>Feature sequence1 212 598 gene locus_tag LOCUS_00010 212 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 582 965 gene locus_tag LOCUS_00020 582 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1009 1482 gene locus_tag LOCUS_00030 1009 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1466 2077 gene locus_tag LOCUS_00040 1466 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2104 2925 gene locus_tag LOCUS_00050 2104 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2915 3952 gene locus_tag LOCUS_00060 2915 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3952 11904 gene locus_tag LOCUS_00070 3952 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12335 11919 gene locus_tag LOCUS_00080 12335 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693479.1 protein_id gnl|my_center|LOCUS_00080 12826 12332 gene locus_tag LOCUS_00090 12826 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13499 13056 gene locus_tag LOCUS_00100 13499 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13858 13517 gene locus_tag LOCUS_00110 13858 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14482 14706 gene locus_tag LOCUS_00120 14482 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15418 16323 gene locus_tag LOCUS_00130 15418 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17252 17875 gene locus_tag LOCUS_00140 17252 17875 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_00140 18024 18623 gene locus_tag LOCUS_00150 gene pth 18024 18623 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693775.1 protein_id gnl|my_center|LOCUS_00150 19751 18750 gene locus_tag LOCUS_00160 19751 18750 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_00160 20406 21404 gene locus_tag LOCUS_00170 20406 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21657 21463 gene locus_tag LOCUS_00180 21657 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22267 22572 gene locus_tag LOCUS_00190 22267 22572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22562 23101 gene locus_tag LOCUS_00200 22562 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00200 23839 25059 gene locus_tag LOCUS_00210 gene ltrA 23839 25059 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_00210 25636 25130 gene locus_tag LOCUS_00220 25636 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25993 27084 gene locus_tag LOCUS_00230 gene ychF 25993 27084 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099270.1 protein_id gnl|my_center|LOCUS_00230 27451 27149 gene locus_tag LOCUS_00240 27451 27149 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_00240 28014 27796 gene locus_tag LOCUS_00250 28014 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28169 28245 gene locus_tag LOCUS_t00010 28169 28245 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28324 28398 gene locus_tag LOCUS_t00020 28324 28398 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 28522 28598 gene locus_tag LOCUS_t00030 28522 28598 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28623 28697 gene locus_tag LOCUS_t00040 28623 28697 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29522 30748 gene locus_tag LOCUS_00260 gene ltrA 29522 30748 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_00260 31609 30998 gene locus_tag LOCUS_00270 31609 30998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31779 32558 gene locus_tag LOCUS_00280 31779 32558 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815907.1 protein_id gnl|my_center|LOCUS_00280 32583 34046 gene locus_tag LOCUS_00290 gene cls 32583 34046 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 protein_id gnl|my_center|LOCUS_00290 35099 34041 gene locus_tag LOCUS_00300 35099 34041 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703563.1 protein_id gnl|my_center|LOCUS_00300 38170 35111 gene locus_tag LOCUS_00310 38170 35111 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141271555.1 protein_id gnl|my_center|LOCUS_00310 39291 38173 gene locus_tag LOCUS_00320 39291 38173 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815494.1 protein_id gnl|my_center|LOCUS_00320 40107 39397 gene locus_tag LOCUS_00330 40107 39397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40756 41991 gene locus_tag LOCUS_00340 gene gmtY 40756 41991 CDS product gamma-mobile-trio recombinase GmtY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477115.1 protein_id gnl|my_center|LOCUS_00340 42021 44666 gene locus_tag LOCUS_00350 42021 44666 CDS product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 protein_id gnl|my_center|LOCUS_00350 44653 45339 gene locus_tag LOCUS_00360 gene gmtX 44653 45339 CDS product gamma-mobile-trio protein GmtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477284.1 protein_id gnl|my_center|LOCUS_00360 45406 45894 gene locus_tag LOCUS_00370 45406 45894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47282 48097 gene locus_tag LOCUS_00380 47282 48097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 51322 48260 gene locus_tag LOCUS_00390 51322 48260 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141271555.1 protein_id gnl|my_center|LOCUS_00390 52443 51325 gene locus_tag LOCUS_00400 52443 51325 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815494.1 protein_id gnl|my_center|LOCUS_00400 52655 53146 gene locus_tag LOCUS_00410 52655 53146 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384583.1 protein_id gnl|my_center|LOCUS_00410 53150 53971 gene locus_tag LOCUS_00420 53150 53971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853567.1 protein_id gnl|my_center|LOCUS_00420 54783 54019 gene locus_tag LOCUS_00430 54783 54019 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_00430 55369 54809 gene locus_tag LOCUS_00440 55369 54809 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_00440 56619 55366 gene locus_tag LOCUS_00450 56619 55366 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_00450 57464 56619 gene locus_tag LOCUS_00460 57464 56619 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_00460 58855 57461 gene locus_tag LOCUS_00470 58855 57461 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_00470 59295 59867 gene locus_tag LOCUS_00480 59295 59867 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103394.1 protein_id gnl|my_center|LOCUS_00480 59878 60522 gene locus_tag LOCUS_00490 gene chrR 59878 60522 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_00490 61548 60613 gene locus_tag LOCUS_00500 61548 60613 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512742.1 protein_id gnl|my_center|LOCUS_00500 62730 62990 gene locus_tag LOCUS_00510 62730 62990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63864 63115 gene locus_tag LOCUS_00520 63864 63115 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_00520 63989 64405 gene locus_tag LOCUS_00530 63989 64405 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929291.1 protein_id gnl|my_center|LOCUS_00530 64534 66060 gene locus_tag LOCUS_00540 64534 66060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66097 66648 gene locus_tag LOCUS_00550 66097 66648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 66951 67523 gene locus_tag LOCUS_00560 66951 67523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67562 68080 gene locus_tag LOCUS_00570 gene tssB 67562 68080 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 protein_id gnl|my_center|LOCUS_00570 68077 69579 gene locus_tag LOCUS_00580 gene tssC 68077 69579 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_00580 69591 70955 gene locus_tag LOCUS_00590 gene tssC 69591 70955 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705459.1 protein_id gnl|my_center|LOCUS_00590 70952 71386 gene locus_tag LOCUS_00600 70952 71386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 71379 73169 gene locus_tag LOCUS_00610 gene tssF 71379 73169 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527836.1 protein_id gnl|my_center|LOCUS_00610 73133 74179 gene locus_tag LOCUS_00620 73133 74179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 74179 76779 gene locus_tag LOCUS_00630 gene tssH 74179 76779 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269330.1 protein_id gnl|my_center|LOCUS_00630 76934 79090 gene locus_tag LOCUS_00640 76934 79090 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_00640 79163 79741 gene locus_tag LOCUS_00650 79163 79741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 79744 80040 gene locus_tag LOCUS_00660 79744 80040 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_00660 80163 80843 gene locus_tag LOCUS_00670 80163 80843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 84292 80867 gene locus_tag LOCUS_00680 gene tssM 84292 80867 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_00680 85260 84289 gene locus_tag LOCUS_00690 85260 84289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 86612 85275 gene locus_tag LOCUS_00700 gene tssK 86612 85275 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212105.1 protein_id gnl|my_center|LOCUS_00700 87135 86662 gene locus_tag LOCUS_00710 87135 86662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 88252 87122 gene locus_tag LOCUS_00720 88252 87122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 89158 88493 gene locus_tag LOCUS_00730 89158 88493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89381 92560 gene locus_tag LOCUS_00740 89381 92560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 94045 92660 gene locus_tag LOCUS_00750 gene pntB 94045 92660 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461042.1 protein_id gnl|my_center|LOCUS_00750 95589 94060 gene locus_tag LOCUS_00760 gene pntA 95589 94060 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 protein_id gnl|my_center|LOCUS_00760 96559 95624 gene locus_tag LOCUS_00770 gene arcC 96559 95624 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083065.1 protein_id gnl|my_center|LOCUS_00770 98131 96812 gene locus_tag LOCUS_00780 gene guaD 98131 96812 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 protein_id gnl|my_center|LOCUS_00780 101149 98231 gene locus_tag LOCUS_00790 101149 98231 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 protein_id gnl|my_center|LOCUS_00790 101952 101152 gene locus_tag LOCUS_00800 gene ygfM 101952 101152 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572441.1 protein_id gnl|my_center|LOCUS_00800 103365 102025 gene locus_tag LOCUS_00810 103365 102025 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_00810 104763 103438 gene locus_tag LOCUS_00820 gene ssnA 104763 103438 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 protein_id gnl|my_center|LOCUS_00820 107917 104807 gene locus_tag LOCUS_00830 gene ygfK 107917 104807 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502427.1 protein_id gnl|my_center|LOCUS_00830 108890 108360 gene locus_tag LOCUS_00840 gene mocA 108890 108360 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817484.1 protein_id gnl|my_center|LOCUS_00840 109002 109874 gene locus_tag LOCUS_00850 109002 109874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 109864 111477 gene locus_tag LOCUS_00860 gene yqeB 109864 111477 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706024.1 protein_id gnl|my_center|LOCUS_00860 113457 111688 gene locus_tag LOCUS_00870 113457 111688 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366900.1 protein_id gnl|my_center|LOCUS_00870 114694 113702 gene locus_tag LOCUS_00880 114694 113702 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_00880 115367 114876 gene locus_tag LOCUS_00890 gene xdhC 115367 114876 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706036.1 protein_id gnl|my_center|LOCUS_00890 116260 115364 gene locus_tag LOCUS_00900 gene xdhB 116260 115364 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459159.1 protein_id gnl|my_center|LOCUS_00900 118561 116261 gene locus_tag LOCUS_00910 gene xdhA 118561 116261 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388180.1 protein_id gnl|my_center|LOCUS_00910 120009 118564 gene locus_tag LOCUS_00920 gene hydA 120009 118564 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047948.1 protein_id gnl|my_center|LOCUS_00920 120187 120420 gene locus_tag LOCUS_00930 120187 120420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 121710 120487 gene locus_tag LOCUS_00940 121710 120487 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301172.1 protein_id gnl|my_center|LOCUS_00940 122946 121753 gene locus_tag LOCUS_00950 gene dpaL 122946 121753 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706020.1 protein_id gnl|my_center|LOCUS_00950 124293 123103 gene locus_tag LOCUS_00960 gene ygeW 124293 123103 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859787.1 protein_id gnl|my_center|LOCUS_00960 124903 126225 gene locus_tag LOCUS_00970 124903 126225 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 protein_id gnl|my_center|LOCUS_00970 126734 126450 gene locus_tag LOCUS_00980 126734 126450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 129342 128284 gene locus_tag LOCUS_00990 129342 128284 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829391.1 protein_id gnl|my_center|LOCUS_00990 130177 129908 gene locus_tag LOCUS_01000 130177 129908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 130470 130790 gene locus_tag LOCUS_01010 130470 130790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 132247 130751 gene locus_tag LOCUS_01020 132247 130751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 132368 133135 gene locus_tag LOCUS_01030 132368 133135 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_01030 134098 135183 gene locus_tag LOCUS_01040 134098 135183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 136705 135278 gene locus_tag LOCUS_01050 136705 135278 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_01050 137120 137782 gene locus_tag LOCUS_01060 137120 137782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 138133 137876 gene locus_tag LOCUS_01070 138133 137876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 139425 138205 gene locus_tag LOCUS_01080 139425 138205 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_01080 140364 139558 gene locus_tag LOCUS_01090 140364 139558 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_01090 141298 140498 gene locus_tag LOCUS_01100 gene rsmA 141298 140498 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_01100 141978 141637 gene locus_tag LOCUS_01110 141978 141637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 143046 142018 gene locus_tag LOCUS_01120 gene pdxA 143046 142018 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_01120 144399 143089 gene locus_tag LOCUS_01130 144399 143089 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_01130 147227 144399 gene locus_tag LOCUS_01140 gene lptD 147227 144399 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_01140 147534 148727 gene locus_tag LOCUS_01150 147534 148727 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_01150 148724 149416 gene locus_tag LOCUS_01160 148724 149416 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_01160 