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_30860 13745 12135 gene locus_tag LOCUS_30870 13745 12135 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268468.1 protein_id gnl|my_center|LOCUS_30870 15594 13756 gene locus_tag LOCUS_30880 15594 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 15742 16671 gene locus_tag LOCUS_30890 gene rarD 15742 16671 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_30890 18010 16679 gene locus_tag LOCUS_30900 18010 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 19122 18175 gene locus_tag LOCUS_30910 19122 18175 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_30910 19231 20424 gene locus_tag LOCUS_30920 19231 20424 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194779.1 protein_id gnl|my_center|LOCUS_30920 21139 20666 gene locus_tag LOCUS_30930 21139 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 21803 21174 gene locus_tag LOCUS_30940 21803 21174 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_30940 22304 22041 gene locus_tag LOCUS_30950 gene tusA 22304 22041 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_30950 22501 23151 gene locus_tag LOCUS_30960 22501 23151 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_30960 23459 25267 gene locus_tag LOCUS_30970 23459 25267 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_30970 25325 26038 gene locus_tag LOCUS_30980 25325 26038 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_30980 27249 26047 gene locus_tag LOCUS_30990 gene ubiM 27249 26047 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951321.1 protein_id gnl|my_center|LOCUS_30990 27490 27801 gene locus_tag LOCUS_31000 27490 27801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 28731 28024 gene locus_tag LOCUS_31010 28731 28024 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261825.1 protein_id gnl|my_center|LOCUS_31010 28821 29024 gene locus_tag LOCUS_31020 28821 29024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 29515 28943 gene locus_tag LOCUS_31030 29515 28943 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence078 156 81 gene locus_tag LOCUS_t00380 156 81 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 276 203 gene locus_tag LOCUS_t00390 276 203 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 405 321 gene locus_tag LOCUS_t00400 405 321 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 784 2109 gene locus_tag LOCUS_31040 784 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3807 2515 gene locus_tag LOCUS_31050 gene pilR 3807 2515 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_31050 5303 3852 gene locus_tag LOCUS_31060 5303 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 6148 5300 gene locus_tag LOCUS_31070 6148 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 6668 9412 gene locus_tag LOCUS_31080 6668 9412 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_31080 9424 10404 gene locus_tag LOCUS_31090 9424 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 10401 10976 gene locus_tag LOCUS_31100 10401 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 10978 11694 gene locus_tag LOCUS_31110 10978 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 12021 12248 gene locus_tag LOCUS_31120 12021 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 12226 12552 gene locus_tag LOCUS_31130 12226 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 13393 12746 gene locus_tag LOCUS_31140 13393 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 14281 13400 gene locus_tag LOCUS_31150 14281 13400 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086303.1 protein_id gnl|my_center|LOCUS_31150 14974 14591 gene locus_tag LOCUS_31160 14974 14591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 16175 15003 gene locus_tag LOCUS_31170 gene megL 16175 15003 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_31170 16705 16172 gene locus_tag LOCUS_31180 16705 16172 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_31180 17295 16720 gene locus_tag LOCUS_31190 17295 16720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 18531 17323 gene locus_tag LOCUS_31200 18531 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 20181 18928 gene locus_tag LOCUS_31210 20181 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 20972 20178 gene locus_tag LOCUS_31220 20972 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 23298 20986 gene locus_tag LOCUS_31230 23298 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 23938 23594 gene locus_tag LOCUS_31240 23938 23594 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_31240 24987 23986 gene locus_tag LOCUS_31250 24987 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 25899 25057 gene locus_tag LOCUS_31260 25899 25057 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_31260 25993 26676 gene locus_tag LOCUS_31270 25993 26676 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_31270 27665 30598 gene locus_tag LOCUS_31280 27665 30598 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462223.1 protein_id gnl|my_center|LOCUS_31280 30612 31232 gene locus_tag LOCUS_31290 30612 31232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 32424 33113 gene locus_tag LOCUS_31300 32424 33113 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272723.1 protein_id gnl|my_center|LOCUS_31300 33101 33748 gene locus_tag LOCUS_31310 33101 33748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 33808 35571 gene locus_tag LOCUS_31320 33808 35571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 35827 36759 gene locus_tag LOCUS_31330 35827 36759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 36849 37556 gene locus_tag LOCUS_31340 36849 37556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 37888 38481 gene locus_tag LOCUS_31350 gene napC 37888 38481 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_31350 38590 39342 gene locus_tag LOCUS_31360 38590 39342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 40069 39479 gene locus_tag LOCUS_31370 gene pth 40069 39479 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705080.1 protein_id gnl|my_center|LOCUS_31370 40932 40306 gene locus_tag LOCUS_31380 40932 40306 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_31380 42134 41181 gene locus_tag LOCUS_31390 42134 41181 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_31390 42293 42219 gene locus_tag LOCUS_t00410 42293 42219 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43229 42348 gene locus_tag LOCUS_31400 gene ispE 43229 42348 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 protein_id gnl|my_center|LOCUS_31400 45063 43294 gene locus_tag LOCUS_31410 gene lbcA 45063 43294 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_31410 45349 46614 gene locus_tag LOCUS_31420 gene hemA 45349 46614 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 protein_id gnl|my_center|LOCUS_31420 46611 47687 gene locus_tag LOCUS_31430 gene prfA 46611 47687 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_31430 47703 48587 gene locus_tag LOCUS_31440 gene prmC 47703 48587 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_31440 48650 49060 gene locus_tag LOCUS_31450 48650 49060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 49155 49898 gene locus_tag LOCUS_31460 49155 49898 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_31460 49905 50516 gene locus_tag LOCUS_31470 49905 50516 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130463.1 protein_id gnl|my_center|LOCUS_31470 50676 51296 gene locus_tag LOCUS_31480 50676 51296 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258090.1 protein_id gnl|my_center|LOCUS_31480 53150 51714 gene locus_tag LOCUS_31490 gene gatB 53150 51714 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_31490 54629 53175 gene locus_tag LOCUS_31500 gene gatA 54629 53175 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_31500 55116 54829 gene locus_tag LOCUS_31510 gene gatC 55116 54829 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_31510 55527 56576 gene locus_tag LOCUS_31520 55527 56576 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417472.1 protein_id gnl|my_center|LOCUS_31520 56673 57527 gene locus_tag LOCUS_31530 gene mreC 56673 57527 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_31530 57524 58012 gene locus_tag LOCUS_31540 gene mreD 57524 58012 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_31540 58016 59860 gene locus_tag LOCUS_31550 gene mrdA 58016 59860 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_31550 59860 60996 gene locus_tag LOCUS_31560 gene rodA 59860 60996 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_31560 61033 62211 gene locus_tag LOCUS_31570 gene mltB 61033 62211 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_31570 62211 63068 gene locus_tag LOCUS_31580 62211 63068 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_31580 63577 64731 gene locus_tag LOCUS_31590 63577 64731 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_31590 64734 65612 gene locus_tag LOCUS_31600 64734 65612 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_31600 65626 65898 gene locus_tag LOCUS_31610 65626 65898 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_31610 65895 66545 gene locus_tag LOCUS_31620 gene lipB 65895 66545 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_31620 66737 67723 gene locus_tag LOCUS_31630 gene lipA 66737 67723 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 protein_id gnl|my_center|LOCUS_31630 67727 68485 gene locus_tag LOCUS_31640 67727 68485 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_31640 69678 68866 gene locus_tag LOCUS_31650 gene murI 69678 68866 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 protein_id gnl|my_center|LOCUS_31650 70117 69671 gene locus_tag LOCUS_31660 gene fxsA 70117 69671 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_31660 70486 70815 gene locus_tag LOCUS_31670 70486 70815 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071016.1 protein_id gnl|my_center|LOCUS_31670 70794 73157 gene locus_tag LOCUS_31680 gene dsbD 70794 73157 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_31680 73154 73687 gene locus_tag LOCUS_31690 73154 73687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 73866 74306 gene locus_tag LOCUS_31700 gene aroQ 73866 74306 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_31700 74333 74788 gene locus_tag LOCUS_31710 gene accB 74333 74788 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369456.1 protein_id gnl|my_center|LOCUS_31710 74803 76143 gene locus_tag LOCUS_31720 gene accC 74803 76143 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884888.1 protein_id gnl|my_center|LOCUS_31720 76197 77087 gene locus_tag LOCUS_31730 gene prmA 76197 77087 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 protein_id gnl|my_center|LOCUS_31730 77104 78234 gene locus_tag LOCUS_31740 77104 78234 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_31740 78351 79337 gene locus_tag LOCUS_31750 gene dusB 78351 79337 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_31750 79334 79630 gene locus_tag LOCUS_31760 gene fis 79334 79630 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 protein_id gnl|my_center|LOCUS_31760 79718 81277 gene locus_tag LOCUS_31770 gene purH 79718 81277 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_31770 81302 82105 gene locus_tag LOCUS_31780 gene lpxA 81302 82105 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_31780 82304 83596 gene locus_tag LOCUS_31790 gene purD 82304 83596 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_31790 84627 83644 gene locus_tag LOCUS_31800 gene amgK 84627 83644 CDS product N-acetylmuramate/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_31800 85215 84898 gene locus_tag LOCUS_31810 85215 84898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 85439 85212 gene locus_tag LOCUS_31820 85439 85212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 85540 87720 gene locus_tag LOCUS_31830 gene lptD 85540 87720 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_31830 87732 89051 gene locus_tag LOCUS_31840 87732 89051 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_31840 89069 90058 gene locus_tag LOCUS_31850 gene pdxA 89069 90058 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_31850 90538 90185 gene locus_tag LOCUS_31860 90538 90185 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_31860 90718 91692 gene locus_tag LOCUS_31870 gene cysB 90718 91692 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_31870 92213 92599 gene locus_tag LOCUS_31880 92213 92599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 93925 92810 gene locus_tag LOCUS_31890 93925 92810 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530155.1 protein_id gnl|my_center|LOCUS_31890 95137 94190 gene locus_tag LOCUS_31900 95137 94190 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_31900 96038 95583 gene locus_tag LOCUS_31910 96038 95583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 96193 96576 gene locus_tag LOCUS_31920 gene apaG 96193 96576 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 protein_id gnl|my_center|LOCUS_31920 96598 97227 gene locus_tag LOCUS_31930 96598 97227 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_31930 97229 98062 gene locus_tag LOCUS_31940 gene apaH 97229 98062 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704371.1 protein_id gnl|my_center|LOCUS_31940 98587 98072 gene locus_tag LOCUS_31950 gene folA 98587 98072 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_31950 98760 99779 gene locus_tag LOCUS_31960 98760 99779 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958398.1 protein_id gnl|my_center|LOCUS_31960 100642 99674 gene locus_tag LOCUS_31970 100642 99674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 101644 100850 gene locus_tag LOCUS_31980 101644 100850 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_31980 102490 101648 gene locus_tag LOCUS_31990 gene lgt 102490 101648 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_31990 103070 103408 gene locus_tag LOCUS_32000 103070 103408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 104653 103457 gene locus_tag LOCUS_32010 104653 103457 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_32010 104844 104650 gene locus_tag LOCUS_32020 104844 104650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 105054 105605 gene locus_tag LOCUS_32030 105054 105605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 105596 106630 gene locus_tag LOCUS_32040 105596 106630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 106632 109766 gene locus_tag LOCUS_32050 106632 109766 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_32050 109968 110303 gene locus_tag LOCUS_32060 109968 110303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 protein_id gnl|my_center|LOCUS_32060 110304 111461 gene locus_tag LOCUS_32070 110304 111461 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257605.1 protein_id gnl|my_center|LOCUS_32070 111520 112374 gene locus_tag LOCUS_32080 111520 112374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_32080 112387 113457 gene locus_tag LOCUS_32090 112387 113457 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089020.1 protein_id gnl|my_center|LOCUS_32090 113789 115909 gene locus_tag LOCUS_32100 113789 115909 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_32100 116280 116825 gene locus_tag LOCUS_32110 116280 116825 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_32110 116822 117541 gene locus_tag LOCUS_32120 116822 117541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 117784 118221 gene locus_tag LOCUS_32130 117784 118221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 118439 118278 gene locus_tag LOCUS_32140 118439 118278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 118776 118417 gene locus_tag LOCUS_32150 118776 118417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 119288 119034 gene locus_tag LOCUS_32160 119288 119034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 120073 119441 gene locus_tag LOCUS_32170 120073 119441 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 protein_id gnl|my_center|LOCUS_32170 120531 120076 gene locus_tag LOCUS_32180 gene moaE 120531 120076 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_32180 