149438 150259 gene locus_tag LOCUS_01170 gene djlA 149438 150259 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_01170 150375 150584 gene locus_tag LOCUS_01180 150375 150584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 150786 151880 gene locus_tag LOCUS_01190 150786 151880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 151867 151998 gene locus_tag LOCUS_01200 151867 151998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 152796 152011 gene locus_tag LOCUS_01210 152796 152011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_01210 153994 152879 gene locus_tag LOCUS_01220 gene zapE 153994 152879 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_01220 154271 154798 gene locus_tag LOCUS_01230 154271 154798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 155808 154846 gene locus_tag LOCUS_01240 gene trxB 155808 154846 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_01240 156110 156367 gene locus_tag LOCUS_01250 156110 156367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 156419 157621 gene locus_tag LOCUS_01260 156419 157621 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_01260 157817 158560 gene locus_tag LOCUS_01270 gene cysZ 157817 158560 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_01270 158967 158827 gene locus_tag LOCUS_01280 158967 158827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 159045 159236 gene locus_tag LOCUS_01290 159045 159236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 159371 160399 gene locus_tag LOCUS_01300 159371 160399 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_01300 160451 162580 gene locus_tag LOCUS_01310 160451 162580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 162690 163031 gene locus_tag LOCUS_01320 162690 163031 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_01320 163813 163142 gene locus_tag LOCUS_01330 163813 163142 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328180.1 protein_id gnl|my_center|LOCUS_01330 164325 163915 gene locus_tag LOCUS_01340 164325 163915 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_01340 164624 165286 gene locus_tag LOCUS_01350 164624 165286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 165261 165443 gene locus_tag LOCUS_01360 165261 165443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 165510 166058 gene locus_tag LOCUS_01370 gene sodC 165510 166058 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096917.1 protein_id gnl|my_center|LOCUS_01370 166931 166122 gene locus_tag LOCUS_01380 gene trpC 166931 166122 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_01380 167987 166953 gene locus_tag LOCUS_01390 gene trpD 167987 166953 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_01390 168610 168032 gene locus_tag LOCUS_01400 168610 168032 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_01400 171573 170089 gene locus_tag LOCUS_01410 gene trpE 171573 170089 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_01410 172684 171995 gene locus_tag LOCUS_01420 172684 171995 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402021.1 protein_id gnl|my_center|LOCUS_01420 173404 172727 gene locus_tag LOCUS_01430 gene rpe 173404 172727 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304938.1 protein_id gnl|my_center|LOCUS_01430 173700 173864 gene locus_tag LOCUS_01440 173700 173864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 173900 174289 gene locus_tag LOCUS_01450 173900 174289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 174596 175024 gene locus_tag LOCUS_01460 gene rplM 174596 175024 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336289.1 protein_id gnl|my_center|LOCUS_01460 175037 175429 gene locus_tag LOCUS_01470 gene rpsI 175037 175429 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 protein_id gnl|my_center|LOCUS_01470 176847 177440 gene locus_tag LOCUS_01480 gene petA 176847 177440 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_01480 177437 178672 gene locus_tag LOCUS_01490 177437 178672 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_01490 178672 179430 gene locus_tag LOCUS_01500 178672 179430 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_01500 179607 180170 gene locus_tag LOCUS_01510 179607 180170 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263183.1 protein_id gnl|my_center|LOCUS_01510 180600 180223 gene locus_tag LOCUS_01520 gene ridA 180600 180223 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 protein_id gnl|my_center|LOCUS_01520 181549 180755 gene locus_tag LOCUS_01530 181549 180755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 181851 183692 gene locus_tag LOCUS_01540 181851 183692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 183813 185306 gene locus_tag LOCUS_01550 gene gltX 183813 185306 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_01550 185737 185812 gene locus_tag LOCUS_t00050 185737 185812 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 185865 185940 gene locus_tag LOCUS_t00060 185865 185940 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 186355 186430 gene locus_tag LOCUS_t00070 186355 186430 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 186561 186636 gene locus_tag LOCUS_t00080 186561 186636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 186676 186751 gene locus_tag LOCUS_t00090 186676 186751 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 186956 187031 gene locus_tag LOCUS_t00100 186956 187031 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 187183 187258 gene locus_tag LOCUS_t00110 187183 187258 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 187384 187459 gene locus_tag LOCUS_t00120 187384 187459 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 187539 187614 gene locus_tag LOCUS_t00130 187539 187614 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 187740 187815 gene locus_tag LOCUS_t00140 187740 187815 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 187958 188878 gene locus_tag LOCUS_01560 187958 188878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 189003 189078 gene locus_tag LOCUS_t00150 189003 189078 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 189118 189193 gene locus_tag LOCUS_t00160 189118 189193 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 189239 189314 gene locus_tag LOCUS_t00170 189239 189314 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 190295 189555 gene locus_tag LOCUS_01570 190295 189555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 191749 190844 gene locus_tag LOCUS_01580 gene nagK 191749 190844 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 protein_id gnl|my_center|LOCUS_01580 192950 191886 gene locus_tag LOCUS_01590 gene fba 192950 191886 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_01590 192949 193218 gene locus_tag LOCUS_01600 192949 193218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 193369 194406 gene locus_tag LOCUS_01610 193369 194406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 195324 194467 gene locus_tag LOCUS_01620 195324 194467 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131850.1 protein_id gnl|my_center|LOCUS_01620 196272 197987 gene locus_tag LOCUS_01630 gene ptsI 196272 197987 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706834.1 protein_id gnl|my_center|LOCUS_01630 198182 200803 gene locus_tag LOCUS_01640 gene adhE 198182 200803 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 protein_id gnl|my_center|LOCUS_01640 201485 200901 gene locus_tag LOCUS_01650 201485 200901 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946157.1 protein_id gnl|my_center|LOCUS_01650 201988 203472 gene locus_tag LOCUS_01660 201988 203472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 203488 204273 gene locus_tag LOCUS_01670 203488 204273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348992.1 protein_id gnl|my_center|LOCUS_01670 204286 205818 gene locus_tag LOCUS_01680 204286 205818 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348991.1 protein_id gnl|my_center|LOCUS_01680 206129 205908 gene locus_tag LOCUS_01690 206129 205908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 207389 206187 gene locus_tag LOCUS_01700 207389 206187 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_01700 209846 207441 gene locus_tag LOCUS_01710 gene ygjK 209846 207441 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706903.1 protein_id gnl|my_center|LOCUS_01710 210401 211375 gene locus_tag LOCUS_01720 gene ebgR 210401 211375 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482344.1 protein_id gnl|my_center|LOCUS_01720 211741 214884 gene locus_tag LOCUS_01730 gene lacZ 211741 214884 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_01730 215451 215843 gene locus_tag LOCUS_01740 215451 215843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 217607 216096 gene locus_tag LOCUS_01750 217607 216096 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674097.1 protein_id gnl|my_center|LOCUS_01750 218117 218476 gene locus_tag LOCUS_01760 218117 218476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 220058 218607 gene locus_tag LOCUS_01770 gene ptsG 220058 218607 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367184.1 protein_id gnl|my_center|LOCUS_01770 221429 220302 gene locus_tag LOCUS_01780 221429 220302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_01780 221807 222640 gene locus_tag LOCUS_01790 221807 222640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 222585 223187 gene locus_tag LOCUS_01800 222585 223187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 223385 223642 gene locus_tag LOCUS_01810 gene ptsH 223385 223642 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164859.1 protein_id gnl|my_center|LOCUS_01810 225135 225521 gene locus_tag LOCUS_01820 225135 225521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 225797 227149 gene locus_tag LOCUS_01830 225797 227149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 227903 228160 gene locus_tag LOCUS_01840 gene ptsH 227903 228160 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164859.1 protein_id gnl|my_center|LOCUS_01840 228793 228566 gene locus_tag LOCUS_01850 228793 228566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 228875 229882 gene locus_tag LOCUS_01860 gene gap 228875 229882 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072334.1 protein_id gnl|my_center|LOCUS_01860 230136 231602 gene locus_tag LOCUS_01870 gene pyk 230136 231602 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453949.1 protein_id gnl|my_center|LOCUS_01870 231733 232713 gene locus_tag LOCUS_01880 gene pfkA 231733 232713 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_01880 232868 233374 gene locus_tag LOCUS_01890 gene crr 232868 233374 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303134.1 protein_id gnl|my_center|LOCUS_01890 233563 234381 gene locus_tag LOCUS_01900 233563 234381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 234473 235192 gene locus_tag LOCUS_01910 234473 235192 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_01910 236688 235258 gene locus_tag LOCUS_01920 gene ptsG 236688 235258 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097113.1 protein_id gnl|my_center|LOCUS_01920 237421 238338 gene locus_tag LOCUS_01930 237421 238338 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 protein_id gnl|my_center|LOCUS_01930 238489 239478 gene locus_tag LOCUS_01940 238489 239478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_01940 239482 240264 gene locus_tag LOCUS_01950 239482 240264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 protein_id gnl|my_center|LOCUS_01950 240518 241342 gene locus_tag LOCUS_01960 gene queF 240518 241342 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114774.1 protein_id gnl|my_center|LOCUS_01960 241438 241998 gene locus_tag LOCUS_01970 241438 241998 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_01970 242444 241995 gene locus_tag LOCUS_01980 242444 241995 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 protein_id gnl|my_center|LOCUS_01980 242713 242447 gene locus_tag LOCUS_01990 242713 242447 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_01990 243865 242729 gene locus_tag LOCUS_02000 gene rnd 243865 242729 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267099.1 protein_id gnl|my_center|LOCUS_02000 247625 243987 gene locus_tag LOCUS_02010 247625 243987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 248819 247929 gene locus_tag LOCUS_02020 gene htpX 248819 247929 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_02020 249396 248977 gene locus_tag LOCUS_02030 249396 248977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_02030 250645 249431 gene locus_tag LOCUS_02040 250645 249431 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_02040 250882 251277 gene locus_tag LOCUS_02050 gene msrB 250882 251277 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 protein_id gnl|my_center|LOCUS_02050 251653 251339 gene locus_tag LOCUS_02060 251653 251339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 260875 251765 gene locus_tag LOCUS_02070 260875 251765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 263026 261182 gene locus_tag LOCUS_02080 263026 261182 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_02080 263739 263050 gene locus_tag LOCUS_02090 263739 263050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 264474 263797 gene locus_tag LOCUS_02100 264474 263797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 265002 264553 gene locus_tag LOCUS_02110 265002 264553 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_02110 266798 265005 gene locus_tag LOCUS_02120 266798 265005 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_02120 267464 266844 gene locus_tag LOCUS_02130 267464 266844 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_02130 268883 267468 gene locus_tag LOCUS_02140 268883 267468 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 protein_id gnl|my_center|LOCUS_02140 270237 269212 gene locus_tag LOCUS_02150 gene arcC 270237 269212 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428628.1 protein_id gnl|my_center|LOCUS_02150 271297 270281 gene locus_tag LOCUS_02160 271297 270281 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 protein_id gnl|my_center|LOCUS_02160 272806 272075 gene locus_tag LOCUS_02170 272806 272075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 274282 273029 gene locus_tag LOCUS_02180 274282 273029 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_02180 274877 274368 gene locus_tag LOCUS_02190 274877 274368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 275838 275362 gene locus_tag LOCUS_02200 275838 275362 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_02200 276800 275865 gene locus_tag LOCUS_02210 276800 275865 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_02210 277518 276883 gene locus_tag LOCUS_02220 277518 276883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 277853 279541 gene locus_tag LOCUS_02230 gene fadD1 277853 279541 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_02230 279673 283563 gene locus_tag LOCUS_02240 gene hrpA 279673 283563 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 protein_id gnl|my_center|LOCUS_02240 283679 284005 gene locus_tag LOCUS_02250 283679 284005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 284728 284075 gene locus_tag LOCUS_02260 284728 284075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 284823 285239 gene locus_tag LOCUS_02270 284823 285239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 285328 286734 gene locus_tag LOCUS_02280 285328 286734 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_02280 288275 286818 gene locus_tag LOCUS_02290 gene dtpA 288275 286818 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100913.1 protein_id gnl|my_center|LOCUS_02290 288542 289744 gene locus_tag LOCUS_02300 288542 289744 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071921.1 protein_id gnl|my_center|LOCUS_02300 290559 289846 gene locus_tag LOCUS_02310 290559 289846 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_02310 291268 290552 gene locus_tag LOCUS_02320 gene rsxG 291268 290552 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_02320 292323 291268 gene locus_tag LOCUS_02330 292323 291268 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_02330 294629 292386 gene locus_tag LOCUS_02340 gene rsxC 294629 292386 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112915.1 protein_id gnl|my_center|LOCUS_02340 295231 294626 gene locus_tag LOCUS_02350 gene rsxB 295231 294626 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_02350 295844 295251 gene locus_tag LOCUS_02360 gene rsxA 295844 295251 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_02360 297575 296295 gene locus_tag LOCUS_02370 297575 296295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 298841 298212 gene locus_tag LOCUS_02380 298841 298212 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_02380 298958 299680 gene locus_tag LOCUS_02390 298958 299680 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477212.1 protein_id gnl|my_center|LOCUS_02390 301127 299685 gene locus_tag LOCUS_02400 gene nhaC 301127 299685 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707517.1 protein_id gnl|my_center|LOCUS_02400 302862 301405 gene locus_tag LOCUS_02410 302862 301405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 304574 305158 gene locus_tag LOCUS_02420 304574 305158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 305168 305452 gene locus_tag LOCUS_02430 305168 305452 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192567.1 protein_id gnl|my_center|LOCUS_02430 306293 305523 gene locus_tag LOCUS_02440 gene pstB 306293 305523 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419893.1 protein_id gnl|my_center|LOCUS_02440 307203 306295 gene locus_tag LOCUS_02450 gene pstA 307203 306295 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 protein_id gnl|my_center|LOCUS_02450 308066 307200 gene locus_tag LOCUS_02460 gene pstC 308066 307200 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 protein_id gnl|my_center|LOCUS_02460 309050 308208 gene locus_tag LOCUS_02470 309050 308208 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 protein_id gnl|my_center|LOCUS_02470 309232 309645 gene locus_tag LOCUS_02480 gene arfB 309232 309645 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_02480 309798 310373 gene locus_tag LOCUS_02490 309798 310373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 311595 310417 gene locus_tag LOCUS_02500 311595 310417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 312022 312984 gene locus_tag LOCUS_02510 312022 312984 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262219.1 protein_id gnl|my_center|LOCUS_02510 315802 313022 gene locus_tag LOCUS_02520 315802 313022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 316074 317030 gene locus_tag LOCUS_02530 gene rlmF 316074 317030 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454860.1 protein_id gnl|my_center|LOCUS_02530 317324 318307 gene locus_tag LOCUS_02540 317324 318307 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444473.1 protein_id gnl|my_center|LOCUS_02540 321438 318439 gene locus_tag LOCUS_02550 321438 318439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 322270 322473 gene locus_tag LOCUS_02560 322270 322473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 325048 323537 gene locus_tag LOCUS_02570 325048 323537 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262925.1 protein_id gnl|my_center|LOCUS_02570 326570 325263 gene locus_tag LOCUS_02580 326570 325263 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262925.1 protein_id gnl|my_center|LOCUS_02580 327018 328010 gene locus_tag LOCUS_02590 327018 328010 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_02590 328611 328384 gene locus_tag LOCUS_02600 328611 328384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 329058 329819 gene locus_tag LOCUS_02610 329058 329819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 330602 330258 gene locus_tag LOCUS_02620 330602 330258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 331038 330820 gene locus_tag LOCUS_02630 331038 330820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 332815 331232 gene locus_tag LOCUS_02640 332815 331232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 333450 332815 gene locus_tag LOCUS_02650 333450 332815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188163.1 protein_id gnl|my_center|LOCUS_02650 334831 333434 gene locus_tag LOCUS_02660 334831 333434 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_02660 336048 334831 gene locus_tag LOCUS_02670 336048 334831 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027693.1 protein_id gnl|my_center|LOCUS_02670 336646 336038 gene locus_tag LOCUS_02680 336646 336038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 337905 336775 gene locus_tag LOCUS_02690 337905 336775 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498593.1 protein_id gnl|my_center|LOCUS_02690 339427 337898 gene locus_tag LOCUS_02700 339427 337898 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_02700 339625 339440 gene locus_tag LOCUS_02710 339625 339440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 340280 339687 gene locus_tag LOCUS_02720 340280 339687 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_02720 340936 344277 gene locus_tag LOCUS_02730 340936 344277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 345090 344305 gene locus_tag LOCUS_02740 345090 344305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 345294 345779 gene locus_tag LOCUS_02750 345294 345779 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_02750 346102 346719 gene locus_tag LOCUS_02760 346102 346719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 348997 349380 gene locus_tag LOCUS_02770 348997 349380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 350362 349346 gene locus_tag LOCUS_02780 350362 349346 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480142.1 protein_id gnl|my_center|LOCUS_02780 350669 351235 gene locus_tag LOCUS_02790 350669 351235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 351753 351349 gene locus_tag LOCUS_02800 351753 351349 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099687.1 protein_id gnl|my_center|LOCUS_02800 351996 353267 gene locus_tag LOCUS_02810 351996 353267 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017176.1 protein_id gnl|my_center|LOCUS_02810 354716 353385 gene locus_tag LOCUS_02820 354716 353385 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_02820 355678 354788 gene locus_tag LOCUS_02830 355678 354788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 355830 356192 gene locus_tag LOCUS_02840 355830 356192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 356263 356895 gene locus_tag LOCUS_02850 356263 356895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 359314 357266 gene locus_tag LOCUS_02860 gene metG 359314 357266 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_02860 361461 359461 gene locus_tag LOCUS_02870 361461 359461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 361819 362280 gene locus_tag LOCUS_02880 361819 362280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 362285 362971 gene locus_tag LOCUS_02890 362285 362971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 363652 362996 gene locus_tag LOCUS_02900 363652 362996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 363802 364896 gene locus_tag LOCUS_02910 gene apbC 363802 364896 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268717.1 protein_id gnl|my_center|LOCUS_02910 365486 364893 gene locus_tag LOCUS_02920 365486 364893 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_02920 365940 365515 gene locus_tag LOCUS_02930 365940 365515 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_02930 366159 366647 gene locus_tag LOCUS_02940 366159 366647 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_02940 367252 367869 gene locus_tag LOCUS_02950 367252 367869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 368554 367952 gene locus_tag LOCUS_02960 368554 367952 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_02960 368833 369612 gene locus_tag LOCUS_02970 368833 369612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 369989 369687 gene locus_tag LOCUS_02980 369989 369687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 370857 370021 gene locus_tag LOCUS_02990 gene galU 370857 370021 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467169.1 protein_id gnl|my_center|LOCUS_02990 372292 371636 gene locus_tag LOCUS_03000 372292 371636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 373066 372338 gene locus_tag LOCUS_03010 373066 372338 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_03010 374091 373066 gene locus_tag LOCUS_03020 374091 373066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 375021 374665 gene locus_tag LOCUS_03030 375021 374665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 375310 376710 gene locus_tag LOCUS_03040 375310 376710 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_03040 376918 377277 gene locus_tag LOCUS_03050 gene tnpA 376918 377277 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_03050 378375 377344 gene locus_tag LOCUS_03060 378375 377344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 378665 378459 gene locus_tag LOCUS_03070 378665 378459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 379910 378795 gene locus_tag LOCUS_03080 379910 378795 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532308.1 protein_id gnl|my_center|LOCUS_03080 381233 379959 gene locus_tag LOCUS_03090 381233 379959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 382180 381230 gene locus_tag LOCUS_03100 382180 381230 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679062.1 protein_id gnl|my_center|LOCUS_03100 383242 382184 gene locus_tag LOCUS_03110 383242 382184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 384336 383293 gene locus_tag LOCUS_03120 384336 383293 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994175.1 protein_id gnl|my_center|LOCUS_03120 384562 384993 gene locus_tag LOCUS_03130 gene tnpA 384562 384993 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_03130 386231 385083 gene locus_tag LOCUS_03140 386231 385083 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081194.1 protein_id gnl|my_center|LOCUS_03140 386640 386245 gene locus_tag LOCUS_03150 386640 386245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 387122 386913 gene locus_tag LOCUS_03160 387122 386913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 388326 387349 gene locus_tag LOCUS_03170 388326 387349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 389643 388378 gene locus_tag LOCUS_03180 389643 388378 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_03180 389796 389644 gene locus_tag LOCUS_03190 389796 389644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 390399 389899 gene locus_tag LOCUS_03200 390399 389899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 391103 390399 gene locus_tag LOCUS_03210 391103 390399 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_03210 392748 391306 gene locus_tag LOCUS_03220 392748 391306 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_03220 393846 392758 gene locus_tag LOCUS_03230 393846 392758 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407602.1 protein_id gnl|my_center|LOCUS_03230 394712 393843 gene locus_tag LOCUS_03240 gene rfbA 394712 393843 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_03240 396054 394987 gene locus_tag LOCUS_03250 gene rffG 396054 394987 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_03250 397392 396073 gene locus_tag LOCUS_03260 397392 396073 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_03260 397523 397864 gene locus_tag LOCUS_03270 397523 397864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 398288 398070 gene locus_tag LOCUS_03280 398288 398070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 400613 398427 gene locus_tag LOCUS_03290 gene vpsO 400613 398427 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_03290 401257 400691 gene locus_tag LOCUS_03300 gene vpsN 401257 400691 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_03300 402591 401401 gene locus_tag LOCUS_03310 402591 401401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 403228 402644 gene locus_tag LOCUS_03320 403228 402644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 403937 404857 gene locus_tag LOCUS_03330 403937 404857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 406054 405011 gene locus_tag LOCUS_03340 gene dapD 406054 405011 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_03340 406488 406090 gene locus_tag LOCUS_03350 406488 406090 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156592.1 protein_id gnl|my_center|LOCUS_03350 406648 407631 gene locus_tag LOCUS_03360 406648 407631 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 protein_id gnl|my_center|LOCUS_03360 408141 407644 gene locus_tag LOCUS_03370 408141 407644 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172875.1 protein_id gnl|my_center|LOCUS_03370 408514 409839 gene locus_tag LOCUS_03380 gene nhaD 408514 409839 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_03380 414234 411109 gene locus_tag LOCUS_03390 gene vmeQ 414234 411109 CDS product efflux RND transporter permease subunit VmeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479247.1 protein_id gnl|my_center|LOCUS_03390 415441 414236 gene locus_tag LOCUS_03400 415441 414236 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967877.1 protein_id gnl|my_center|LOCUS_03400 415774 417135 gene locus_tag LOCUS_03410 415774 417135 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_03410 417660 418358 gene locus_tag LOCUS_03420 417660 418358 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262741.1 protein_id gnl|my_center|LOCUS_03420 418399 419793 gene locus_tag LOCUS_03430 418399 