120881 120627 gene locus_tag LOCUS_32190 gene moaD 120881 120627 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093027.1 protein_id gnl|my_center|LOCUS_32190 122128 120878 gene locus_tag LOCUS_32200 122128 120878 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_32200 122700 122182 gene locus_tag LOCUS_32210 gene moaB 122700 122182 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 protein_id gnl|my_center|LOCUS_32210 123780 122848 gene locus_tag LOCUS_32220 123780 122848 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_32220 124438 124070 gene locus_tag LOCUS_32230 124438 124070 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_32230 125896 124439 gene locus_tag LOCUS_32240 gene gcvPB 125896 124439 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_32240 127273 125915 gene locus_tag LOCUS_32250 gene gcvPA 127273 125915 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_32250 127724 127329 gene locus_tag LOCUS_32260 gene gcvH 127724 127329 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_32260 128930 127839 gene locus_tag LOCUS_32270 gene gcvT 128930 127839 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071082.1 protein_id gnl|my_center|LOCUS_32270 129542 130558 gene locus_tag LOCUS_32280 129542 130558 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_32280 131000 132592 gene locus_tag LOCUS_32290 131000 132592 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_32290 132567 133646 gene locus_tag LOCUS_32300 132567 133646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_32300 135313 134009 gene locus_tag LOCUS_32310 gene pepP 135313 134009 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_32310 135864 135310 gene locus_tag LOCUS_32320 135864 135310 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_32320 136005 136235 gene locus_tag LOCUS_32330 136005 136235 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_32330 136307 136621 gene locus_tag LOCUS_32340 136307 136621 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380079.1 protein_id gnl|my_center|LOCUS_32340 136859 137449 gene locus_tag LOCUS_32350 136859 137449 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_32350 137638 138144 gene locus_tag LOCUS_32360 137638 138144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 139832 138294 gene locus_tag LOCUS_32370 gene ilvA 139832 138294 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence079 3658 1025 gene locus_tag LOCUS_32380 gene acnB 3658 1025 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 protein_id gnl|my_center|LOCUS_32380 4366 5733 gene locus_tag LOCUS_32390 gene purB 4366 5733 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380132.1 protein_id gnl|my_center|LOCUS_32390 6948 6187 gene locus_tag LOCUS_32400 6948 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 7759 7274 gene locus_tag LOCUS_32410 7759 7274 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_32410 12062 8157 gene locus_tag LOCUS_32420 gene hrpA 12062 8157 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446469.1 protein_id gnl|my_center|LOCUS_32420 12293 13921 gene locus_tag LOCUS_32430 12293 13921 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088888.1 protein_id gnl|my_center|LOCUS_32430 15895 14168 gene locus_tag LOCUS_32440 15895 14168 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 protein_id gnl|my_center|LOCUS_32440 16054 17079 gene locus_tag LOCUS_32450 16054 17079 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_32450 19810 17096 gene locus_tag LOCUS_32460 gene acnA 19810 17096 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_32460 20001 20501 gene locus_tag LOCUS_32470 20001 20501 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_32470 20498 21403 gene locus_tag LOCUS_32480 gene rimK 20498 21403 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_32480 21714 22757 gene locus_tag LOCUS_32490 21714 22757 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_32490 24162 22759 gene locus_tag LOCUS_32500 24162 22759 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_32500 24462 24178 gene locus_tag LOCUS_32510 24462 24178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 25725 24625 gene locus_tag LOCUS_32520 25725 24625 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931189.1 protein_id gnl|my_center|LOCUS_32520 26877 26062 gene locus_tag LOCUS_32530 26877 26062 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120310.1 protein_id gnl|my_center|LOCUS_32530 27921 26893 gene locus_tag LOCUS_32540 gene epd 27921 26893 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635047.1 protein_id gnl|my_center|LOCUS_32540 28071 28826 gene locus_tag LOCUS_32550 28071 28826 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence080 638 231 gene locus_tag LOCUS_32560 638 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3070 683 gene locus_tag LOCUS_32570 3070 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3242 5038 gene locus_tag LOCUS_32580 3242 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 5035 5760 gene locus_tag LOCUS_32590 gene hoxU 5035 5760 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_32590 5750 6289 gene locus_tag LOCUS_32600 5750 6289 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_32600 6297 7802 gene locus_tag LOCUS_32610 6297 7802 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_32610 7799 8308 gene locus_tag LOCUS_32620 7799 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 11333 8757 gene locus_tag LOCUS_32630 gene clpB 11333 8757 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_32630 12115 11405 gene locus_tag LOCUS_32640 12115 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 12949 12425 gene locus_tag LOCUS_32650 gene def 12949 12425 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_32650 13458 12952 gene locus_tag LOCUS_32660 13458 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 14702 13947 gene locus_tag LOCUS_32670 gene yfiH 14702 13947 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703192.1 protein_id gnl|my_center|LOCUS_32670 15654 14695 gene locus_tag LOCUS_32680 gene rluD 15654 14695 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079108.1 protein_id gnl|my_center|LOCUS_32680 16192 17019 gene locus_tag LOCUS_32690 16192 17019 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102590.1 protein_id gnl|my_center|LOCUS_32690 17460 17122 gene locus_tag LOCUS_32700 gene glnB 17460 17122 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_32700 19580 17955 gene locus_tag LOCUS_32710 19580 17955 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_32710 20931 20059 gene locus_tag LOCUS_32720 gene sucD 20931 20059 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165487.1 protein_id gnl|my_center|LOCUS_32720 22045 21011 gene locus_tag LOCUS_32730 gene sucC 22045 21011 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 protein_id gnl|my_center|LOCUS_32730 22269 22502 gene locus_tag LOCUS_32740 22269 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 22547 24190 gene locus_tag LOCUS_32750 22547 24190 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_32750 24200 25552 gene locus_tag LOCUS_32760 gene pilR 24200 25552 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_32760 26003 26239 gene locus_tag LOCUS_32770 26003 26239 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_32770 26236 26613 gene locus_tag LOCUS_32780 26236 26613 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence081 2502 442 gene locus_tag LOCUS_32790 2502 442 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204831.1 protein_id gnl|my_center|LOCUS_32790 3851 2499 gene locus_tag LOCUS_32800 3851 2499 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179209223.1 protein_id gnl|my_center|LOCUS_32800 4550 3936 gene locus_tag LOCUS_32810 4550 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4975 4640 gene locus_tag LOCUS_32820 4975 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 5597 5672 gene locus_tag LOCUS_t00420 5597 5672 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6179 5892 gene locus_tag LOCUS_32830 6179 5892 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_32830 6192 6479 gene locus_tag LOCUS_32840 6192 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 6748 7614 gene locus_tag LOCUS_32850 6748 7614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275487.1 protein_id gnl|my_center|LOCUS_32850 9141 7993 gene locus_tag LOCUS_32860 9141 7993 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_32860 10480 9383 gene locus_tag LOCUS_32870 gene aroC 10480 9383 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_32870 11899 10559 gene locus_tag LOCUS_32880 gene tolC 11899 10559 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_32880 12984 12157 gene locus_tag LOCUS_32890 12984 12157 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_32890 13200 15014 gene locus_tag LOCUS_32900 13200 15014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_32900 17653 15560 gene locus_tag LOCUS_32910 gene pnp 17653 15560 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_32910 17961 17692 gene locus_tag LOCUS_32920 gene rpsO 17961 17692 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_32920 19281 18367 gene locus_tag LOCUS_32930 gene truB 19281 18367 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209256.1 protein_id gnl|my_center|LOCUS_32930 19661 19281 gene locus_tag LOCUS_32940 gene rbfA 19661 19281 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_32940 22349 19674 gene locus_tag LOCUS_32950 gene infB 22349 19674 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192207.1 protein_id gnl|my_center|LOCUS_32950 23873 22371 gene locus_tag LOCUS_32960 gene nusA 23873 22371 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156278.1 protein_id gnl|my_center|LOCUS_32960 24325 23888 gene locus_tag LOCUS_32970 gene rimP 24325 23888 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence082 154 471 gene locus_tag LOCUS_32980 154 471 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129526501.1 protein_id gnl|my_center|LOCUS_32980 816 3116 gene locus_tag LOCUS_32990 gene nosZ 816 3116 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_32990 3221 3544 gene locus_tag LOCUS_33000 3221 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3842 4576 gene locus_tag LOCUS_33010 3842 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 4707 5855 gene locus_tag LOCUS_33020 4707 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 5980 7215 gene locus_tag LOCUS_33030 5980 7215 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967623.1 protein_id gnl|my_center|LOCUS_33030 7212 8102 gene locus_tag LOCUS_33040 gene napG 7212 8102 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071137.1 protein_id gnl|my_center|LOCUS_33040 8099 9070 gene locus_tag LOCUS_33050 gene napH 8099 9070 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_33050 9467 10354 gene locus_tag LOCUS_33060 9467 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 10440 11048 gene locus_tag LOCUS_33070 10440 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 11230 12057 gene locus_tag LOCUS_33080 11230 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 12610 13110 gene locus_tag LOCUS_33090 12610 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 13107 13718 gene locus_tag LOCUS_33100 13107 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 13951 14430 gene locus_tag LOCUS_33110 13951 14430 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_33110 16034 14751 gene locus_tag LOCUS_33120 gene hemL 16034 14751 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_33120 16681 16031 gene locus_tag LOCUS_33130 gene thiE 16681 16031 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_33130 17494 16688 gene locus_tag LOCUS_33140 17494 16688 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_33140 17701 18162 gene locus_tag LOCUS_33150 17701 18162 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969643.1 protein_id gnl|my_center|LOCUS_33150 18423 18812 gene locus_tag LOCUS_33160 18423 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 19751 19332 gene locus_tag LOCUS_33170 gene hemJ 19751 19332 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_33170 20585 19872 gene locus_tag LOCUS_33180 20585 19872 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_33180 21064 22092 gene locus_tag LOCUS_33190 gene argC 21064 22092 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_33190 22172 22888 gene locus_tag LOCUS_33200 22172 22888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 22900 23379 gene locus_tag LOCUS_33210 22900 23379 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_33210 23480 23833 gene locus_tag LOCUS_33220 gene erpA 23480 23833 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_33220 24500 24105 gene locus_tag LOCUS_33230 24500 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 >Feature sequence083 97 891 gene locus_tag LOCUS_33240 97 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1735 1328 gene locus_tag LOCUS_33250 1735 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 2832 2401 gene locus_tag LOCUS_33260 2832 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4716 2908 gene locus_tag LOCUS_33270 4716 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5253 5627 gene locus_tag LOCUS_33280 5253 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 5876 8644 gene locus_tag LOCUS_33290 5876 8644 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787323.1 protein_id gnl|my_center|LOCUS_33290 9816 8674 gene locus_tag LOCUS_33300 9816 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 10124 11191 gene locus_tag LOCUS_33310 10124 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 12072 11215 gene locus_tag LOCUS_33320 12072 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 12704 12120 gene locus_tag LOCUS_33330 12704 12120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 12597 12974 gene locus_tag LOCUS_33340 12597 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 13677 14546 gene locus_tag LOCUS_33350 13677 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 15668 14706 gene locus_tag LOCUS_33360 15668 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 15894 16154 gene locus_tag LOCUS_33370 15894 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 16714 16184 gene locus_tag LOCUS_33380 16714 16184 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073958.1 protein_id gnl|my_center|LOCUS_33380 17039 17413 gene locus_tag LOCUS_33390 17039 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 18798 17422 gene locus_tag LOCUS_33400 18798 17422 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_33400 19787 19044 gene locus_tag LOCUS_33410 19787 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 21984 19900 gene locus_tag LOCUS_33420 21984 19900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 22190 22489 gene locus_tag LOCUS_33430 22190 22489 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_33430 22531 23001 gene locus_tag LOCUS_33440 gene bcp 22531 23001 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094791.1 protein_id gnl|my_center|LOCUS_33440 23039 23431 gene locus_tag LOCUS_33450 23039 23431 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_33450 23556 24047 gene locus_tag LOCUS_33460 23556 24047 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_33460 24166 24011 gene locus_tag LOCUS_33470 24166 24011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence084 152 307 gene locus_tag LOCUS_33480 152 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 361 942 gene locus_tag LOCUS_33490 361 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 2495 1482 gene locus_tag LOCUS_33500 2495 1482 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_33500 3673 2981 gene locus_tag LOCUS_33510 3673 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 3916 3767 gene locus_tag LOCUS_33520 3916 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 4139 5647 gene locus_tag LOCUS_33530 gene nifB 4139 5647 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_33530 5669 5947 gene locus_tag LOCUS_33540 5669 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 5966 6142 gene locus_tag LOCUS_33550 5966 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 