419793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356901.1 protein_id gnl|my_center|LOCUS_03430 419760 420467 gene locus_tag LOCUS_03440 gene nfi 419760 420467 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217884.1 protein_id gnl|my_center|LOCUS_03440 420430 421050 gene locus_tag LOCUS_03450 420430 421050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 422292 421108 gene locus_tag LOCUS_03460 422292 421108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 423708 422305 gene locus_tag LOCUS_03470 423708 422305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 424410 423784 gene locus_tag LOCUS_03480 gene lpoB 424410 423784 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851945.1 protein_id gnl|my_center|LOCUS_03480 425834 424425 gene locus_tag LOCUS_03490 425834 424425 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_03490 426386 425988 gene locus_tag LOCUS_03500 426386 425988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 427063 426374 gene locus_tag LOCUS_03510 427063 426374 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_03510 427456 428763 gene locus_tag LOCUS_03520 427456 428763 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_03520 429281 429084 gene locus_tag LOCUS_03530 429281 429084 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_03530 429429 429791 gene locus_tag LOCUS_03540 429429 429791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 429837 430982 gene locus_tag LOCUS_03550 429837 430982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 431626 431018 gene locus_tag LOCUS_03560 431626 431018 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 protein_id gnl|my_center|LOCUS_03560 432288 431728 gene locus_tag LOCUS_03570 432288 431728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 433300 432734 gene locus_tag LOCUS_03580 gene yeiP 433300 432734 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228019.1 protein_id gnl|my_center|LOCUS_03580 433643 433371 gene locus_tag LOCUS_03590 433643 433371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 434292 434104 gene locus_tag LOCUS_03600 434292 434104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 434596 435717 gene locus_tag LOCUS_03610 gene ald 434596 435717 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 protein_id gnl|my_center|LOCUS_03610 435834 436295 gene locus_tag LOCUS_03620 435834 436295 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568142.1 protein_id gnl|my_center|LOCUS_03620 437147 436311 gene locus_tag LOCUS_03630 437147 436311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 437344 437919 gene locus_tag LOCUS_03640 437344 437919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 439954 437951 gene locus_tag LOCUS_03650 439954 437951 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_03650 440263 441876 gene locus_tag LOCUS_03660 440263 441876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 442322 441936 gene locus_tag LOCUS_03670 442322 441936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 442670 442407 gene locus_tag LOCUS_03680 442670 442407 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306857.1 protein_id gnl|my_center|LOCUS_03680 444030 444413 gene locus_tag LOCUS_03690 444030 444413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 445161 446135 gene locus_tag LOCUS_03700 445161 446135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 446227 447534 gene locus_tag LOCUS_03710 446227 447534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112793.1 protein_id gnl|my_center|LOCUS_03710 448194 447589 gene locus_tag LOCUS_03720 448194 447589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 448987 448388 gene locus_tag LOCUS_03730 448987 448388 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704839.1 protein_id gnl|my_center|LOCUS_03730 449651 449010 gene locus_tag LOCUS_03740 449651 449010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 450072 451295 gene locus_tag LOCUS_03750 450072 451295 CDS product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 protein_id gnl|my_center|LOCUS_03750 451581 451796 gene locus_tag LOCUS_03760 451581 451796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 452064 452999 gene locus_tag LOCUS_03770 452064 452999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 453308 453511 gene locus_tag LOCUS_03780 453308 453511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 455018 453636 gene locus_tag LOCUS_03790 455018 453636 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 protein_id gnl|my_center|LOCUS_03790 455779 455210 gene locus_tag LOCUS_03800 455779 455210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 456046 455786 gene locus_tag LOCUS_03810 456046 455786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 456086 456694 gene locus_tag LOCUS_03820 456086 456694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 458125 456875 gene locus_tag LOCUS_03830 gene sstT 458125 456875 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458382.1 protein_id gnl|my_center|LOCUS_03830 460483 458456 gene locus_tag LOCUS_03840 460483 458456 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_03840 461487 460843 gene locus_tag LOCUS_03850 461487 460843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 461787 463376 gene locus_tag LOCUS_03860 461787 463376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 464425 463403 gene locus_tag LOCUS_03870 464425 463403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 465776 464616 gene locus_tag LOCUS_03880 465776 464616 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_03880 466080 467003 gene locus_tag LOCUS_03890 466080 467003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 468180 467053 gene locus_tag LOCUS_03900 gene mnmH 468180 467053 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_03900 470180 468237 gene locus_tag LOCUS_03910 470180 468237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 470615 472537 gene locus_tag LOCUS_03920 gene thrS 470615 472537 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 protein_id gnl|my_center|LOCUS_03920 472615 473184 gene locus_tag LOCUS_03930 gene infC 472615 473184 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_03930 473388 473606 gene locus_tag LOCUS_03940 gene rpmI 473388 473606 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090673.1 protein_id gnl|my_center|LOCUS_03940 473646 474002 gene locus_tag LOCUS_03950 gene rplT 473646 474002 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_03950 474894 474280 gene locus_tag LOCUS_03960 474894 474280 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 protein_id gnl|my_center|LOCUS_03960 476329 475820 gene locus_tag LOCUS_03970 476329 475820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 476759 476355 gene locus_tag LOCUS_03980 476759 476355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 476682 477917 gene locus_tag LOCUS_03990 476682 477917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 479347 478025 gene locus_tag LOCUS_04000 479347 478025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 480055 479477 gene locus_tag LOCUS_04010 gene smrA 480055 479477 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 protein_id gnl|my_center|LOCUS_04010 480191 480445 gene locus_tag LOCUS_04020 480191 480445 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 protein_id gnl|my_center|LOCUS_04020 481634 480510 gene locus_tag LOCUS_04030 gene thiH 481634 480510 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260917.1 protein_id gnl|my_center|LOCUS_04030 482404 481634 gene locus_tag LOCUS_04040 482404 481634 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912209.1 protein_id gnl|my_center|LOCUS_04040 482656 482456 gene locus_tag LOCUS_04050 gene thiS 482656 482456 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166243.1 protein_id gnl|my_center|LOCUS_04050 482780 483055 gene locus_tag LOCUS_04060 482780 483055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 483159 484814 gene locus_tag LOCUS_04070 483159 484814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 484923 485939 gene locus_tag LOCUS_04080 gene pheS 484923 485939 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_04080 486114 488492 gene locus_tag LOCUS_04090 gene pheT 486114 488492 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 protein_id gnl|my_center|LOCUS_04090 489734 488541 gene locus_tag LOCUS_04100 489734 488541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 490252 490563 gene locus_tag LOCUS_04110 gene ihfA 490252 490563 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_04110 490535 490939 gene locus_tag LOCUS_04120 490535 490939 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_04120 491633 491007 gene locus_tag LOCUS_04130 491633 491007 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_04130 491800 493620 gene locus_tag LOCUS_04140 gene recQ 491800 493620 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_04140 494873 493677 gene locus_tag LOCUS_04150 494873 493677 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455363.1 protein_id gnl|my_center|LOCUS_04150 496280 495285 gene locus_tag LOCUS_04160 496280 495285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 496922 496416 gene locus_tag LOCUS_04170 496922 496416 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766637.1 protein_id gnl|my_center|LOCUS_04170 497248 499299 gene locus_tag LOCUS_04180 gene zntA 497248 499299 CDS product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106499.1 protein_id gnl|my_center|LOCUS_04180 500763 499483 gene locus_tag LOCUS_04190 500763 499483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 501004 501198 gene locus_tag LOCUS_04200 501004 501198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 501684 501208 gene locus_tag LOCUS_04210 501684 501208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 502142 501690 gene locus_tag LOCUS_04220 502142 501690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04220 502446 502159 gene locus_tag LOCUS_04230 502446 502159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04230 503265 502522 gene locus_tag LOCUS_04240 503265 502522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 503856 503473 gene locus_tag LOCUS_04250 503856 503473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 504857 506452 gene locus_tag LOCUS_04260 504857 506452 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 protein_id gnl|my_center|LOCUS_04260 507389 506469 gene locus_tag LOCUS_04270 507389 506469 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_04270 507557 508687 gene locus_tag LOCUS_04280 507557 508687 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074449.1 protein_id gnl|my_center|LOCUS_04280 508745 509602 gene locus_tag LOCUS_04290 gene fghA 508745 509602 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074448.1 protein_id gnl|my_center|LOCUS_04290 509733 509978 gene locus_tag LOCUS_04300 509733 509978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 510277 510627 gene locus_tag LOCUS_04310 510277 510627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 511636 513048 gene locus_tag LOCUS_04320 511636 513048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 513687 513076 gene locus_tag LOCUS_04330 513687 513076 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_04330 513932 514759 gene locus_tag LOCUS_04340 513932 514759 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261913.1 protein_id gnl|my_center|LOCUS_04340 514794 515600 gene locus_tag LOCUS_04350 514794 515600 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_04350 515695 516555 gene locus_tag LOCUS_04360 515695 516555 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_04360 517570 516638 gene locus_tag LOCUS_04370 gene ttcA 517570 516638 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477636.1 protein_id gnl|my_center|LOCUS_04370 517979 518314 gene locus_tag LOCUS_04380 517979 518314 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 protein_id gnl|my_center|LOCUS_04380 518848 518315 gene locus_tag LOCUS_04390 518848 518315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_04390 519523 518981 gene locus_tag LOCUS_04400 519523 518981 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087259.1 protein_id gnl|my_center|LOCUS_04400 520386 519628 gene locus_tag LOCUS_04410 gene anr 520386 519628 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_04410 522094 520709 gene locus_tag LOCUS_04420 gene hemN 522094 520709 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_04420 522971 522270 gene locus_tag LOCUS_04430 522971 522270 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_04430 523243 523043 gene locus_tag LOCUS_04440 gene ccoS 523243 523043 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_04440 525726 523246 gene locus_tag LOCUS_04450 525726 523246 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_04450 526297 525743 gene locus_tag LOCUS_04460 526297 525743 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_04460 527722 526337 gene locus_tag LOCUS_04470 gene ccoG 527722 526337 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_04470 528722 527928 gene locus_tag LOCUS_04480 528722 527928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 529963 529061 gene locus_tag LOCUS_04490 gene ccoP 529963 529061 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 protein_id gnl|my_center|LOCUS_04490 530181 529960 gene locus_tag LOCUS_04500 530181 529960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 530797 530186 gene locus_tag LOCUS_04510 gene ccoO 530797 530186 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_04510 532267 530816 gene locus_tag LOCUS_04520 gene ccoN 532267 530816 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_04520 532780 533739 gene locus_tag LOCUS_04530 532780 533739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 534603 533896 gene locus_tag LOCUS_04540 534603 533896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 535584 534877 gene locus_tag LOCUS_04550 535584 534877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 536589 535858 gene locus_tag LOCUS_04560 536589 535858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 536825 538186 gene locus_tag LOCUS_04570 536825 538186 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_04570 539478 538561 gene locus_tag LOCUS_04580 539478 538561 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 protein_id gnl|my_center|LOCUS_04580 539755 540000 gene locus_tag LOCUS_04590 gene tusA 539755 540000 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371482.1 protein_id gnl|my_center|LOCUS_04590 540233 540835 gene locus_tag LOCUS_04600 540233 540835 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_04600 540870 541727 gene locus_tag LOCUS_04610 540870 541727 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_04610 542428 541745 gene locus_tag LOCUS_04620 542428 541745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 543185 542496 gene locus_tag LOCUS_04630 543185 542496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 544253 543267 gene locus_tag LOCUS_04640 544253 543267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 544478 545650 gene locus_tag LOCUS_04650 gene pdxB 544478 545650 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766914.1 protein_id gnl|my_center|LOCUS_04650 545811 546881 gene locus_tag LOCUS_04660 545811 546881 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_04660 547040 548287 gene locus_tag LOCUS_04670 547040 548287 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_04670 548287 548676 gene locus_tag LOCUS_04680 548287 548676 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_04680 548875 548684 gene locus_tag LOCUS_04690 548875 548684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 549426 549232 gene locus_tag LOCUS_04700 549426 549232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 550314 550096 gene locus_tag LOCUS_04710 550314 550096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 551264 551046 gene locus_tag LOCUS_04720 551264 551046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 551715 551533 gene locus_tag LOCUS_04730 551715 551533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 552823 552452 gene locus_tag LOCUS_04740 552823 552452 CDS product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 protein_id gnl|my_center|LOCUS_04740 553466 552915 gene locus_tag LOCUS_04750 553466 552915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 553884 553693 gene locus_tag LOCUS_04760 553884 553693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 555145 554954 gene locus_tag LOCUS_04770 555145 554954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 555480 555325 gene locus_tag LOCUS_04780 555480 555325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 555690 555481 gene locus_tag LOCUS_04790 555690 555481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 556116 556343 gene locus_tag LOCUS_04800 556116 556343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 556729 556379 gene locus_tag LOCUS_04810 556729 556379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 556890 558386 gene locus_tag LOCUS_04820 556890 558386 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074299.1 protein_id gnl|my_center|LOCUS_04820 558429 560216 gene locus_tag LOCUS_04830 gene menD 558429 560216 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704504.1 protein_id gnl|my_center|LOCUS_04830 560216 561148 gene locus_tag LOCUS_04840 gene menH 560216 561148 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154236135.1 protein_id gnl|my_center|LOCUS_04840 561191 562225 gene locus_tag LOCUS_04850 gene menC 561191 562225 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262223.1 protein_id gnl|my_center|LOCUS_04850 562216 563724 gene locus_tag LOCUS_04860 gene menE 562216 563724 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933507.1 protein_id gnl|my_center|LOCUS_04860 564093 564674 gene locus_tag LOCUS_04870 gene thpR 564093 564674 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229239.1 protein_id gnl|my_center|LOCUS_04870 564741 565751 gene locus_tag LOCUS_04880 564741 565751 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705630.1 protein_id gnl|my_center|LOCUS_04880 565798 566694 gene locus_tag LOCUS_04890 565798 566694 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_04890 566986 568308 gene locus_tag LOCUS_04900 566986 568308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 568828 568358 gene locus_tag LOCUS_04910 568828 568358 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456068.1 protein_id gnl|my_center|LOCUS_04910 569656 568841 gene locus_tag LOCUS_04920 gene thiM 569656 568841 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482855.1 protein_id gnl|my_center|LOCUS_04920 570034 570468 gene locus_tag LOCUS_04930 570034 570468 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647492.1 protein_id gnl|my_center|LOCUS_04930 570841 572613 gene locus_tag LOCUS_04940 570841 572613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 protein_id gnl|my_center|LOCUS_04940 572658 574214 gene locus_tag LOCUS_04950 572658 574214 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 protein_id gnl|my_center|LOCUS_04950 574305 575285 gene locus_tag LOCUS_04960 574305 575285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 protein_id gnl|my_center|LOCUS_04960 575282 576226 gene locus_tag LOCUS_04970 575282 576226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262868.1 protein_id gnl|my_center|LOCUS_04970 577459 576248 gene locus_tag LOCUS_04980 577459 576248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 578336 577539 gene locus_tag LOCUS_04990 578336 577539 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256553.1 protein_id gnl|my_center|LOCUS_04990 578460 579038 gene locus_tag LOCUS_05000 gene hemG 578460 579038 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853982.1 protein_id gnl|my_center|LOCUS_05000 580677 579352 gene locus_tag LOCUS_05010 580677 579352 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_05010 580973 581779 gene locus_tag LOCUS_05020 580973 581779 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_05020 581813 582478 gene locus_tag LOCUS_05030 gene msrA 581813 582478 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095789.1 protein_id gnl|my_center|LOCUS_05030 584524 582446 gene locus_tag LOCUS_05040 gene mnmC 584524 582446 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268624.1 protein_id gnl|my_center|LOCUS_05040 585555 584551 gene locus_tag LOCUS_05050 585555 584551 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_05050 585826 586077 gene locus_tag LOCUS_05060 585826 586077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 586158 587966 gene locus_tag LOCUS_05070 gene oadA 586158 587966 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_05070 587987 589297 gene locus_tag LOCUS_05080 587987 589297 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 protein_id gnl|my_center|LOCUS_05080 589690 589376 gene locus_tag LOCUS_05090 589690 589376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 590128 589724 gene locus_tag LOCUS_05100 590128 589724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 590051 591286 gene locus_tag LOCUS_05110 590051 591286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 591955 591404 gene locus_tag LOCUS_05120 591955 591404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 592362 592823 gene locus_tag LOCUS_05130 592362 592823 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_05130 593456 592989 gene locus_tag LOCUS_05140 593456 592989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 594201 596486 gene locus_tag LOCUS_05150 gene pflB 594201 596486 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292799.1 protein_id gnl|my_center|LOCUS_05150 596645 597376 gene locus_tag LOCUS_05160 gene pflA 596645 597376 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072818.1 protein_id gnl|my_center|LOCUS_05160 599571 597544 gene locus_tag LOCUS_05170 599571 597544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 602632 600677 gene locus_tag LOCUS_05180 602632 600677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 605037 604000 gene locus_tag LOCUS_05190 605037 604000 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095585.1 protein_id gnl|my_center|LOCUS_05190 605348 605085 gene locus_tag LOCUS_05200 605348 605085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 605979 605359 gene locus_tag LOCUS_05210 gene udk 605979 605359 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 protein_id gnl|my_center|LOCUS_05210 606464 606078 gene locus_tag LOCUS_05220 gene yciA 606464 606078 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299258.1 protein_id gnl|my_center|LOCUS_05220 606626 607687 gene locus_tag LOCUS_05230 gene rsmC 606626 607687 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262584.1 protein_id gnl|my_center|LOCUS_05230 607857 609080 gene locus_tag LOCUS_05240 607857 609080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 609904 609167 gene locus_tag LOCUS_05250 609904 609167 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_05250 610928 609909 gene locus_tag LOCUS_05260 610928 609909 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_05260 611746 611039 gene locus_tag LOCUS_05270 611746 611039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 614520 613564 gene locus_tag LOCUS_05280 gene intIA 614520 613564 CDS product integron integrase IntIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841995.1 protein_id gnl|my_center|LOCUS_05280 614745 615572 gene locus_tag LOCUS_05290 614745 615572 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 protein_id gnl|my_center|LOCUS_05290 615740 616207 gene locus_tag LOCUS_05300 615740 616207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 616306 616860 gene locus_tag LOCUS_05310 616306 616860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 616957 617304 gene locus_tag LOCUS_05320 616957 617304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 617387 617617 gene locus_tag LOCUS_05330 617387 617617 CDS product DUF6429 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105375144.1 protein_id gnl|my_center|LOCUS_05330 618961 617855 gene locus_tag LOCUS_05340 618961 617855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05340 619654 620208 gene locus_tag LOCUS_05350 619654 620208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 621541 620279 gene locus_tag LOCUS_05360 gene ltrA 621541 620279 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05360 622306 623688 gene locus_tag LOCUS_05370 622306 623688 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985752.1 protein_id gnl|my_center|LOCUS_05370 623736 624203 gene locus_tag LOCUS_05380 623736 624203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 624341 624661 gene locus_tag LOCUS_05390 624341 624661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 626181 625189 gene locus_tag LOCUS_05400 626181 625189 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_05400 626352 626510 gene locus_tag LOCUS_05410 626352 626510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 626646 627230 gene locus_tag LOCUS_05420 626646 627230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 628010 628600 gene locus_tag LOCUS_05430 628010 628600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 628988 628674 gene locus_tag LOCUS_05440 628988 628674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 629432 629938 gene locus_tag LOCUS_05450 629432 629938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 630313 630086 gene locus_tag LOCUS_05460 630313 630086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 630689 630495 gene locus_tag LOCUS_05470 630689 630495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 630801 631418 gene locus_tag LOCUS_05480 630801 631418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 631430 631870 gene locus_tag LOCUS_05490 631430 631870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 631872 632477 gene locus_tag LOCUS_05500 631872 632477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 634234 632999 gene locus_tag LOCUS_05510 634234 632999 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_05510 634341 634676 gene locus_tag LOCUS_05520 gene tnpA 634341 634676 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_05520 634938 634747 gene locus_tag LOCUS_05530 634938 634747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 635008 636645 gene locus_tag LOCUS_05540 635008 636645 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_05540 637152 637619 gene locus_tag LOCUS_05550 637152 637619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 638974 637712 gene locus_tag LOCUS_05560 gene ltrA 638974 637712 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05560 640266 640559 gene locus_tag LOCUS_05570 640266 640559 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_05570 640582 640980 gene locus_tag LOCUS_05580 640582 640980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263497.1 protein_id gnl|my_center|LOCUS_05580 641186 642325 gene locus_tag LOCUS_05590 641186 642325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 642427 643629 gene locus_tag LOCUS_05600 642427 643629 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_05600 643661 644155 gene locus_tag LOCUS_05610 643661 644155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 644240 644473 gene locus_tag LOCUS_05620 644240 644473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 644474 644968 gene locus_tag LOCUS_05630 644474 644968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462908.1 protein_id gnl|my_center|LOCUS_05630 646188 645433 gene locus_tag LOCUS_05640 gene istB 646188 645433 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_05640 647731 646208 gene locus_tag LOCUS_05650 gene istA 647731 646208 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_05650 648264 648797 gene locus_tag LOCUS_05660 648264 648797 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477738.1 protein_id gnl|my_center|LOCUS_05660 649174 648875 gene locus_tag LOCUS_05670 649174 648875 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_05670 649413 649171 gene locus_tag LOCUS_05680 649413 649171 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_05680 649582 650052 gene locus_tag LOCUS_05690 649582 650052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 651890 650628 gene locus_tag LOCUS_05700 gene ltrA 651890 650628 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05700 652596 653192 gene locus_tag LOCUS_05710 652596 653192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 653291 653623 gene locus_tag LOCUS_05720 653291 653623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 653665 654219 gene locus_tag LOCUS_05730 653665 654219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 654240 655091 gene locus_tag LOCUS_05740 654240 655091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 655105 655878 gene locus_tag LOCUS_05750 655105 655878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 655993 656538 gene locus_tag LOCUS_05760 655993 656538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 658465 657065 gene locus_tag LOCUS_05770 658465 657065 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_05770 659867 658548 gene locus_tag LOCUS_05780 659867 658548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 660412 660026 gene locus_tag LOCUS_05790 660412 660026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 660772 661026 gene locus_tag LOCUS_05800 660772 661026 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_05800 661023 661355 gene locus_tag LOCUS_05810 661023 661355 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_05810 661469 662215 gene locus_tag LOCUS_05820 661469 662215 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 protein_id gnl|my_center|LOCUS_05820 662574 662281 gene locus_tag LOCUS_05830 662574 662281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 663151 663900 gene locus_tag LOCUS_05840 