6139 6561 gene locus_tag LOCUS_33560 6139 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_33560 6941 7225 gene locus_tag LOCUS_33570 gene fdxC 6941 7225 CDS product ferredoxin FdxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723760.1 protein_id gnl|my_center|LOCUS_33570 7244 7606 gene locus_tag LOCUS_33580 7244 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 7590 8162 gene locus_tag LOCUS_33590 7590 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 8441 9310 gene locus_tag LOCUS_33600 gene draG 8441 9310 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_33600 10175 9774 gene locus_tag LOCUS_33610 10175 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 11156 10254 gene locus_tag LOCUS_33620 11156 10254 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_33620 12136 11291 gene locus_tag LOCUS_33630 12136 11291 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943429.1 protein_id gnl|my_center|LOCUS_33630 12323 13198 gene locus_tag LOCUS_33640 gene nifH 12323 13198 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943447.1 protein_id gnl|my_center|LOCUS_33640 13363 14844 gene locus_tag LOCUS_33650 gene nifD 13363 14844 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_33650 14986 16557 gene locus_tag LOCUS_33660 gene nifK 14986 16557 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_33660 16773 16576 gene locus_tag LOCUS_33670 16773 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 16837 17049 gene locus_tag LOCUS_33680 16837 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 17075 17269 gene locus_tag LOCUS_33690 17075 17269 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723758.1 protein_id gnl|my_center|LOCUS_33690 17554 18309 gene locus_tag LOCUS_33700 17554 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 18306 18572 gene locus_tag LOCUS_33710 18306 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 18569 19324 gene locus_tag LOCUS_33720 18569 19324 CDS product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388751.1 protein_id gnl|my_center|LOCUS_33720 19828 20865 gene locus_tag LOCUS_33730 19828 20865 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 protein_id gnl|my_center|LOCUS_33730 21231 22178 gene locus_tag LOCUS_33740 21231 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence085 376 594 gene locus_tag LOCUS_33750 376 594 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33750 673 987 gene locus_tag LOCUS_33760 673 987 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_33760 1237 1437 gene locus_tag LOCUS_33770 1237 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 2983 1577 gene locus_tag LOCUS_33780 2983 1577 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_33780 4832 2958 gene locus_tag LOCUS_33790 4832 2958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268779.1 protein_id gnl|my_center|LOCUS_33790 5208 6203 gene locus_tag LOCUS_33800 5208 6203 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384578.1 protein_id gnl|my_center|LOCUS_33800 6571 6392 gene locus_tag LOCUS_33810 6571 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 6559 7188 gene locus_tag LOCUS_33820 6559 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 7188 8594 gene locus_tag LOCUS_33830 7188 8594 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_33830 9197 8694 gene locus_tag LOCUS_33840 9197 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 9875 9246 gene locus_tag LOCUS_33850 9875 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 10577 10107 gene locus_tag LOCUS_33860 10577 10107 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_33860 11850 10570 gene locus_tag LOCUS_33870 11850 10570 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 protein_id gnl|my_center|LOCUS_33870 12490 11966 gene locus_tag LOCUS_33880 12490 11966 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_33880 13073 13948 gene locus_tag LOCUS_33890 13073 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 13942 15009 gene locus_tag LOCUS_33900 gene amrS 13942 15009 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_33900 15060 15344 gene locus_tag LOCUS_33910 15060 15344 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_33910 16634 15357 gene locus_tag LOCUS_33920 16634 15357 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_33920 17034 16615 gene locus_tag LOCUS_33930 17034 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 17610 18812 gene locus_tag LOCUS_33940 gene proV 17610 18812 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_33940 18816 19982 gene locus_tag LOCUS_33950 gene proW 18816 19982 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390229.1 protein_id gnl|my_center|LOCUS_33950 20027 21040 gene locus_tag LOCUS_33960 gene proX 20027 21040 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence086 239 685 gene locus_tag LOCUS_33970 gene fkpB 239 685 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_33970 892 1836 gene locus_tag LOCUS_33980 gene ispH 892 1836 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_33980 2501 2130 gene locus_tag LOCUS_33990 2501 2130 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_33990 2788 2498 gene locus_tag LOCUS_34000 2788 2498 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 protein_id gnl|my_center|LOCUS_34000 4203 2989 gene locus_tag LOCUS_34010 4203 2989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_34010 4591 4860 gene locus_tag LOCUS_34020 4591 4860 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971536.1 protein_id gnl|my_center|LOCUS_34020 4863 5189 gene locus_tag LOCUS_34030 4863 5189 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 protein_id gnl|my_center|LOCUS_34030 5309 5464 gene locus_tag LOCUS_34040 5309 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 6219 5773 gene locus_tag LOCUS_34050 6219 5773 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_34050 6632 6261 gene locus_tag LOCUS_34060 6632 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 10266 6667 gene locus_tag LOCUS_34070 10266 6667 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_34070 10922 10425 gene locus_tag LOCUS_34080 10922 10425 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_34080 12063 10996 gene locus_tag LOCUS_34090 12063 10996 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704649.1 protein_id gnl|my_center|LOCUS_34090 12470 12075 gene locus_tag LOCUS_34100 12470 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 12954 12532 gene locus_tag LOCUS_34110 gene tppE 12954 12532 CDS product type IVa pilus pseudopilin TppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_34110 13258 13689 gene locus_tag LOCUS_34120 13258 13689 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503471.1 protein_id gnl|my_center|LOCUS_34120 13942 14017 gene locus_tag LOCUS_t00430 13942 14017 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14205 15428 gene locus_tag LOCUS_34130 14205 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 15415 16611 gene locus_tag LOCUS_34140 15415 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 16774 16947 gene locus_tag LOCUS_34150 16774 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 17224 19326 gene locus_tag LOCUS_34160 17224 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 19848 20705 gene locus_tag LOCUS_34170 19848 20705 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence087 1655 270 gene locus_tag LOCUS_34180 gene argH 1655 270 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_34180 1922 2971 gene locus_tag LOCUS_34190 1922 2971 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_34190 2992 3729 gene locus_tag LOCUS_34200 2992 3729 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_34200 4797 3901 gene locus_tag LOCUS_34210 4797 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 5102 6028 gene locus_tag LOCUS_34220 gene hemC 5102 6028 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_34220 6038 6826 gene locus_tag LOCUS_34230 6038 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 7114 8295 gene locus_tag LOCUS_34240 7114 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 8292 9584 gene locus_tag LOCUS_34250 8292 9584 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_34250 10855 9842 gene locus_tag LOCUS_34260 10855 9842 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_34260 10924 11787 gene locus_tag LOCUS_34270 10924 11787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_34270 12769 12140 gene locus_tag LOCUS_34280 12769 12140 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_34280 14312 12834 gene locus_tag LOCUS_34290 gene ubiD 14312 12834 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_34290 15310 14510 gene locus_tag LOCUS_34300 15310 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 17340 15307 gene locus_tag LOCUS_34310 gene prlC 17340 15307 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_34310 18539 17583 gene locus_tag LOCUS_34320 18539 17583 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_34320 19111 18536 gene locus_tag LOCUS_34330 19111 18536 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_34330 19652 19176 gene locus_tag LOCUS_34340 19652 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence088 56 460 gene locus_tag LOCUS_34350 56 460 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_34350 1129 509 gene locus_tag LOCUS_34360 1129 509 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185827.1 protein_id gnl|my_center|LOCUS_34360 2987 1131 gene locus_tag LOCUS_34370 2987 1131 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481667.1 protein_id gnl|my_center|LOCUS_34370 3954 3082 gene locus_tag LOCUS_34380 3954 3082 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 protein_id gnl|my_center|LOCUS_34380 6370 3986 gene locus_tag LOCUS_34390 6370 3986 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_34390 6785 8788 gene locus_tag LOCUS_34400 6785 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 10050 8929 gene locus_tag LOCUS_34410 10050 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 10724 10338 gene locus_tag LOCUS_34420 10724 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 11242 11733 gene locus_tag LOCUS_34430 11242 11733 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974110.1 protein_id gnl|my_center|LOCUS_34430 11735 12475 gene locus_tag LOCUS_34440 11735 12475 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275400.1 protein_id gnl|my_center|LOCUS_34440 12495 13295 gene locus_tag LOCUS_34450 12495 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 13639 15117 gene locus_tag LOCUS_34460 13639 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 15245 15592 gene locus_tag LOCUS_34470 15245 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 15597 16172 gene locus_tag LOCUS_34480 15597 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 16184 16813 gene locus_tag LOCUS_34490 16184 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 16821 18470 gene locus_tag LOCUS_34500 16821 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 19135 18506 gene locus_tag LOCUS_34510 19135 18506 CDS product cold shock and DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037374.1 protein_id gnl|my_center|LOCUS_34510 19385 19206 gene locus_tag LOCUS_34520 19385 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence089 1101 634 gene locus_tag LOCUS_34530 1101 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1841 1386 gene locus_tag LOCUS_34540 1841 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 2614 2339 gene locus_tag LOCUS_34550 2614 2339 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_34550 2813 2574 gene locus_tag LOCUS_34560 2813 2574 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_34560 3729 3058 gene locus_tag LOCUS_34570 3729 3058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267736.1 protein_id gnl|my_center|LOCUS_34570 4505 3729 gene locus_tag LOCUS_34580 4505 3729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_34580 5538 4564 gene locus_tag LOCUS_34590 5538 4564 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532064.1 protein_id gnl|my_center|LOCUS_34590 6007 5612 gene locus_tag LOCUS_34600 6007 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 6215 7138 gene locus_tag LOCUS_34610 gene pqqB 6215 7138 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720978.1 protein_id gnl|my_center|LOCUS_34610 7135 7863 gene locus_tag LOCUS_34620 gene pqqC 7135 7863 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089476.1 protein_id gnl|my_center|LOCUS_34620 8096 7878 gene locus_tag LOCUS_34630 8096 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 8476 8766 gene locus_tag LOCUS_34640 gene pqqD 8476 8766 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_34640 8735 9883 gene locus_tag LOCUS_34650 gene pqqE 8735 9883 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 protein_id gnl|my_center|LOCUS_34650 9986 10492 gene locus_tag LOCUS_34660 9986 10492 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_34660 10506 11594 gene locus_tag LOCUS_34670 gene serC 10506 11594 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_34670 11578 12561 gene locus_tag LOCUS_34680 11578 12561 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931480.1 protein_id gnl|my_center|LOCUS_34680 12561 13754 gene locus_tag LOCUS_34690 12561 13754 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_34690 14053 13751 gene locus_tag LOCUS_34700 14053 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 14127 14885 gene locus_tag LOCUS_34710 14127 14885 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_34710 17245 15146 gene locus_tag LOCUS_34720 17245 15146 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 protein_id gnl|my_center|LOCUS_34720 17823 17506 gene locus_tag LOCUS_34730 17823 17506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 18161 18640 gene locus_tag LOCUS_34740 18161 18640 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941579.1 protein_id gnl|my_center|LOCUS_34740 18665 20512 gene locus_tag LOCUS_34750 18665 20512 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_34750 20927 22267 gene locus_tag LOCUS_34760 20927 22267 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808330.1 protein_id gnl|my_center|LOCUS_34760 23046 23480 gene locus_tag LOCUS_34770 gene pedF 23046 23480 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_34770 23594 24766 gene locus_tag LOCUS_34780 23594 24766 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_34780 24766 27054 gene locus_tag LOCUS_34790 24766 27054 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337818.1 protein_id gnl|my_center|LOCUS_34790 28302 27658 gene locus_tag LOCUS_34800 gene agmR 28302 27658 CDS product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 protein_id gnl|my_center|LOCUS_34800 30416 28686 gene locus_tag LOCUS_34810 30416 28686 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399374.1 protein_id gnl|my_center|LOCUS_34810 32165 30954 gene locus_tag LOCUS_34820 32165 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 33702 32803 gene locus_tag LOCUS_34830 33702 32803 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399356.1 protein_id gnl|my_center|LOCUS_34830 34064 33738 gene locus_tag LOCUS_34840 34064 33738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 34489 34064 gene locus_tag LOCUS_34850 34489 34064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 34637 35806 gene locus_tag LOCUS_34860 34637 35806 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088928.1 protein_id gnl|my_center|LOCUS_34860 35808 36779 gene locus_tag LOCUS_34870 35808 36779 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_34870 36788 37558 gene locus_tag LOCUS_34880 36788 37558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 protein_id gnl|my_center|LOCUS_34880 37555 38331 gene locus_tag LOCUS_34890 37555 38331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528734.1 protein_id gnl|my_center|LOCUS_34890 38672 39073 gene locus_tag LOCUS_34900 38672 39073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 39395 39667 gene locus_tag LOCUS_34910 39395 39667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 39945 40586 gene locus_tag LOCUS_34920 39945 40586 