663151 663900 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268011.1 protein_id gnl|my_center|LOCUS_05840 665078 663855 gene locus_tag LOCUS_05850 665078 663855 CDS product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 protein_id gnl|my_center|LOCUS_05850 665919 666197 gene locus_tag LOCUS_05860 665919 666197 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_05860 666197 666490 gene locus_tag LOCUS_05870 666197 666490 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816231.1 protein_id gnl|my_center|LOCUS_05870 667823 666561 gene locus_tag LOCUS_05880 gene ltrA 667823 666561 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05880 669874 668390 gene locus_tag LOCUS_05890 669874 668390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 671746 670715 gene locus_tag LOCUS_05900 gene ltrA 671746 670715 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05900 672746 673633 gene locus_tag LOCUS_05910 672746 673633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 674634 673606 gene locus_tag LOCUS_05920 674634 673606 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_05920 674803 675438 gene locus_tag LOCUS_05930 674803 675438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 676178 675582 gene locus_tag LOCUS_05940 676178 675582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 677361 676183 gene locus_tag LOCUS_05950 677361 676183 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_05950 677416 679119 gene locus_tag LOCUS_05960 677416 679119 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_05960 679343 679089 gene locus_tag LOCUS_05970 679343 679089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 680478 681740 gene locus_tag LOCUS_05980 gene ltrA 680478 681740 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05980 682412 683674 gene locus_tag LOCUS_05990 gene ltrA 682412 683674 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_05990 683896 684105 gene locus_tag LOCUS_06000 683896 684105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 685321 684542 gene locus_tag LOCUS_06010 685321 684542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 685962 685480 gene locus_tag LOCUS_06020 685962 685480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 686348 686013 gene locus_tag LOCUS_06030 686348 686013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 686654 688159 gene locus_tag LOCUS_06040 686654 688159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 689207 690082 gene locus_tag LOCUS_06050 689207 690082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06050 691148 690321 gene locus_tag LOCUS_06060 691148 690321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 691883 693103 gene locus_tag LOCUS_06070 gene ltrA 691883 693103 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_06070 693247 693489 gene locus_tag LOCUS_06080 693247 693489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 693486 693887 gene locus_tag LOCUS_06090 693486 693887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 694568 695830 gene locus_tag LOCUS_06100 gene ltrA 694568 695830 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_06100 696680 698041 gene locus_tag LOCUS_06110 696680 698041 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_06110 698165 698518 gene locus_tag LOCUS_06120 698165 698518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 701497 700091 gene locus_tag LOCUS_06130 701497 700091 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 protein_id gnl|my_center|LOCUS_06130 703137 701503 gene locus_tag LOCUS_06140 703137 701503 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_06140 704915 703362 gene locus_tag LOCUS_06150 704915 703362 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409202.1 protein_id gnl|my_center|LOCUS_06150 705331 704972 gene locus_tag LOCUS_06160 gene tnpB 705331 704972 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_06160 705675 705328 gene locus_tag LOCUS_06170 705675 705328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 706229 705870 gene locus_tag LOCUS_06180 gene tnpB 706229 705870 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_06180 706573 706226 gene locus_tag LOCUS_06190 706573 706226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 707119 707466 gene locus_tag LOCUS_06200 707119 707466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 707463 707822 gene locus_tag LOCUS_06210 gene tnpB 707463 707822 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_06210 707879 709432 gene locus_tag LOCUS_06220 707879 709432 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 protein_id gnl|my_center|LOCUS_06220 709821 710057 gene locus_tag LOCUS_06230 709821 710057 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_06230 710038 710283 gene locus_tag LOCUS_06240 710038 710283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 710833 710618 gene locus_tag LOCUS_06250 710833 710618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 711004 711996 gene locus_tag LOCUS_06260 711004 711996 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_06260 712129 713832 gene locus_tag LOCUS_06270 712129 713832 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_06270 713875 714531 gene locus_tag LOCUS_06280 713875 714531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 714707 715771 gene locus_tag LOCUS_06290 714707 715771 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_06290 716813 715701 gene locus_tag LOCUS_06300 716813 715701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 717150 718151 gene locus_tag LOCUS_06310 717150 718151 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_06310 718157 718942 gene locus_tag LOCUS_06320 718157 718942 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_06320 718982 719977 gene locus_tag LOCUS_06330 718982 719977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 719977 720537 gene locus_tag LOCUS_06340 719977 720537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 721619 720534 gene locus_tag LOCUS_06350 721619 720534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 721880 722410 gene locus_tag LOCUS_06360 721880 722410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 723280 722552 gene locus_tag LOCUS_06370 gene fkpA 723280 722552 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_06370 724723 723497 gene locus_tag LOCUS_06380 gene arsJ 724723 723497 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 protein_id gnl|my_center|LOCUS_06380 725726 724725 gene locus_tag LOCUS_06390 725726 724725 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 protein_id gnl|my_center|LOCUS_06390 726818 725784 gene locus_tag LOCUS_06400 726818 725784 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267571.1 protein_id gnl|my_center|LOCUS_06400 727248 727015 gene locus_tag LOCUS_06410 727248 727015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 727933 727271 gene locus_tag LOCUS_06420 727933 727271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 728312 728851 gene locus_tag LOCUS_06430 728312 728851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 729752 729060 gene locus_tag LOCUS_06440 729752 729060 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_06440 732420 729757 gene locus_tag LOCUS_06450 gene pepN 732420 729757 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071313.1 protein_id gnl|my_center|LOCUS_06450 732698 737473 gene locus_tag LOCUS_06460 732698 737473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 737690 738019 gene locus_tag LOCUS_06470 737690 738019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 739374 738118 gene locus_tag LOCUS_06480 739374 738118 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_06480 740917 739508 gene locus_tag LOCUS_06490 740917 739508 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_06490 741821 742201 gene locus_tag LOCUS_06500 741821 742201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 742265 743290 gene locus_tag LOCUS_06510 742265 743290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 743459 744685 gene locus_tag LOCUS_06520 743459 744685 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_06520 744699 747908 gene locus_tag LOCUS_06530 744699 747908 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06530 748096 747896 gene locus_tag LOCUS_06540 748096 747896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 748418 749458 gene locus_tag LOCUS_06550 748418 749458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 751229 749721 gene locus_tag LOCUS_06560 751229 749721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 751346 751777 gene locus_tag LOCUS_06570 gene tnpA 751346 751777 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_06570 752880 754205 gene locus_tag LOCUS_06580 752880 754205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 755111 754848 gene locus_tag LOCUS_06590 755111 754848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 756309 755257 gene locus_tag LOCUS_06600 756309 755257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 756690 757787 gene locus_tag LOCUS_06610 756690 757787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 758353 757796 gene locus_tag LOCUS_06620 758353 757796 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_06620 759051 760612 gene locus_tag LOCUS_r00010 759051 760612 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 760995 763910 gene locus_tag LOCUS_r00020 760995 763910 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 764154 764264 gene locus_tag LOCUS_r00030 764154 764264 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 764461 764270 gene locus_tag LOCUS_06630 764461 764270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 765082 766308 gene locus_tag LOCUS_06640 gene ltrA 765082 766308 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_06640 767963 766437 gene locus_tag LOCUS_06650 gene putP 767963 766437 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_06650 768371 769657 gene locus_tag LOCUS_06660 gene hutI 768371 769657 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927515.1 protein_id gnl|my_center|LOCUS_06660 769674 770690 gene locus_tag LOCUS_06670 gene hutG 769674 770690 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 protein_id gnl|my_center|LOCUS_06670 770839 772449 gene locus_tag LOCUS_06680 770839 772449 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194594.1 protein_id gnl|my_center|LOCUS_06680 772451 773986 gene locus_tag LOCUS_06690 gene hutH 772451 773986 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105400.1 protein_id gnl|my_center|LOCUS_06690 774099 776156 gene locus_tag LOCUS_06700 774099 776156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 776990 776346 gene locus_tag LOCUS_06710 gene ddpX 776990 776346 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939993.1 protein_id gnl|my_center|LOCUS_06710 778058 776991 gene locus_tag LOCUS_06720 778058 776991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 778897 778160 gene locus_tag LOCUS_06730 778897 778160 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933545.1 protein_id gnl|my_center|LOCUS_06730 780399 779062 gene locus_tag LOCUS_06740 gene gltA 780399 779062 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_06740 780766 781140 gene locus_tag LOCUS_06750 gene sdhC 780766 781140 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_06750 781134 781502 gene locus_tag LOCUS_06760 gene sdhD 781134 781502 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104386.1 protein_id gnl|my_center|LOCUS_06760 781506 783278 gene locus_tag LOCUS_06770 gene sdhA 781506 783278 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 protein_id gnl|my_center|LOCUS_06770 783297 784001 gene locus_tag LOCUS_06780 783297 784001 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_06780 784283 787099 gene locus_tag LOCUS_06790 784283 787099 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_06790 787163 788368 gene locus_tag LOCUS_06800 gene odhB 787163 788368 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_06800 788383 789873 gene locus_tag LOCUS_06810 gene lpdA 788383 789873 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_06810 790008 791312 gene locus_tag LOCUS_06820 gene sucC 790008 791312 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_06820 791312 792184 gene locus_tag LOCUS_06830 gene sucD 791312 792184 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_06830 792442 793317 gene locus_tag LOCUS_06840 792442 793317 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_06840 795481 793355 gene locus_tag LOCUS_06850 gene xcpQ 795481 793355 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_06850 796153 795518 gene locus_tag LOCUS_06860 796153 795518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 796457 797986 gene locus_tag LOCUS_06870 gene xcpR 796457 797986 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_06870 798016 799236 gene locus_tag LOCUS_06880 gene xcpS 798016 799236 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_06880 799343 799822 gene locus_tag LOCUS_06890 gene xcpT 799343 799822 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_06890 799819 800322 gene locus_tag LOCUS_06900 799819 800322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 800354 800701 gene locus_tag LOCUS_06910 800354 800701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 800698 801468 gene locus_tag LOCUS_06920 gene xcpW 800698 801468 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_06920 801461 802447 gene locus_tag LOCUS_06930 gene xcpX 801461 802447 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_06930 802457 803863 gene locus_tag LOCUS_06940 802457 803863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 803867 804385 gene locus_tag LOCUS_06950 gene gspM 803867 804385 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661339.1 protein_id gnl|my_center|LOCUS_06950 804563 804638 gene locus_tag LOCUS_t00180 804563 804638 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 804707 804783 gene locus_tag LOCUS_t00190 804707 804783 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 805213 805076 gene locus_tag LOCUS_06960 805213 805076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 805610 805275 gene locus_tag LOCUS_06970 805610 805275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 806772 806572 gene locus_tag LOCUS_06980 806772 806572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 807320 806874 gene locus_tag LOCUS_06990 807320 806874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 808654 807320 gene locus_tag LOCUS_07000 808654 807320 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_07000 808931 808641 gene locus_tag LOCUS_07010 808931 808641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 809179 809021 gene locus_tag LOCUS_07020 809179 809021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 810499 810182 gene locus_tag LOCUS_07030 810499 810182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 810498 811877 gene locus_tag LOCUS_07040 810498 