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_34920 40711 42504 gene locus_tag LOCUS_34930 gene aspS 40711 42504 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_34930 42659 43099 gene locus_tag LOCUS_34940 gene nudB 42659 43099 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_34940 45049 43643 gene locus_tag LOCUS_34950 45049 43643 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948529.1 protein_id gnl|my_center|LOCUS_34950 45654 45118 gene locus_tag LOCUS_34960 45654 45118 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_34960 45875 46750 gene locus_tag LOCUS_34970 gene dapA 45875 46750 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_34970 46948 48105 gene locus_tag LOCUS_34980 gene bamC 46948 48105 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524737.1 protein_id gnl|my_center|LOCUS_34980 48133 48894 gene locus_tag LOCUS_34990 48133 48894 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_34990 48898 49335 gene locus_tag LOCUS_35000 48898 49335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071246.1 protein_id gnl|my_center|LOCUS_35000 50047 53955 gene locus_tag LOCUS_35010 gene purL 50047 53955 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_35010 53983 54660 gene locus_tag LOCUS_35020 53983 54660 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_35020 54657 54989 gene locus_tag LOCUS_35030 54657 54989 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658306.1 protein_id gnl|my_center|LOCUS_35030 55731 55291 gene locus_tag LOCUS_35040 55731 55291 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_35040 56250 58391 gene locus_tag LOCUS_35050 56250 58391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 58404 59012 gene locus_tag LOCUS_35060 58404 59012 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_35060 59280 59681 gene locus_tag LOCUS_35070 gene soxX 59280 59681 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_35070 59744 60571 gene locus_tag LOCUS_35080 gene soxA 59744 60571 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_35080 60621 60953 gene locus_tag LOCUS_35090 60621 60953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 60981 61652 gene locus_tag LOCUS_35100 60981 61652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 61694 62164 gene locus_tag LOCUS_35110 gene soxY 61694 62164 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_35110 62225 62533 gene locus_tag LOCUS_35120 gene soxZ 62225 62533 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_35120 62692 64470 gene locus_tag LOCUS_35130 gene soxB 62692 64470 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_35130 64513 64704 gene locus_tag LOCUS_35140 64513 64704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 64743 65645 gene locus_tag LOCUS_35150 64743 65645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 66506 65652 gene locus_tag LOCUS_35160 gene folD 66506 65652 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071914.1 protein_id gnl|my_center|LOCUS_35160 66670 66746 gene locus_tag LOCUS_t00440 66670 66746 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 66760 66836 gene locus_tag LOCUS_t00450 66760 66836 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66855 66930 gene locus_tag LOCUS_t00460 66855 66930 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 66937 67012 gene locus_tag LOCUS_t00470 66937 67012 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 67101 68147 gene locus_tag LOCUS_35170 67101 68147 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_35170 69373 68393 gene locus_tag LOCUS_35180 69373 68393 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226858412.1 protein_id gnl|my_center|LOCUS_35180 69456 69665 gene locus_tag LOCUS_35190 69456 69665 CDS product Plasmid-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039729.1 protein_id gnl|my_center|LOCUS_35190 70084 70548 gene locus_tag LOCUS_35200 70084 70548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 70766 71131 gene locus_tag LOCUS_35210 70766 71131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 71160 71561 gene locus_tag LOCUS_35220 71160 71561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 71888 72262 gene locus_tag LOCUS_35230 gene traJ 71888 72262 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 protein_id gnl|my_center|LOCUS_35230 72585 73355 gene locus_tag LOCUS_35240 gene trbJ 72585 73355 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 protein_id gnl|my_center|LOCUS_35240 73698 75146 gene locus_tag LOCUS_35250 gene trbL 73698 75146 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001405816.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35250 75128 75424 gene locus_tag LOCUS_35260 75128 75424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35260 75492 75740 gene locus_tag LOCUS_35270 75492 75740 CDS product type I toxin-antitoxin system ptaRNA1 family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039740.1 protein_id gnl|my_center|LOCUS_35270 76286 75966 gene locus_tag LOCUS_35280 76286 75966 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_35280 76606 76274 gene locus_tag LOCUS_35290 76606 76274 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 protein_id gnl|my_center|LOCUS_35290 77118 76840 gene locus_tag LOCUS_35300 77118 76840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 77400 77218 gene locus_tag LOCUS_35310 77400 77218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 77697 77464 gene locus_tag LOCUS_35320 77697 77464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 78020 79267 gene locus_tag LOCUS_35330 78020 79267 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_35330 79416 79613 gene locus_tag LOCUS_35340 79416 79613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 79684 80763 gene locus_tag LOCUS_35350 gene dcm 79684 80763 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_35350 80811 81695 gene locus_tag LOCUS_35360 80811 81695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 81695 82120 gene locus_tag LOCUS_35370 gene vsr 81695 82120 CDS product DNA mismatch endonuclease Vsr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_35370 82852 82241 gene locus_tag LOCUS_35380 82852 82241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 84156 83587 gene locus_tag LOCUS_35390 84156 83587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 84733 84245 gene locus_tag LOCUS_35400 84733 84245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 86028 86936 gene locus_tag LOCUS_35410 86028 86936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 86979 87296 gene locus_tag LOCUS_35420 86979 87296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 88386 87787 gene locus_tag LOCUS_35430 88386 87787 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 protein_id gnl|my_center|LOCUS_35430 88556 90634 gene locus_tag LOCUS_35440 88556 90634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 91562 91284 gene locus_tag LOCUS_35450 91562 91284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 92185 91565 gene locus_tag LOCUS_35460 92185 91565 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731337.1 protein_id gnl|my_center|LOCUS_35460 93283 92300 gene locus_tag LOCUS_35470 93283 92300 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_35470 96735 93280 gene locus_tag LOCUS_35480 96735 93280 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 protein_id gnl|my_center|LOCUS_35480 97591 96950 gene locus_tag LOCUS_35490 97591 96950 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_35490 98565 97636 gene locus_tag LOCUS_35500 98565 97636 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 protein_id gnl|my_center|LOCUS_35500 99173 98562 gene locus_tag LOCUS_35510 99173 98562 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_35510 100500 99166 gene locus_tag LOCUS_35520 100500 99166 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209766.1 protein_id gnl|my_center|LOCUS_35520 102290 100503 gene locus_tag LOCUS_35530 102290 100503 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_35530 102617 104107 gene locus_tag LOCUS_35540 102617 104107 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044917.1 protein_id gnl|my_center|LOCUS_35540 105607 104126 gene locus_tag LOCUS_35550 105607 104126 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044930.1 protein_id gnl|my_center|LOCUS_35550 106214 105849 gene locus_tag LOCUS_35560 106214 105849 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_35560 106358 107239 gene locus_tag LOCUS_35570 106358 107239 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_35570 107373 107981 gene locus_tag LOCUS_35580 gene slmA 107373 107981 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_35580 107978 109129 gene locus_tag LOCUS_35590 gene mdtA 107978 109129 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678979.1 protein_id gnl|my_center|LOCUS_35590 109126 110328 gene locus_tag LOCUS_35600 109126 110328 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_35600 110330 111040 gene locus_tag LOCUS_35610 110330 111040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_35610 111292 111735 gene locus_tag LOCUS_35620 111292 111735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 113021 111948 gene locus_tag LOCUS_35630 gene modC 113021 111948 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_35630 113705 113031 gene locus_tag LOCUS_35640 gene modB 113705 113031 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_35640 114000 113740 gene locus_tag LOCUS_35650 114000 113740 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_35650 114988 114293 gene locus_tag LOCUS_35660 114988 114293 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 protein_id gnl|my_center|LOCUS_35660 115631 114981 gene locus_tag LOCUS_35670 gene rsxG 115631 114981 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_35670 116725 115631 gene locus_tag LOCUS_35680 116725 115631 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_35680 118254 116722 gene locus_tag LOCUS_35690 gene rsxC 118254 116722 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_35690 118786 118256 gene locus_tag LOCUS_35700 gene rsxB 118786 118256 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_35700 119377 118799 gene locus_tag LOCUS_35710 gene rsxA 119377 118799 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169884.1 protein_id gnl|my_center|LOCUS_35710 119760 121421 gene locus_tag LOCUS_35720 119760 121421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 121426 122988 gene locus_tag LOCUS_35730 121426 122988 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176720.1 protein_id gnl|my_center|LOCUS_35730 123499 123239 gene locus_tag LOCUS_35740 123499 123239 CDS product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_35740 123962 123504 gene locus_tag LOCUS_35750 123962 123504 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_35750 124128 125240 gene locus_tag LOCUS_35760 124128 125240 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197970.1 protein_id gnl|my_center|LOCUS_35760 125240 126289 gene locus_tag LOCUS_35770 125240 126289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 126530 127390 gene locus_tag LOCUS_35780 126530 127390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 127871 127503 gene locus_tag LOCUS_35790 127871 127503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 128513 128247 gene locus_tag LOCUS_35800 128513 128247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 128743 129669 gene locus_tag LOCUS_35810 128743 129669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975756.1 protein_id gnl|my_center|LOCUS_35810 129666 130427 gene locus_tag LOCUS_35820 129666 130427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055336.1 protein_id gnl|my_center|LOCUS_35820 130637 131653 gene locus_tag LOCUS_35830 130637 131653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 131659 132534 gene locus_tag LOCUS_35840 131659 132534 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810439.1 protein_id gnl|my_center|LOCUS_35840 133647 132958 gene locus_tag LOCUS_35850 gene soxX 133647 132958 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228667.1 protein_id gnl|my_center|LOCUS_35850 134511 133675 gene locus_tag LOCUS_35860 gene soxA 134511 133675 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence090 3875 1104 gene locus_tag LOCUS_35870 3875 1104 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_35870 4091 3954 gene locus_tag LOCUS_35880 4091 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 6029 4314 gene locus_tag LOCUS_35890 6029 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 7917 6298 gene locus_tag LOCUS_35900 7917 6298 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 protein_id gnl|my_center|LOCUS_35900 8782 8201 gene locus_tag LOCUS_35910 8782 8201 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389795.1 protein_id gnl|my_center|LOCUS_35910 9144 10235 gene locus_tag LOCUS_35920 9144 10235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_35920 10295 11362 gene locus_tag LOCUS_35930 10295 11362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_35930 11437 12726 gene locus_tag LOCUS_35940 11437 12726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480621.1 protein_id gnl|my_center|LOCUS_35940 12740 13591 gene locus_tag LOCUS_35950 12740 13591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_35950 13702 15159 gene locus_tag LOCUS_35960 gene gabD 13702 15159 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_35960 15377 16654 gene locus_tag LOCUS_35970 gene gabT 15377 16654 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence091 712 1896 gene locus_tag LOCUS_35980 712 1896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_35980 1903 3066 gene locus_tag LOCUS_35990 1903 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_35990 3107 3394 gene locus_tag LOCUS_36000 3107 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3883 5028 gene locus_tag LOCUS_36010 3883 5028 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_36010 6294 5611 gene locus_tag LOCUS_36020 6294 5611 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 protein_id gnl|my_center|LOCUS_36020 7940 6291 gene locus_tag LOCUS_36030 7940 6291 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706287.1 protein_id gnl|my_center|LOCUS_36030 8197 9174 gene locus_tag LOCUS_36040 8197 9174 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 protein_id gnl|my_center|LOCUS_36040 9171 9617 gene locus_tag LOCUS_36050 9171 9617 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446144.1 protein_id gnl|my_center|LOCUS_36050 9617 11143 gene locus_tag LOCUS_36060 9617 11143 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_36060 11327 11641 gene locus_tag LOCUS_36070 11327 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 13338 12178 gene locus_tag LOCUS_36080 13338 12178 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_36080 16094 13374 gene locus_tag LOCUS_36090 16094 13374 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_36090 17038 16097 gene locus_tag LOCUS_36100 17038 16097 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706409.1 protein_id gnl|my_center|LOCUS_36100 >Feature sequence092 336 76 gene locus_tag LOCUS_36110 336 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 619 338 gene locus_tag LOCUS_36120 619 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 923 762 gene locus_tag LOCUS_36130 923 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 2071 1694 gene locus_tag LOCUS_36140 2071 1694 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967717.1 protein_id gnl|my_center|LOCUS_36140 2460 2146 gene locus_tag LOCUS_36150 2460 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 2633 2445 gene locus_tag LOCUS_36160 2633 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3405 2950 gene locus_tag LOCUS_36170 3405 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 4446 3511 gene locus_tag LOCUS_36180 4446 3511 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_36180 4345 4536 gene locus_tag LOCUS_36190 4345 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 5614 4802 gene locus_tag LOCUS_36200 5614 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 6623 5781 gene locus_tag LOCUS_36210 6623 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 6804 8411 gene locus_tag LOCUS_36220 6804 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 9144 8431 gene locus_tag LOCUS_36230 9144 8431 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390385.1 protein_id gnl|my_center|LOCUS_36230 9842 9342 gene locus_tag LOCUS_36240 9842 9342 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813001.1 protein_id gnl|my_center|LOCUS_36240 9726 9935 gene locus_tag LOCUS_36250 9726 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 10525 12318 gene locus_tag LOCUS_36260 10525 12318 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_36260 12594 13517 gene locus_tag LOCUS_36270 gene ylqF 12594 13517 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_36270 13684 14880 gene locus_tag LOCUS_36280 gene nhaA 13684 14880 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166980.1 protein_id gnl|my_center|LOCUS_36280 16154 15180 gene locus_tag LOCUS_36290 16154 15180 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015931585.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence093 28 1491 gene locus_tag LOCUS_36300 28 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 1478 3874 gene locus_tag LOCUS_36310 1478 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3871 4833 gene locus_tag LOCUS_36320 3871 4833 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_36320 5805 4903 gene locus_tag LOCUS_36330 5805 4903 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338856.1 protein_id gnl|my_center|LOCUS_36330 6053 8233 gene locus_tag LOCUS_36340 6053 8233 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338854.1 protein_id gnl|my_center|LOCUS_36340 8230 9267 gene locus_tag LOCUS_36350 8230 9267 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_36350 9269 10768 gene locus_tag LOCUS_36360 9269 10768 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338852.1 protein_id gnl|my_center|LOCUS_36360 10823 12094 gene locus_tag LOCUS_36370 10823 12094 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 protein_id gnl|my_center|LOCUS_36370 13084 12290 gene locus_tag LOCUS_36380 13084 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 13547 14896 gene locus_tag LOCUS_36390 13547 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence094 2065 20 gene locus_tag LOCUS_36400 gene fusA 2065 20 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_36400 2642 2172 gene locus_tag LOCUS_36410 gene rpsG 2642 2172 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_36410 3050 2676 gene locus_tag LOCUS_36420 gene rpsL 3050 2676 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_36420 3280 3489 gene locus_tag LOCUS_36430 3280 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 7750 3530 gene locus_tag LOCUS_36440 gene rpoC 7750 3530 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_36440 11897 7821 gene locus_tag LOCUS_36450 gene rpoB 11897 7821 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_36450 12590 12213 gene locus_tag LOCUS_36460 gene rplL 12590 12213 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_36460 13194 12667 gene locus_tag LOCUS_36470 gene rplJ 13194 12667 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_36470 14132 13437 gene locus_tag LOCUS_36480 gene rplA 14132 13437 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 protein_id gnl|my_center|LOCUS_36480 14567 14136 gene locus_tag LOCUS_36490 gene rplK 14567 14136 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946069.1 protein_id gnl|my_center|LOCUS_36490 15199 14666 gene locus_tag LOCUS_36500 gene nusG 15199 14666 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_36500 15544 15209 gene locus_tag LOCUS_36510 gene secE 15544 15209 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707705.1 protein_id gnl|my_center|LOCUS_36510 15694 15619 gene locus_tag LOCUS_t00480 15694 15619 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence095 109 912 gene locus_tag LOCUS_36520 109 912 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551489.1 protein_id gnl|my_center|LOCUS_36520 920 1327 gene locus_tag LOCUS_36530 920 1327 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527933.1 protein_id gnl|my_center|LOCUS_36530 1320 1691 gene locus_tag LOCUS_36540 1320 1691 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_36540 2149 1739 gene locus_tag LOCUS_36550 2149 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 2333 3166 gene locus_tag LOCUS_36560 2333 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 3177 6029 gene locus_tag LOCUS_36570 3177 6029 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103041.1 protein_id gnl|my_center|LOCUS_36570 6307 6450 gene locus_tag LOCUS_36580 6307 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 6458 7288 gene locus_tag LOCUS_36590 gene dapF 6458 7288 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_36590 7285 7965 gene locus_tag LOCUS_36600 7285 7965 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_36600 7965 8882 gene locus_tag LOCUS_36610 gene xerC 7965 8882 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_36610 11009 9465 gene locus_tag LOCUS_36620 11009 9465 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_36620 11324 12109 gene locus_tag LOCUS_36630 11324 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 12365 13162 gene locus_tag LOCUS_36640 12365 13162 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_36640 14004 13537 gene locus_tag LOCUS_36650 14004 13537 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_36650 14628 14245 gene locus_tag LOCUS_36660 14628 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 15383 14655 gene locus_tag LOCUS_36670 15383 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence096 892 674 gene locus_tag LOCUS_36680 892 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 977 1210 gene locus_tag LOCUS_36690 977 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2203 1322 gene locus_tag LOCUS_36700 2203 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 3841 2336 gene locus_tag LOCUS_36710 gene glpK 3841 2336 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_36710 4272 6011 gene locus_tag LOCUS_36720 4272 6011 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_36720 6114 6902 gene locus_tag LOCUS_36730 6114 6902 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 protein_id gnl|my_center|LOCUS_36730 6962 8029 gene locus_tag LOCUS_36740 6962 8029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531812.1 protein_id gnl|my_center|LOCUS_36740 8098 9165 gene locus_tag LOCUS_36750 8098 9165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973408.1 protein_id gnl|my_center|LOCUS_36750 9176 10042 gene locus_tag LOCUS_36760 9176 10042 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531810.1 protein_id gnl|my_center|LOCUS_36760 10042 10842 gene locus_tag LOCUS_36770 10042 10842 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970356.1 protein_id gnl|my_center|LOCUS_36770 10859 11140 gene locus_tag LOCUS_36780 10859 11140 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252300.1 protein_id gnl|my_center|LOCUS_36780 11176 12738 gene locus_tag LOCUS_36790 gene glpD 11176 12738 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 protein_id gnl|my_center|LOCUS_36790 14302 12815 gene locus_tag LOCUS_36800 14302 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 14778 14326 gene locus_tag LOCUS_36810 14778 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 <15456 14901 gene locus_tag LOCUS_36820 <15456 14901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968202.1:diaminobutyrate decarboxylase >Feature sequence097 471 2099 gene locus_tag LOCUS_36830 gene nirS 471 2099 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_36830 2210 5035 gene locus_tag LOCUS_36840 2210 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 5214 5564 gene locus_tag LOCUS_36850 5214 5564 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939175.1 protein_id gnl|my_center|LOCUS_36850 5839 6162 gene locus_tag LOCUS_36860 5839 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 6168 7337 gene locus_tag LOCUS_36870 gene nirF 6168 7337 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_36870 7339 7863 gene locus_tag LOCUS_36880 7339 7863 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_36880 7854 8330 gene locus_tag LOCUS_36890 7854 8330 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_36890 8327 8782 gene locus_tag LOCUS_36900 8327 8782 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_36900 8831 9334 gene locus_tag LOCUS_36910 8831 9334 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_36910 9510 10673 gene locus_tag LOCUS_36920 gene nirJ 9510 10673 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_36920 11029 12603 gene locus_tag LOCUS_36930 gene nirN 11029 12603 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_36930 12734 12928 gene locus_tag LOCUS_36940 12734 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 12972 13547 gene locus_tag LOCUS_36950 12972 13547 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868177.1 protein_id gnl|my_center|LOCUS_36950 14645 13809 gene locus_tag LOCUS_36960 14645 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880491.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence098 466 1251 gene locus_tag LOCUS_36970 466 1251 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_36970 2159 1551 gene locus_tag LOCUS_36980 2159 1551 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_36980 5295 2311 gene locus_tag LOCUS_36990 5295 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 5771 8665 gene locus_tag LOCUS_37000 5771 8665 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932183.1 protein_id gnl|my_center|LOCUS_37000 8662 9276 gene locus_tag LOCUS_37010 8662 9276 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932182.1 protein_id gnl|my_center|LOCUS_37010 9280 10242 gene locus_tag LOCUS_37020 gene nrfD 9280 10242 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932181.1 protein_id gnl|my_center|LOCUS_37020 10226 10765 gene locus_tag LOCUS_37030 10226 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 10762 11316 gene locus_tag LOCUS_37040 10762 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 11627 11367 gene locus_tag LOCUS_37050 11627 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 12545 11892 gene locus_tag LOCUS_37060 12545 11892 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_37060 13387 12851 gene locus_tag LOCUS_37070 13387 12851 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_37070 >Feature sequence099 2791 137 gene locus_tag LOCUS_37080 2791 137 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061456.1 protein_id gnl|my_center|LOCUS_37080 4162 3104 gene locus_tag LOCUS_37090 gene hisC 4162 3104 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_37090 4393 4587 gene locus_tag LOCUS_37100 4393 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 4961 6799 gene locus_tag LOCUS_37110 4961 6799 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_37110 7066 7560 gene locus_tag LOCUS_37120 7066 7560 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_37120 7704 7901 gene locus_tag LOCUS_37130 7704 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 8263 9069 gene locus_tag LOCUS_37140 8263 9069 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_37140 9111 11366 gene locus_tag LOCUS_37150 9111 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 11986 11771 gene locus_tag LOCUS_37160 11986 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 12035 12268 gene locus_tag LOCUS_37170 12035 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 12265 12663 gene locus_tag LOCUS_37180 12265 12663 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_37180 13027 12767 gene locus_tag LOCUS_37190 13027 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 13682 13017 gene locus_tag LOCUS_37200 13682 13017 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence100 1250 144 gene locus_tag LOCUS_37210 1250 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 2081 1596 gene locus_tag LOCUS_37220 2081 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 3081 2278 gene locus_tag LOCUS_37230 gene dapB 3081 2278 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_37230 4276 3140 gene locus_tag LOCUS_37240 gene dnaJ 4276 3140 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 protein_id gnl|my_center|LOCUS_37240 6341 4395 gene locus_tag LOCUS_37250 gene dnaK 6341 4395 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_37250 7039 6434 gene locus_tag LOCUS_37260 gene grpE 7039 6434 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071703.1 protein_id gnl|my_center|LOCUS_37260 8238 7174 gene locus_tag LOCUS_37270 gene hrcA 8238 7174 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_37270 8649 9530 gene locus_tag LOCUS_37280 8649 9530 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_37280 9537 11207 gene locus_tag LOCUS_37290 gene recN 9537 11207 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_37290 11670 11239 gene locus_tag LOCUS_37300 gene fur 11670 11239 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_37300 11767 12258 gene locus_tag LOCUS_37310 11767 12258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 12619 12305 gene locus_tag LOCUS_37320 12619 12305 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705345.1 protein_id gnl|my_center|LOCUS_37320 13046 12609 gene locus_tag LOCUS_37330 13046 12609 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_37330 14420 13047 gene locus_tag LOCUS_37340 14420 13047 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 protein_id gnl|my_center|LOCUS_37340 14589 15071 gene locus_tag LOCUS_37350 gene smpB 14589 15071 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036652.1 protein_id gnl|my_center|LOCUS_37350 15172 15548 gene locus_tag LOCUS_tm00010 15172 15548 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 15860 16480 gene locus_tag LOCUS_37360 15860 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 16473 16793 gene locus_tag LOCUS_37370 16473 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 16936 18387 gene locus_tag LOCUS_37380 16936 18387 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_37380 18390 19040 gene locus_tag LOCUS_37390 18390 19040 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37390 19037 22399 gene locus_tag LOCUS_37400 19037 22399 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_37400 22396 23580 gene locus_tag LOCUS_37410 22396 23580 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_37410 24088 24297 gene locus_tag LOCUS_37420 24088 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 24297 27416 gene locus_tag LOCUS_37430 24297 27416 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_37430 27410 29044 gene locus_tag LOCUS_37440 27410 29044 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_37440 29394 30341 gene locus_tag LOCUS_37450 29394 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 30370 30813 gene locus_tag LOCUS_37460 30370 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_37460 30810 31580 gene locus_tag LOCUS_37470 30810 31580 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_37470 31826 31587 gene locus_tag LOCUS_37480 31826 31587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 31852 32985 gene locus_tag LOCUS_37490 31852 32985 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_37490 33553 34560 gene locus_tag LOCUS_37500 33553 34560 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272230.1 protein_id gnl|my_center|LOCUS_37500 34627 35697 gene locus_tag LOCUS_37510 34627 35697 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_37510 35851 36183 gene locus_tag LOCUS_37520 35851 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022115.1 protein_id gnl|my_center|LOCUS_37520 36192 36743 gene locus_tag LOCUS_37530 36192 36743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 36724 39126 gene locus_tag LOCUS_37540 36724 39126 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_37540 39516 40487 gene locus_tag LOCUS_37550 39516 40487 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_37550 40804 41274 gene locus_tag LOCUS_37560 40804 41274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37560 41278 41583 gene