811877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07040 811977 812348 gene locus_tag LOCUS_07050 811977 812348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07050 812565 812314 gene locus_tag LOCUS_07060 812565 812314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 812821 812543 gene locus_tag LOCUS_07070 812821 812543 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_07070 813238 813711 gene locus_tag LOCUS_07080 813238 813711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07080 813730 814014 gene locus_tag LOCUS_07090 813730 814014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07090 814027 814188 gene locus_tag LOCUS_07100 814027 814188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 814185 815180 gene locus_tag LOCUS_07110 814185 815180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 815165 815461 gene locus_tag LOCUS_07120 815165 815461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 815445 816029 gene locus_tag LOCUS_07130 815445 816029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 816004 816405 gene locus_tag LOCUS_07140 816004 816405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 816453 817196 gene locus_tag LOCUS_07150 816453 817196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 817424 817206 gene locus_tag LOCUS_07160 817424 817206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 817460 820405 gene locus_tag LOCUS_07170 817460 820405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 820405 820797 gene locus_tag LOCUS_07180 820405 820797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 821306 821671 gene locus_tag LOCUS_07190 821306 821671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 822941 821736 gene locus_tag LOCUS_07200 822941 821736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 823263 822952 gene locus_tag LOCUS_07210 823263 822952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 826367 823386 gene locus_tag LOCUS_07220 826367 823386 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_07220 826832 827590 gene locus_tag LOCUS_07230 826832 827590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 828037 827603 gene locus_tag LOCUS_07240 828037 827603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 829371 828037 gene locus_tag LOCUS_07250 829371 828037 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_07250 829804 829358 gene locus_tag LOCUS_07260 829804 829358 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_07260 829986 829801 gene locus_tag LOCUS_07270 829986 829801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 830195 831361 gene locus_tag LOCUS_07280 830195 831361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 831354 832325 gene locus_tag LOCUS_07290 831354 832325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 832495 832710 gene locus_tag LOCUS_07300 832495 832710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 832707 833174 gene locus_tag LOCUS_07310 832707 833174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 833171 834019 gene locus_tag LOCUS_07320 833171 834019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 834016 834639 gene locus_tag LOCUS_07330 834016 834639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 834691 836802 gene locus_tag LOCUS_07340 834691 836802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 837113 837484 gene locus_tag LOCUS_07350 837113 837484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 837674 838951 gene locus_tag LOCUS_07360 837674 838951 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_07360 838917 839192 gene locus_tag LOCUS_07370 838917 839192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 839196 839639 gene locus_tag LOCUS_07380 839196 839639 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_07380 839636 840004 gene locus_tag LOCUS_07390 839636 840004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 840027 840749 gene locus_tag LOCUS_07400 840027 840749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 841584 841243 gene locus_tag LOCUS_07410 841584 841243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 842060 841581 gene locus_tag LOCUS_07420 842060 841581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 842252 842079 gene locus_tag LOCUS_07430 842252 842079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 842406 842897 gene locus_tag LOCUS_07440 842406 842897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 842894 844741 gene locus_tag LOCUS_07450 842894 844741 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_07450 844745 844945 gene locus_tag LOCUS_07460 844745 844945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 845055 846455 gene locus_tag LOCUS_07470 845055 846455 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_07470 846700 847818 gene locus_tag LOCUS_07480 846700 847818 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_07480 847831 847992 gene locus_tag LOCUS_07490 847831 847992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 847989 848984 gene locus_tag LOCUS_07500 847989 848984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 848969 849265 gene locus_tag LOCUS_07510 848969 849265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 849249 849833 gene locus_tag LOCUS_07520 849249 849833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 849808 850209 gene locus_tag LOCUS_07530 849808 850209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 850259 850789 gene locus_tag LOCUS_07540 850259 850789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 850783 852657 gene locus_tag LOCUS_07550 850783 852657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 852657 853049 gene locus_tag LOCUS_07560 852657 853049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 854066 853074 gene locus_tag LOCUS_07570 854066 853074 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_07570 855792 854557 gene locus_tag LOCUS_07580 855792 854557 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_07580 855921 856208 gene locus_tag LOCUS_07590 855921 856208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07590 856225 856677 gene locus_tag LOCUS_07600 856225 856677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07600 856884 856600 gene locus_tag LOCUS_07610 856884 856600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 856883 860542 gene locus_tag LOCUS_07620 856883 860542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 860454 861440 gene locus_tag LOCUS_07630 860454 861440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 861440 862204 gene locus_tag LOCUS_07640 861440 862204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 862204 864657 gene locus_tag LOCUS_07650 862204 864657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 864986 864708 gene locus_tag LOCUS_07660 864986 864708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 865223 865023 gene locus_tag LOCUS_07670 865223 865023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 865402 865635 gene locus_tag LOCUS_07680 865402 865635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 865999 865646 gene locus_tag LOCUS_07690 865999 865646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 866170 869397 gene locus_tag LOCUS_07700 gene drmD 866170 869397 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083686.1 protein_id gnl|my_center|LOCUS_07700 869394 874463 gene locus_tag LOCUS_07710 869394 874463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 874463 880414 gene locus_tag LOCUS_07720 874463 880414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 880443 881744 gene locus_tag LOCUS_07730 880443 881744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 881729 882352 gene locus_tag LOCUS_07740 881729 882352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 882744 882917 gene locus_tag LOCUS_07750 882744 882917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 883149 882946 gene locus_tag LOCUS_07760 883149 882946 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632579.1 protein_id gnl|my_center|LOCUS_07760 883370 883149 gene locus_tag LOCUS_07770 883370 883149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 884047 883643 gene locus_tag LOCUS_07780 884047 883643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 886348 884231 gene locus_tag LOCUS_07790 886348 884231 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_07790 888402 887089 gene locus_tag LOCUS_07800 888402 887089 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_07800 888921 888502 gene locus_tag LOCUS_07810 888921 888502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 890345 889152 gene locus_tag LOCUS_07820 890345 889152 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615699.1 protein_id gnl|my_center|LOCUS_07820 891885 890359 gene locus_tag LOCUS_07830 891885 890359 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_07830 892196 891945 gene locus_tag LOCUS_07840 892196 891945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 892795 892541 gene locus_tag LOCUS_07850 gene minE 892795 892541 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_07850 893608 892799 gene locus_tag LOCUS_07860 gene minD 893608 892799 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072528.1 protein_id gnl|my_center|LOCUS_07860 894421 893651 gene locus_tag LOCUS_07870 gene minC 894421 893651 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_07870 894601 895545 gene locus_tag LOCUS_07880 894601 895545 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_07880 895730 897253 gene locus_tag LOCUS_07890 895730 897253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 900185 897303 gene locus_tag LOCUS_07900 gene rapA 900185 897303 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268689.1 protein_id gnl|my_center|LOCUS_07900 900685 900407 gene locus_tag LOCUS_07910 900685 900407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 901349 900888 gene locus_tag LOCUS_07920 901349 900888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 901716 901468 gene locus_tag LOCUS_07930 901716 901468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 902790 901879 gene locus_tag LOCUS_07940 gene rluB 902790 901879 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113439.1 protein_id gnl|my_center|LOCUS_07940 903710 902877 gene locus_tag LOCUS_07950 gene scpB 903710 902877 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114835.1 protein_id gnl|my_center|LOCUS_07950 904655 903726 gene locus_tag LOCUS_07960 904655 903726 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_07960 905978 904764 gene locus_tag LOCUS_07970 905978 904764 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_07970 906710 906072 gene locus_tag LOCUS_07980 906710 906072 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_07980 907599 906913 gene locus_tag LOCUS_07990 907599 906913 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071331.1 protein_id gnl|my_center|LOCUS_07990 909097 907751 gene locus_tag LOCUS_08000 909097 907751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 910775 909327 gene locus_tag LOCUS_08010 910775 909327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 911774 910884 gene locus_tag LOCUS_08020 911774 910884 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 protein_id gnl|my_center|LOCUS_08020 911963 912589 gene locus_tag LOCUS_08030 911963 912589 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396551.1 protein_id gnl|my_center|LOCUS_08030 912590 912889 gene locus_tag LOCUS_08040 912590 912889 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_08040 912919 913608 gene locus_tag LOCUS_08050 912919 913608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 913962 913684 gene locus_tag LOCUS_08060 913962 913684 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_08060 914106 914741 gene locus_tag LOCUS_08070 914106 914741 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_08070 914903 915403 gene locus_tag LOCUS_08080 914903 915403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 915406 915924 gene locus_tag LOCUS_08090 915406 915924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 915945 916670 gene locus_tag LOCUS_08100 915945 916670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_08100 916664 917863 gene locus_tag LOCUS_08110 916664 917863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 918059 918694 gene locus_tag LOCUS_08120 918059 918694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 919137 918679 gene locus_tag LOCUS_08130 919137 918679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 919482 919168 gene locus_tag LOCUS_08140 gene bolA 919482 919168 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_08140 920280 919516 gene locus_tag LOCUS_08150 920280 919516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 920530 920688 gene locus_tag LOCUS_08160 920530 920688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 920823 922340 gene locus_tag LOCUS_08170 920823 922340 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_08170 925137 922447 gene locus_tag LOCUS_08180 925137 922447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 926867 925455 gene locus_tag LOCUS_08190 926867 925455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 927497 927018 gene locus_tag LOCUS_08200 927497 927018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 928950 927811 gene locus_tag LOCUS_08210 gene gcvT 928950 927811 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_08210 929221 930438 gene locus_tag LOCUS_08220 gene pepT 929221 930438 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263146.1 protein_id gnl|my_center|LOCUS_08220 930850 932427 gene locus_tag LOCUS_08230 930850 932427 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_08230 933866 932598 gene locus_tag LOCUS_08240 933866 932598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 936232 934064 gene locus_tag LOCUS_08250 936232 934064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 936447 938090 gene locus_tag LOCUS_08260 936447 938090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 941099 938172 gene locus_tag LOCUS_08270 gene gcvP 941099 938172 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 protein_id gnl|my_center|LOCUS_08270 942579 941185 gene locus_tag LOCUS_08280 942579 941185 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_08280 943104 944207 gene locus_tag LOCUS_08290 943104 944207 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862386.1 protein_id gnl|my_center|LOCUS_08290 944275 944490 gene locus_tag LOCUS_08300 944275 944490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 944487 945998 gene locus_tag LOCUS_08310 944487 945998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 947846 946059 gene locus_tag LOCUS_08320 947846 946059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 947845 948054 gene locus_tag LOCUS_08330 947845 948054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 949547 948111 gene locus_tag LOCUS_08340 949547 948111 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_08340 949802 950434 gene locus_tag