locus_tag LOCUS_37570 41278 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37570 41584 41841 gene locus_tag LOCUS_37580 41584 41841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37580 41858 42700 gene locus_tag LOCUS_37590 41858 42700 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_37590 44189 43029 gene locus_tag LOCUS_37600 44189 43029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 44348 46474 gene locus_tag LOCUS_37610 44348 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 46490 48700 gene locus_tag LOCUS_37620 46490 48700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 48832 49671 gene locus_tag LOCUS_37630 48832 49671 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_37630 51851 49830 gene locus_tag LOCUS_37640 51851 49830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 52204 53250 gene locus_tag LOCUS_37650 52204 53250 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_37650 53274 54509 gene locus_tag LOCUS_37660 53274 54509 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_37660 54532 55704 gene locus_tag LOCUS_37670 54532 55704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 56100 56462 gene locus_tag LOCUS_37680 56100 56462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 57046 56729 gene locus_tag LOCUS_37690 57046 56729 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314681.1 protein_id gnl|my_center|LOCUS_37690 57294 57641 gene locus_tag LOCUS_37700 57294 57641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 58398 57625 gene locus_tag LOCUS_37710 58398 57625 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 protein_id gnl|my_center|LOCUS_37710 60326 58395 gene locus_tag LOCUS_37720 60326 58395 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_37720 60456 61130 gene locus_tag LOCUS_37730 60456 61130 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947023.1 protein_id gnl|my_center|LOCUS_37730 61123 62484 gene locus_tag LOCUS_37740 61123 62484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_37740 64470 62521 gene locus_tag LOCUS_37750 gene mcpN 64470 62521 CDS product nitrate chemoreceptor McpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114783.1 protein_id gnl|my_center|LOCUS_37750 64860 65105 gene locus_tag LOCUS_37760 64860 65105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 66050 65412 gene locus_tag LOCUS_37770 66050 65412 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236662.1 protein_id gnl|my_center|LOCUS_37770 67231 66515 gene locus_tag LOCUS_37780 67231 66515 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_37780 68041 67262 gene locus_tag LOCUS_37790 68041 67262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_37790 69045 68038 gene locus_tag LOCUS_37800 69045 68038 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_37800 69866 69042 gene locus_tag LOCUS_37810 69866 69042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_37810 72040 70205 gene locus_tag LOCUS_37820 gene btuB 72040 70205 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_37820 73396 72539 gene locus_tag LOCUS_37830 73396 72539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 75009 73618 gene locus_tag LOCUS_37840 gene pabB 75009 73618 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705927.1 protein_id gnl|my_center|LOCUS_37840 75507 75431 gene locus_tag LOCUS_t00490 75507 75431 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 75932 75573 gene locus_tag LOCUS_37850 75932 75573 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_37850 76212 75913 gene locus_tag LOCUS_37860 gene ihfA 76212 75913 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_37860 78595 76217 gene locus_tag LOCUS_37870 gene pheT 78595 76217 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 protein_id gnl|my_center|LOCUS_37870 79725 78694 gene locus_tag LOCUS_37880 gene pheS 79725 78694 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_37880 80218 79859 gene locus_tag LOCUS_37890 gene rplT 80218 79859 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138366.1 protein_id gnl|my_center|LOCUS_37890 80437 80240 gene locus_tag LOCUS_37900 gene rpmI 80437 80240 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_37900 81212 80721 gene locus_tag LOCUS_37910 gene infC 81212 80721 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 protein_id gnl|my_center|LOCUS_37910 83400 81490 gene locus_tag LOCUS_37920 gene thrS 83400 81490 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_37920 83783 83707 gene locus_tag LOCUS_t00500 83783 83707 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 83965 85122 gene locus_tag LOCUS_37930 83965 85122 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 protein_id gnl|my_center|LOCUS_37930 85119 85805 gene locus_tag LOCUS_37940 85119 85805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_37940 85805 87010 gene locus_tag LOCUS_37950 85805 87010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_37950 87012 88211 gene locus_tag LOCUS_37960 87012 88211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_37960 88281 89051 gene locus_tag LOCUS_37970 88281 89051 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136374357.1 protein_id gnl|my_center|LOCUS_37970 91293 89287 gene locus_tag LOCUS_37980 gene uvrB 91293 89287 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 protein_id gnl|my_center|LOCUS_37980 91417 91974 gene locus_tag LOCUS_37990 91417 91974 CDS product GspH/FimT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207590.1 protein_id gnl|my_center|LOCUS_37990 92095 92170 gene locus_tag LOCUS_t00510 92095 92170 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 93557 92316 gene locus_tag LOCUS_38000 93557 92316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 94260 95480 gene locus_tag LOCUS_38010 94260 95480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 95793 97781 gene locus_tag LOCUS_38020 95793 97781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 98934 97951 gene locus_tag LOCUS_38030 98934 97951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 99193 98975 gene locus_tag LOCUS_38040 99193 98975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 99623 99204 gene locus_tag LOCUS_38050 99623 99204 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_38050 100592 100014 gene locus_tag LOCUS_38060 100592 100014 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_38060 101781 100597 gene locus_tag LOCUS_38070 101781 100597 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_38070 102799 102329 gene locus_tag LOCUS_38080 gene msrB 102799 102329 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792822.1 protein_id gnl|my_center|LOCUS_38080 103458 104618 gene locus_tag LOCUS_38090 gene phaZ 103458 104618 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391103.1 protein_id gnl|my_center|LOCUS_38090 105260 108712 gene locus_tag LOCUS_38100 105260 108712 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268160.1 protein_id gnl|my_center|LOCUS_38100 108744 109793 gene locus_tag LOCUS_38110 108744 109793 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_38110 110112 110915 gene locus_tag LOCUS_38120 110112 110915 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_38120 110963 112135 gene locus_tag LOCUS_38130 110963 112135 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_38130 112901 112419 gene locus_tag LOCUS_38140 112901 112419 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_38140 112963 113769 gene locus_tag LOCUS_38150 112963 113769 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815907.1 protein_id gnl|my_center|LOCUS_38150 114012 114087 gene locus_tag LOCUS_t00520 114012 114087 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 115246 114386 gene locus_tag LOCUS_38160 115246 114386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 115836 115366 gene locus_tag LOCUS_38170 115836 115366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 117078 116023 gene locus_tag LOCUS_38180 117078 116023 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_38180 118731 117190 gene locus_tag LOCUS_38190 118731 117190 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_38190 120660 119278 gene locus_tag LOCUS_38200 gene thrC 120660 119278 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_38200 120988 122433 gene locus_tag LOCUS_38210 120988 122433 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 protein_id gnl|my_center|LOCUS_38210 123383 122727 gene locus_tag LOCUS_38220 123383 122727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 123721 124353 gene locus_tag LOCUS_38230 123721 124353 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_38230 126736 124601 gene locus_tag LOCUS_38240 126736 124601 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_38240 126987 127259 gene locus_tag LOCUS_38250 126987 127259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 127544 128173 gene locus_tag LOCUS_38260 127544 128173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 128163 128642 gene locus_tag LOCUS_38270 128163 128642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 128642 129430 gene locus_tag LOCUS_38280 128642 129430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 129575 129832 gene locus_tag LOCUS_38290 129575 129832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 130226 130504 gene locus_tag LOCUS_38300 130226 130504 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_38300 130515 130829 gene locus_tag LOCUS_38310 130515 130829 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_38310 131019 131348 gene locus_tag LOCUS_38320 131019 131348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 132128 131694 gene locus_tag LOCUS_38330 132128 131694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 >Feature sequence101 412 1575 gene locus_tag LOCUS_38340 412 1575 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_38340 1960 3144 gene locus_tag LOCUS_38350 1960 3144 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339111.1 protein_id gnl|my_center|LOCUS_38350 3584 4720 gene locus_tag LOCUS_38360 3584 4720 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_38360 4724 5326 gene locus_tag LOCUS_38370 4724 5326 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337073.1 protein_id gnl|my_center|LOCUS_38370 5326 6933 gene locus_tag LOCUS_38380 5326 6933 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_38380 6952 7767 gene locus_tag LOCUS_38390 6952 7767 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_38390 7767 9758 gene locus_tag LOCUS_38400 7767 9758 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973075.1 protein_id gnl|my_center|LOCUS_38400 10451 11353 gene locus_tag LOCUS_38410 10451 11353 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_38410 11594 12181 gene locus_tag LOCUS_38420 11594 12181 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_38420 12634 12858 gene locus_tag LOCUS_38430 12634 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence102 396 241 gene locus_tag LOCUS_38440 396 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 911 498 gene locus_tag LOCUS_38450 911 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_38450 1725 1021 gene locus_tag LOCUS_38460 1725 1021 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_38460 2152 2340 gene locus_tag LOCUS_38470 2152 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 3629 2280 gene locus_tag LOCUS_38480 3629 2280 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_38480 3877 5772 gene locus_tag LOCUS_38490 3877 5772 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_38490 6146 7534 gene locus_tag LOCUS_38500 gene dbpA 6146 7534 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_38500 7659 7853 gene locus_tag LOCUS_38510 7659 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 7829 8101 gene locus_tag LOCUS_38520 7829 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 8271 9029 gene locus_tag LOCUS_38530 8271 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 9034 9489 gene locus_tag LOCUS_38540 gene aprB 9034 9489 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_38540 9494 11338 gene locus_tag LOCUS_38550 gene aprA 9494 11338 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_38550 12294 11587 gene locus_tag LOCUS_38560 12294 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence103 98 724 gene locus_tag LOCUS_38570 gene cysC 98 724 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124345.1 protein_id gnl|my_center|LOCUS_38570 944 2098 gene locus_tag LOCUS_38580 944 2098 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_38580 3586 2312 gene locus_tag LOCUS_38590 3586 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 5166 3589 gene locus_tag LOCUS_38600 5166 3589 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_38600 5340 6932 gene locus_tag LOCUS_38610 5340 6932 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_38610 6929 8164 gene locus_tag LOCUS_38620 6929 8164 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_38620 8180 9268 gene locus_tag LOCUS_38630 8180 9268 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_38630 10012 9782 gene locus_tag LOCUS_38640 10012 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 10515 10955 gene locus_tag LOCUS_38650 10515 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 >Feature sequence104 717 106 gene locus_tag LOCUS_38660 gene thrH 717 106 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_38660 912 1310 gene locus_tag LOCUS_38670 912 1310 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389066.1 protein_id gnl|my_center|LOCUS_38670 1388 2512 gene locus_tag LOCUS_38680 1388 2512 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_38680 2512 4836 gene locus_tag LOCUS_38690 2512 4836 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_38690 4841 6622 gene locus_tag LOCUS_38700 4841 6622 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_38700 6659 7189 gene locus_tag LOCUS_38710 6659 7189 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626149.1 protein_id gnl|my_center|LOCUS_38710 7396 8193 gene locus_tag LOCUS_38720 gene paaG 7396 8193 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence105 780 151 gene locus_tag LOCUS_38730 780 151 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552516.1 protein_id gnl|my_center|LOCUS_38730 2037 817 gene locus_tag LOCUS_38740 2037 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 protein_id gnl|my_center|LOCUS_38740 2311 5169 gene locus_tag LOCUS_38750 2311 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 5373 5942 gene locus_tag LOCUS_38760 5373 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 6844 6239 gene locus_tag LOCUS_38770 6844 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence106 338 1066 gene locus_tag LOCUS_38780 338 1066 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 protein_id gnl|my_center|LOCUS_38780 1063 2085 gene locus_tag LOCUS_38790 gene nrfD 1063 2085 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809141.1 protein_id gnl|my_center|LOCUS_38790 2114 5197 gene locus_tag LOCUS_38800 2114 5197 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457967.1 protein_id gnl|my_center|LOCUS_38800 5625 5272 gene locus_tag LOCUS_38810 5625 5272 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 protein_id gnl|my_center|LOCUS_38810 6428 5856 gene locus_tag LOCUS_38820 6428 5856 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_38820 >Feature sequence107 994 209 gene locus_tag LOCUS_38830 994 209 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_38830 2216 1407 gene locus_tag LOCUS_38840 2216 1407 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_38840 5746 2483 gene locus_tag LOCUS_38850 5746 2483 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_38850 6187 6624 gene locus_tag LOCUS_38860 6187 6624 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705940.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence108 1043 375 gene locus_tag LOCUS_38870 1043 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 1881 1528 gene locus_tag LOCUS_38880 1881 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 2036 3049 gene locus_tag LOCUS_38890 gene hemB 2036 3049 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260930.1 protein_id gnl|my_center|LOCUS_38890 3304 4152 gene locus_tag LOCUS_38900 gene aroE 3304 4152 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_38900 4535 4197 gene locus_tag LOCUS_38910 4535 4197 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173118.1 protein_id gnl|my_center|LOCUS_38910 5386 4850 gene locus_tag LOCUS_38920 5386 4850 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_38920 >Feature sequence109 24 911 gene locus_tag LOCUS_38930 24 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464929.1 protein_id gnl|my_center|LOCUS_38930 1055 1585 gene locus_tag LOCUS_38940 1055 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_38940 1763 2515 gene locus_tag LOCUS_38950 1763 2515 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478741.1 protein_id gnl|my_center|LOCUS_38950 2601 3137 gene locus_tag LOCUS_38960 2601 3137 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 protein_id gnl|my_center|LOCUS_38960 3887 3201 gene locus_tag LOCUS_38970 3887 3201 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_38970 4411 4259 gene locus_tag LOCUS_38980 4411 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4537 5082 gene locus_tag LOCUS_38990 4537 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence110 869 249 gene locus_tag LOCUS_39000 869 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 1634 879 gene locus_tag LOCUS_39010 1634 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 3660 1843 gene locus_tag LOCUS_39020 3660 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 5081 3678 gene locus_tag LOCUS_39030 5081 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence111 481 756 gene locus_tag LOCUS_39040 481 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 749 1279 gene locus_tag LOCUS_39050 749 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_39050 3300 1423 gene locus_tag LOCUS_39060 3300 1423 CDS product cobalt chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387960.1 protein_id gnl|my_center|LOCUS_39060 4317 3310 gene locus_tag LOCUS_39070 gene cobS 4317 3310 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 protein_id gnl|my_center|LOCUS_39070 6201 4441 gene locus_tag LOCUS_39080 6201 4441 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_39080 7348 6185 gene locus_tag LOCUS_39090 7348 6185 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_39090 8017 7748 gene locus_tag LOCUS_39100 8017 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 8372 8905 gene locus_tag LOCUS_39110 8372 8905 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_39110 8966 9541 gene locus_tag LOCUS_39120 8966 9541 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_39120 9820 10392 gene locus_tag LOCUS_39130 9820 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 10403 10855 gene locus_tag LOCUS_39140 10403 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 11543 11196 gene locus_tag LOCUS_39150 11543 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 11779 12444 gene locus_tag LOCUS_39160 11779 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_39160 12568 13308 gene locus_tag LOCUS_39170 12568 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 13523 14617 gene locus_tag LOCUS_39180 13523 14617 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401285.1 protein_id gnl|my_center|LOCUS_39180 14614 15366 gene locus_tag LOCUS_39190 14614 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170101.1 protein_id gnl|my_center|LOCUS_39190 15363 16598 gene locus_tag LOCUS_39200 15363 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 17005 17166 gene locus_tag LOCUS_39210 17005 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 17212 18177 gene locus_tag LOCUS_39220 gene arsS 17212 18177 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121078.1 protein_id gnl|my_center|LOCUS_39220 18347 18913 gene locus_tag LOCUS_39230 18347 18913 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_39230 19163 21571 gene locus_tag LOCUS_39240 19163 21571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 21842 22207 gene locus_tag LOCUS_39250 21842 22207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 22188 23084 gene locus_tag LOCUS_39260 22188 23084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 23118 23663 gene locus_tag LOCUS_39270 23118 23663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 23808 24815 gene locus_tag LOCUS_39280 23808 24815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 24922 25410 gene locus_tag LOCUS_39290 24922 25410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 25443 26336 gene locus_tag LOCUS_39300 25443 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 26448 26828 gene locus_tag LOCUS_39310 26448 26828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 27166 28872 gene locus_tag LOCUS_39320 27166 28872 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_39320 28869 30572 gene locus_tag LOCUS_39330 28869 30572 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_39330 30589 32037 gene locus_tag LOCUS_39340 30589 32037 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_39340 32490 32167 gene locus_tag LOCUS_39350 32490 32167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 32619 33809 gene locus_tag LOCUS_39360 32619 33809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 33811 34005 gene locus_tag LOCUS_39370 33811 34005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 34670 34212 gene locus_tag LOCUS_39380 34670 34212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 34889 35482 gene locus_tag LOCUS_39390 34889 35482 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194486.1 protein_id gnl|my_center|LOCUS_39390 36733 35882 gene locus_tag LOCUS_39400 36733 35882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 38124 36733 gene locus_tag LOCUS_39410 38124 36733 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_39410 38564 38250 gene locus_tag LOCUS_39420 38564 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 39424 38984 gene locus_tag LOCUS_39430 39424 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 39924 40157 gene locus_tag LOCUS_39440 39924 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 40666 40253 gene locus_tag LOCUS_39450 gene zntR 40666 40253 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 protein_id gnl|my_center|LOCUS_39450 41247 40975 gene locus_tag LOCUS_39460 41247 40975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 42256 41279 gene locus_tag LOCUS_39470 42256 41279 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_39470 42543 42253 gene locus_tag LOCUS_39480 42543 42253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 43753 42920 gene locus_tag LOCUS_39490 43753 42920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 44124 44405 gene locus_tag LOCUS_39500 44124 44405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 45053 45427 gene locus_tag LOCUS_39510 45053 45427 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_39510 45431 45781 gene locus_tag LOCUS_39520 gene merP 45431 45781 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732292.1 protein_id gnl|my_center|LOCUS_39520 45880 47448 gene locus_tag LOCUS_39530 gene merA 45880 47448 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136268.1 protein_id gnl|my_center|LOCUS_39530 47456 47827 gene locus_tag LOCUS_39540 47456 47827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 48997 47963 gene locus_tag LOCUS_39550 48997 47963 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_39550 49236 48994 gene locus_tag LOCUS_39560 49236 48994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 49472 49741 gene locus_tag LOCUS_39570 49472 49741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 51064 50282 gene locus_tag LOCUS_39580 51064 50282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 52709 51342 gene locus_tag LOCUS_39590 52709 51342 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_39590 54987 52702 gene locus_tag LOCUS_39600 54987 52702 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943129.1 protein_id gnl|my_center|LOCUS_39600 58216 55523 gene locus_tag LOCUS_39610 58216 55523 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_39610 58803 58219 gene locus_tag LOCUS_39620 58803 58219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 60008 58803 gene locus_tag LOCUS_39630 60008 58803 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_39630 61130 60024 gene locus_tag LOCUS_39640 61130 60024 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_39640 61990 62436 gene locus_tag LOCUS_39650 gene merR 61990 62436 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_39650 63489 63962 gene locus_tag LOCUS_39660 63489 63962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 63959 64582 gene locus_tag LOCUS_39670 63959 64582 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 protein_id gnl|my_center|LOCUS_39670 64575 66221 gene locus_tag LOCUS_39680 64575 66221 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766330.1 protein_id gnl|my_center|LOCUS_39680 66218 66820 gene locus_tag LOCUS_39690 66218 66820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 67832 67092 gene locus_tag LOCUS_39700 67832 67092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 70702 68009 gene locus_tag LOCUS_39710 70702 68009 CDS product arsenate reductase (azurin) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257094.1 protein_id gnl|my_center|LOCUS_39710 71289 70705 gene locus_tag LOCUS_39720 71289 70705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 72425 71289 gene locus_tag LOCUS_39730 72425 71289 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_39730 73649 72543 gene locus_tag LOCUS_39740 73649 72543 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_39740 74940 74305 gene locus_tag LOCUS_39750 74940 74305 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_39750 77831 75399 gene locus_tag LOCUS_39760 77831 75399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 78664 77828 gene locus_tag LOCUS_39770 78664 77828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 80514 78661 gene locus_tag LOCUS_39780 80514 78661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 81415 83955 gene locus_tag LOCUS_39790 81415 83955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 83988 84731 gene locus_tag LOCUS_39800 83988 84731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 84871 87207 gene locus_tag LOCUS_39810 84871 87207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 87465 89588 gene locus_tag LOCUS_39820 87465 89588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 89597 91021 gene locus_tag LOCUS_39830 gene hemG 89597 91021 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_39830 91247 91579 gene locus_tag LOCUS_39840 91247 91579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 91570 94173 gene locus_tag LOCUS_39850 91570 94173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39850 94170 95555 gene locus_tag LOCUS_39860 94170 95555 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_39860 95697 96077 gene locus_tag LOCUS_39870 95697 96077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 96300 96151 gene locus_tag LOCUS_39880 96300 96151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 96672 98069 gene locus_tag LOCUS_39890 gene sthA 96672 98069 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_39890 99140 98298 gene locus_tag LOCUS_39900 99140 98298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 99923 100366 gene locus_tag LOCUS_39910 99923 100366 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_39910 100388 101446 gene locus_tag LOCUS_39920 100388 101446 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_39920 101728 102138 gene locus_tag LOCUS_39930 101728 102138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 102757 102152 gene locus_tag LOCUS_39940 102757 102152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 102947 103798 gene locus_tag LOCUS_39950 gene hdfR 102947 103798 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_39950 104252 104064 gene locus_tag LOCUS_39960 104252 104064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 104625 104440 gene locus_tag LOCUS_39970 104625 104440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 106112 104790 gene locus_tag LOCUS_39980 gene yegQ 106112 104790 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 protein_id gnl|my_center|LOCUS_39980 106666 109092 gene locus_tag LOCUS_39990 106666 109092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 109127 110656 gene locus_tag LOCUS_40000 109127 110656 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_40000 112704 110860 gene locus_tag LOCUS_40010 112704 110860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 113099 112737 gene locus_tag LOCUS_40020 113099 112737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 114501 113302 gene locus_tag LOCUS_40030 114501 113302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 114937 115191 gene locus_tag LOCUS_40040 114937 115191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 115131 115625 gene locus_tag LOCUS_40050 115131 115625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 115754 116629 gene locus_tag LOCUS_40060 115754 116629 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 protein_id gnl|my_center|LOCUS_40060 116746 117687 gene locus_tag LOCUS_40070 116746 117687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 118238 117699 gene locus_tag LOCUS_40080 118238 117699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 119727 118747 gene locus_tag LOCUS_40090 119727 118747 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_40090 121088 120363 gene locus_tag LOCUS_40100 121088 120363 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_40100 124009 121085 gene locus_tag LOCUS_40110 124009 121085 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_40110 124946 124503 gene locus_tag LOCUS_40120 124946 124503 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065668.1 protein_id gnl|my_center|LOCUS_40120 125187 126953 gene locus_tag LOCUS_40130 125187 126953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence112 118 1302 gene locus_tag LOCUS_40140 118 1302 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_40140 1332 2255 gene locus_tag LOCUS_40150 gene argF 1332 2255 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_40150 2498 2289 gene locus_tag LOCUS_40160 2498 2289 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930433.1 protein_id gnl|my_center|LOCUS_40160 2879 3829 gene locus_tag LOCUS_40170 2879 3829 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_40170 3836 4216 gene locus_tag LOCUS_40180 3836 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence113 35 1240 gene locus_tag LOCUS_40190 gene pcaF 35 1240 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522007.1 protein_id gnl|my_center|LOCUS_40190 1428 3491 gene locus_tag LOCUS_40200 1428 3491 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792925.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence114 1007 45 gene locus_tag LOCUS_40210 1007 45 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406942.1 protein_id gnl|my_center|LOCUS_40210 1911 1054 gene locus_tag LOCUS_40220 1911 1054 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_40220 2871 2002 gene locus_tag LOCUS_40230 2871 2002 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530117.1 protein_id gnl|my_center|LOCUS_40230 >Feature sequence115 2212 1856 gene locus_tag LOCUS_40240 2212 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence116 1044 529 gene locus_tag LOCUS_40250 1044 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40250 1340 1041 gene locus_tag LOCUS_40260 1340 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40260 >Feature sequence117 1395 295 gene locus_tag LOCUS_40270 1395 295 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118134.1 protein_id gnl|my_center|LOCUS_40270 2299 1559 gene locus_tag LOCUS_40280 2299 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40280 >Feature sequence118 372 55 gene locus_tag LOCUS_40290 372 55 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_40290 617 360 gene locus_tag LOCUS_40300 617 360 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861987.1 protein_id gnl|my_center|LOCUS_40300 1156 950 gene locus_tag LOCUS_40310 1156 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 1878 1144 gene locus_tag LOCUS_40320 1878 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 >Feature sequence119 327 121 gene locus_tag LOCUS_40330 327 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 1180 347 gene locus_tag LOCUS_40340 1180 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 <2411 1177 gene locus_tag LOCUS_40350 <2411 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917061.1:DDE-type integrase/transposase/recombinase >Feature sequence120 1992 1627 gene locus_tag LOCUS_40360 gene tnpB 1992 1627 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_40360 2309 1989 gene locus_tag LOCUS_40370 2309 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 >Feature sequence121 >Feature sequence122 133 561 gene locus_tag LOCUS_40380 133 561 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_40380 867 1352 gene locus_tag LOCUS_40390 867 1352 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_40390 1433 1834 gene locus_tag LOCUS_40400 1433 1834 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929671.1 protein_id gnl|my_center|LOCUS_40400 1899 2357 gene locus_tag LOCUS_40410 1899 2357 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_40410 2451 3104 gene locus_tag LOCUS_40420 2451 3104 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967700.1 protein_id gnl|my_center|LOCUS_40420 3282 4478 gene locus_tag LOCUS_40430 3282 4478 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 protein_id gnl|my_center|LOCUS_40430 4834 4484 gene locus_tag LOCUS_40440 4834 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 5883 5278 gene locus_tag LOCUS_40450 5883 5278 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 protein_id gnl|my_center|LOCUS_40450 6265 6900 gene locus_tag LOCUS_40460 gene ccmA 6265 6900 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420299.1 protein_id gnl|my_center|LOCUS_40460 6893 7561 gene locus_tag LOCUS_40470 gene ccmB 6893 7561 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_40470 8020 8712 gene locus_tag LOCUS_40480 gene ccmC 8020 8712 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_40480 8709 8882 gene locus_tag LOCUS_40490 8709 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 8879 9328 gene locus_tag LOCUS_40500 gene ccmE 8879 9328 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_40500 9325 11313 gene locus_tag LOCUS_40510 9325 11313 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_40510 11310 11843 gene locus_tag LOCUS_40520 gene dsbE 11310 11843 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_40520 11840 12313 gene locus_tag LOCUS_40530 11840 12313 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457737.1 protein_id gnl|my_center|LOCUS_40530 12310 13548 gene locus_tag LOCUS_40540 gene ccmI 12310 13548 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_40540 14394 13861 gene locus_tag LOCUS_40550 14394 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 14872 16566 gene locus_tag LOCUS_40560 14872 16566 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268314.1 protein_id gnl|my_center|LOCUS_40560 16935 18275 gene locus_tag LOCUS_40570 16935 18275 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389294.1 protein_id gnl|my_center|LOCUS_40570 18577 20784 gene locus_tag LOCUS_40580 18577 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 21805 21089 gene locus_tag LOCUS_40590 gene rph 21805 21089 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_40590 22683 21802 gene locus_tag LOCUS_40600 22683 21802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 23657 22680 gene locus_tag LOCUS_40610 23657 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 23803 24669 gene locus_tag LOCUS_40620 23803 24669 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621340.1 protein_id gnl|my_center|LOCUS_40620 24774 25388 gene locus_tag LOCUS_40630 gene gmk 24774 25388 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_40630 25707 25988 gene locus_tag LOCUS_40640 gene rpoZ 25707 25988 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_40640 26084 28249 gene locus_tag LOCUS_40650 gene spoT 26084 28249 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_40650 28271 28663 gene locus_tag LOCUS_40660 28271 28663 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_40660 29096 28680 gene locus_tag LOCUS_40670 29096 28680 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_40670 29675 29361 gene locus_tag LOCUS_40680 29675 29361 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 protein_id gnl|my_center|LOCUS_40680 29888 31960 gene locus_tag LOCUS_40690 gene recG 29888 31960 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 protein_id gnl|my_center|LOCUS_40690 32315 32812 gene locus_tag LOCUS_40700 32315 32812 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_40700 32809 33714 gene locus_tag LOCUS_40710 gene ubiA 32809 33714 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772835.1 protein_id gnl|my_center|LOCUS_40710 35016 33769 gene locus_tag LOCUS_40720 gene dsrA 35016 33769 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_40720 36009 35632 gene locus_tag LOCUS_40730 36009 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 36667 36200 gene locus_tag LOCUS_40740 gene phaR 36667 36200 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037439.1 protein_id gnl|my_center|LOCUS_40740 38073 36883 gene locus_tag LOCUS_40750 38073 36883 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_40750 38255 39166 gene locus_tag LOCUS_40760 38255 39166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 39168 40277 gene locus_tag LOCUS_40770 39168 40277 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_40770 41174 40296 gene locus_tag LOCUS_40780 gene hisG 41174 40296 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_40780 41650 41408 gene locus_tag LOCUS_40790 41650 41408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 42496 41804 gene locus_tag LOCUS_40800 42496 41804 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_40800 42624 43649 gene locus_tag LOCUS_40810 gene bioB 42624 43649 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_40810 43718 44881 gene locus_tag LOCUS_40820 gene bioF 43718 44881 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_40820 44878 45654 gene locus_tag LOCUS_40830 gene bioH 44878 45654 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260983.1 protein_id gnl|my_center|LOCUS_40830 45647 46549 gene locus_tag LOCUS_40840 gene bioC 45647 46549 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_40840 46556 47233 gene locus_tag LOCUS_40850 gene bioD 46556 47233 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_40850 47276 47878 gene locus_tag LOCUS_40860 47276 47878 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_40860 47875 48333 gene locus_tag LOCUS_40870 47875 48333 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047671.1 protein_id gnl|my_center|LOCUS_40870 48532 49608 gene locus_tag LOCUS_40880 48532 49608 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382491.1 protein_id gnl|my_center|LOCUS_40880 51717 50380 gene locus_tag LOCUS_40890 51717 50380 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_40890 52474 51878 gene locus_tag LOCUS_40900 52474 51878 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389730.1 protein_id gnl|my_center|LOCUS_40900 54404 52521 gene locus_tag LOCUS_40910 54404 52521 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389731.1 protein_id gnl|my_center|LOCUS_40910 55918 54617 gene locus_tag LOCUS_40920 55918 54617 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_40920 56617 56156 gene locus_tag LOCUS_40930 56617 56156 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_40930 58048 56837 gene locus_tag LOCUS_40940 gene pcaF 58048 56837 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_40940 59608 58091 gene locus_tag LOCUS_40950 59608 58091 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_40950 60404 59613 gene locus_tag LOCUS_40960 gene paaG 60404 59613 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_40960 61195 60416 gene locus_tag LOCUS_40970 61195 60416 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292350.1 protein_id gnl|my_center|LOCUS_40970 61548 63569 gene locus_tag LOCUS_40980 gene paaZ 61548 63569 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_40980 63779 64804 gene locus_tag LOCUS_40990 63779 64804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_40990 64988 66031 gene locus_tag LOCUS_41000 64988 66031 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817846.1 protein_id gnl|my_center|LOCUS_41000 67219 66272 gene locus_tag LOCUS_41010 gene paaX 67219 66272 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612287.1 protein_id gnl|my_center|LOCUS_41010 67477 67280 gene locus_tag LOCUS_41020 67477 67280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 68421 67762 gene locus_tag LOCUS_41030 68421 67762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 69264 68542 gene locus_tag LOCUS_41040 69264 68542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_41040 70027 69254 gene locus_tag LOCUS_41050 70027 69254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_41050 71057 70014 gene locus_tag LOCUS_41060 71057 70014 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_41060 71941 71060 gene locus_tag LOCUS_41070 71941 71060 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_41070 73264 72116 gene locus_tag LOCUS_41080 73264 72116 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 protein_id gnl|my_center|LOCUS_41080 74639 73791 gene locus_tag LOCUS_41090 gene rpoH 74639 73791 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013101924.1 protein_id gnl|my_center|LOCUS_41090 76050 75079 gene locus_tag LOCUS_41100 gene ftsX 76050 75079 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_41100 76727 76050 gene locus_tag LOCUS_41110 gene ftsE 76727 76050 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_41110 77755 76748 gene locus_tag LOCUS_41120 77755 76748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 77969 79348 gene locus_tag LOCUS_41130 77969 79348 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_41130 79527 80828 gene locus_tag LOCUS_41140 79527 80828 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_41140 80834 81430 gene locus_tag LOCUS_41150 gene rsmD 80834 81430 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 protein_id gnl|my_center|LOCUS_41150 81770 82249 gene locus_tag LOCUS_41160 gene coaD 81770 82249 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_41160 82294 82539 gene locus_tag LOCUS_41170 82294 82539 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_41170 83550 82696 gene locus_tag LOCUS_41180 83550 82696 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_41180 85282 83552 gene locus_tag LOCUS_41190 85282 83552 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_41190 85613 86464 gene locus_tag LOCUS_41200 85613 86464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 86477 88900 gene locus_tag LOCUS_41210 86477 88900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 89794 88916 gene locus_tag LOCUS_41220 89794 88916 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_41220 90306 91457 gene locus_tag LOCUS_41230 90306 91457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 91595 91936 gene locus_tag LOCUS_41240 91595 91936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 92062 92655 gene locus_tag LOCUS_41250 92062 92655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 92780 93136 gene locus_tag LOCUS_41260 92780 93136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 93282 94175 gene locus_tag LOCUS_41270 93282 94175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 95662 94235 gene locus_tag LOCUS_41280 95662 94235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 96336 95659 gene locus_tag LOCUS_41290 96336 95659 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_41290 96675 97067 gene locus_tag LOCUS_41300 96675 97067 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815302.1 protein_id gnl|my_center|LOCUS_41300 97214 98533 gene locus_tag LOCUS_41310 97214 98533 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_41310 98604 100043 gene locus_tag LOCUS_41320 98604 100043 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_41320 100045 103185 gene locus_tag LOCUS_41330 100045 103185 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_41330 103266 104510 gene locus_tag LOCUS_41340 103266 104510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 104993 104628 gene locus_tag LOCUS_41350 104993 104628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 105453 106850 gene locus_tag LOCUS_41360 105453 106850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 107207 108682 gene locus_tag LOCUS_41370 107207 108682 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_41370 108684 109478 gene locus_tag LOCUS_41380 108684 109478 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216798.1 protein_id gnl|my_center|LOCUS_41380 110080 111165 gene locus_tag LOCUS_41390 gene coxB 110080 111165 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_41390 111176 112771 gene locus_tag LOCUS_41400 gene ctaD 111176 112771 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_41400 112940 113452 gene locus_tag LOCUS_41410 112940 113452 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_41410 113521 114369 gene locus_tag LOCUS_41420 113521 114369 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_41420 114477 115169 gene locus_tag LOCUS_41430 114477 115169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_41430 115242 115727 gene locus_tag LOCUS_41440 115242 115727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 116073 116846 gene locus_tag LOCUS_41450 gene fpr 116073 116846 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_41450 117353 117027 gene locus_tag LOCUS_41460 117353 117027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 118076 117606 gene locus_tag LOCUS_41470 118076 117606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 118610 119641 gene locus_tag LOCUS_41480 118610 119641 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213256.1 protein_id gnl|my_center|LOCUS_41480 120685 119711 gene locus_tag LOCUS_41490 120685 119711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 122211 120934 gene locus_tag LOCUS_41500 122211 120934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 123106 122219 gene locus_tag LOCUS_41510 123106 122219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 124514 123267 gene locus_tag LOCUS_41520 124514 123267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064352.1 protein_id gnl|my_center|LOCUS_41520 125221 124691 gene locus_tag LOCUS_41530 125221 124691 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence123 >Feature sequence124 747 2009 gene locus_tag LOCUS_41540 gene ltrA 747 2009 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_41540 >Feature sequence125 1514 123 gene locus_tag LOCUS_41550 gene norB 1514 123 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_41550 >Feature sequence126 563 330 gene locus_tag LOCUS_41560 563 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 875 1201 gene locus_tag LOCUS_41570 875 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 >Feature sequence127 897 649 gene locus_tag LOCUS_41580 897 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 1286 912 gene locus_tag LOCUS_41590 1286 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence128 31 783 gene locus_tag LOCUS_41600 31 783 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066753.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence129 106 1449 gene locus_tag LOCUS_41610 106 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 >Feature sequence130 1547 204 gene locus_tag LOCUS_41620 1547 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence131 762 1502 gene locus_tag LOCUS_41630 762 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 >Feature sequence132 793 641 gene locus_tag LOCUS_41640 793 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1462 1025 gene locus_tag LOCUS_41650 1462 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650