LOCUS_08350 949802 950434 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478414.1 protein_id gnl|my_center|LOCUS_08350 950469 950834 gene locus_tag LOCUS_08360 950469 950834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 950995 952308 gene locus_tag LOCUS_08370 950995 952308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 952577 953008 gene locus_tag LOCUS_08380 gene ndk 952577 953008 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963851.1 protein_id gnl|my_center|LOCUS_08380 953056 954201 gene locus_tag LOCUS_08390 gene rlmN 953056 954201 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_08390 954331 955068 gene locus_tag LOCUS_08400 gene pilF 954331 955068 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_08400 955058 956074 gene locus_tag LOCUS_08410 955058 956074 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771017.1 protein_id gnl|my_center|LOCUS_08410 956181 957452 gene locus_tag LOCUS_08420 gene hisS 956181 957452 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_08420 957528 958202 gene locus_tag LOCUS_08430 957528 958202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_08430 958206 959357 gene locus_tag LOCUS_08440 gene bamB 958206 959357 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_08440 959550 961025 gene locus_tag LOCUS_08450 gene der 959550 961025 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_08450 962466 961231 gene locus_tag LOCUS_08460 962466 961231 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_08460 963120 962506 gene locus_tag LOCUS_08470 963120 962506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 964715 963315 gene locus_tag LOCUS_08480 964715 963315 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_08480 965207 965527 gene locus_tag LOCUS_08490 965207 965527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 966553 966771 gene locus_tag LOCUS_08500 966553 966771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 968484 967114 gene locus_tag LOCUS_08510 gene xseA 968484 967114 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797807.1 protein_id gnl|my_center|LOCUS_08510 968657 969973 gene locus_tag LOCUS_08520 968657 969973 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261719.1 protein_id gnl|my_center|LOCUS_08520 970187 969996 gene locus_tag LOCUS_08530 970187 969996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 970808 972034 gene locus_tag LOCUS_08540 gene ltrA 970808 972034 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_08540 972236 973705 gene locus_tag LOCUS_08550 gene guaB 972236 973705 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_08550 973851 975452 gene locus_tag LOCUS_08560 gene guaA 973851 975452 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_08560 976172 977767 gene locus_tag LOCUS_08570 976172 977767 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_08570 977843 978271 gene locus_tag LOCUS_08580 977843 978271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 978283 981708 gene locus_tag LOCUS_08590 978283 981708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 982089 981715 gene locus_tag LOCUS_08600 982089 981715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 982376 982110 gene locus_tag LOCUS_08610 982376 982110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 982656 982399 gene locus_tag LOCUS_08620 982656 982399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 984124 982634 gene locus_tag LOCUS_08630 984124 982634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 984456 986156 gene locus_tag LOCUS_08640 gene fadD2 984456 986156 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_08640 986681 986280 gene locus_tag LOCUS_08650 986681 986280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 987439 986858 gene locus_tag LOCUS_08660 987439 986858 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705053.1 protein_id gnl|my_center|LOCUS_08660 988559 987669 gene locus_tag LOCUS_08670 988559 987669 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707055.1 protein_id gnl|my_center|LOCUS_08670 988682 988606 gene locus_tag LOCUS_t00200 988682 988606 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 988839 988763 gene locus_tag LOCUS_t00210 988839 988763 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 988995 988919 gene locus_tag LOCUS_t00220 988995 988919 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 989151 989075 gene locus_tag LOCUS_t00230 989151 989075 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 989308 989232 gene locus_tag LOCUS_t00240 989308 989232 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 991475 989514 gene locus_tag LOCUS_08680 gene acs 991475 989514 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110260.1 protein_id gnl|my_center|LOCUS_08680 991950 995435 gene locus_tag LOCUS_08690 991950 995435 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 protein_id gnl|my_center|LOCUS_08690 996139 995417 gene locus_tag LOCUS_08700 996139 995417 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072594.1 protein_id gnl|my_center|LOCUS_08700 996917 996237 gene locus_tag LOCUS_08710 996917 996237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 997257 998378 gene locus_tag LOCUS_08720 gene dinB 997257 998378 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406165.1 protein_id gnl|my_center|LOCUS_08720 998466 998858 gene locus_tag LOCUS_08730 998466 998858 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_08730 1000371 998944 gene locus_tag LOCUS_08740 1000371 998944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1001099 1000482 gene locus_tag LOCUS_08750 1001099 1000482 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_08750 1002929 1001211 gene locus_tag LOCUS_08760 gene recJ 1002929 1001211 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_08760 1003709 1003311 gene locus_tag LOCUS_08770 1003709 1003311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1004311 1003706 gene locus_tag LOCUS_08780 1004311 1003706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1004471 1005361 gene locus_tag LOCUS_08790 1004471 1005361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1008552 1006834 gene locus_tag LOCUS_08800 1008552 1006834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1010234 1008759 gene locus_tag LOCUS_08810 1010234 1008759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1010722 1012032 gene locus_tag LOCUS_08820 1010722 1012032 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262944.1 protein_id gnl|my_center|LOCUS_08820 1012349 1013827 gene locus_tag LOCUS_08830 1012349 1013827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1015386 1013905 gene locus_tag LOCUS_08840 1015386 1013905 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103494.1 protein_id gnl|my_center|LOCUS_08840 1015742 1016812 gene locus_tag LOCUS_08850 gene lptF 1015742 1016812 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_08850 1016805 1017863 gene locus_tag LOCUS_08860 gene lptG 1016805 1017863 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_08860 1018156 1017977 gene locus_tag LOCUS_08870 1018156 1017977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1018815 1018327 gene locus_tag LOCUS_08880 1018815 1018327 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_08880 1019303 1020457 gene locus_tag LOCUS_08890 1019303 1020457 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_08890 1020540 1020749 gene locus_tag LOCUS_08900 1020540 1020749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1021043 1021255 gene locus_tag LOCUS_08910 1021043 1021255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1022414 1021179 gene locus_tag LOCUS_08920 1022414 1021179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1022337 1022741 gene locus_tag LOCUS_08930 1022337 1022741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1022873 1023205 gene locus_tag LOCUS_08940 1022873 1023205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1023338 1023961 gene locus_tag LOCUS_08950 1023338 1023961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1025130 1023928 gene locus_tag LOCUS_08960 1025130 1023928 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_08960 1025258 1026100 gene locus_tag LOCUS_08970 1025258 1026100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1026590 1026799 gene locus_tag LOCUS_08980 1026590 1026799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1026934 1027092 gene locus_tag LOCUS_08990 1026934 1027092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1027153 1027335 gene locus_tag LOCUS_09000 1027153 1027335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1027385 1028098 gene locus_tag LOCUS_09010 1027385 1028098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1028625 1028101 gene locus_tag LOCUS_09020 1028625 1028101 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704259.1 protein_id gnl|my_center|LOCUS_09020 1029311 1028646 gene locus_tag LOCUS_09030 1029311 1028646 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810039.1 protein_id gnl|my_center|LOCUS_09030 1030466 1029486 gene locus_tag LOCUS_09040 gene moaA 1030466 1029486 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 protein_id gnl|my_center|LOCUS_09040 1030707 1031249 gene locus_tag LOCUS_09050 1030707 1031249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 1031242 1032483 gene locus_tag LOCUS_09060 gene moeA 1031242 1032483 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397358.1 protein_id gnl|my_center|LOCUS_09060 1032832 1035264 gene locus_tag LOCUS_09070 gene dmsA 1032832 1035264 CDS product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850310.1 protein_id gnl|my_center|LOCUS_09070 1035278 1035904 gene locus_tag LOCUS_09080 gene dmsB 1035278 1035904 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483443.1 protein_id gnl|my_center|LOCUS_09080 1035901 1036740 gene locus_tag LOCUS_09090 1035901 1036740 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262982.1 protein_id gnl|my_center|LOCUS_09090 1036990 1037790 gene locus_tag LOCUS_09100 1036990 1037790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1039680 1037974 gene locus_tag LOCUS_09110 1039680 1037974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1041531 1040446 gene locus_tag LOCUS_09120 gene modC 1041531 1040446 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_09120 1042193 1041531 gene locus_tag LOCUS_09130 gene modB 1042193 1041531 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705491.1 protein_id gnl|my_center|LOCUS_09130 1042982 1042209 gene locus_tag LOCUS_09140 gene modA 1042982 1042209 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_09140 1043428 1042970 gene locus_tag LOCUS_09150 gene moaE 1043428 1042970 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_09150 1043682 1043431 gene locus_tag LOCUS_09160 gene moaD 1043682 1043431 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705488.1 protein_id gnl|my_center|LOCUS_09160 1044189 1043716 gene locus_tag LOCUS_09170 gene moaC 1044189 1043716 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 protein_id gnl|my_center|LOCUS_09170 1044710 1044186 gene locus_tag LOCUS_09180 gene moaB 1044710 1044186 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 protein_id gnl|my_center|LOCUS_09180 1045449 1044763 gene locus_tag LOCUS_09190 1045449 1044763 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_09190 1046449 1045460 gene locus_tag LOCUS_09200 1046449 1045460 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269211.1 protein_id gnl|my_center|LOCUS_09200 1048332 1046590 gene locus_tag LOCUS_09210 1048332 1046590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1049295 1048843 gene locus_tag LOCUS_09220 1049295 1048843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09220 1049629 1049312 gene locus_tag LOCUS_09230 1049629 1049312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09230 1050494 1049667 gene locus_tag LOCUS_09240 1050494 1049667 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_09240 1051247 1050657 gene locus_tag LOCUS_09250 1051247 1050657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1051414 1051328 gene locus_tag LOCUS_t00250 1051414 1051328 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1053196 1051796 gene locus_tag LOCUS_09260 1053196 1051796 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_09260 1053493 1054521 gene locus_tag LOCUS_09270 gene queA 1053493 1054521 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_09270 1054698 1055813 gene locus_tag LOCUS_09280 gene tgt 1054698 1055813 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_09280 1055925 1056257 gene locus_tag LOCUS_09290 gene yajC 1055925 1056257 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_09290 1056391 1058262 gene locus_tag LOCUS_09300 gene secD 1056391 1058262 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 protein_id gnl|my_center|LOCUS_09300 1058273 1059196 gene locus_tag LOCUS_09310 gene secF 1058273 1059196 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100612.1 protein_id gnl|my_center|LOCUS_09310 1060681 1061907 gene locus_tag LOCUS_09320 gene ltrA 1060681 1061907 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_09320 1062338 1063351 gene locus_tag LOCUS_09330 1062338 1063351 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 protein_id gnl|my_center|LOCUS_09330 1064506 1063514 gene locus_tag LOCUS_09340 1064506 1063514 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_09340 1066559 1065744 gene locus_tag LOCUS_09350 gene suhB 1066559 1065744 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_09350 1066880 1067683 gene locus_tag LOCUS_09360 gene trmJ 1066880 1067683 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_09360 1067727 1068521 gene locus_tag LOCUS_09370 gene cysE 1067727 1068521 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_09370 1068926 1069402 gene locus_tag LOCUS_09380 gene iscR 1068926 1069402 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_09380 1069502 1070716 gene locus_tag LOCUS_09390 1069502 1070716 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 protein_id gnl|my_center|LOCUS_09390 1070795 1071190 gene locus_tag LOCUS_09400 gene iscU 1070795 1071190 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117907.1 protein_id gnl|my_center|LOCUS_09400 1071245 1071568 gene locus_tag LOCUS_09410 gene iscA 1071245 1071568 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100617.1 protein_id gnl|my_center|LOCUS_09410 1071690 1072259 gene locus_tag LOCUS_09420 gene hscB 1071690 1072259 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_09420 1072289 1074154 gene locus_tag LOCUS_09430 gene hscA 1072289 1074154 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_09430 1074157 1074495 gene locus_tag LOCUS_09440 gene fdx 1074157 1074495 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_09440 1074537 1074737 gene locus_tag LOCUS_09450 gene iscX 1074537 1074737 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417922.1 protein_id gnl|my_center|LOCUS_09450 1075131 1074820 gene locus_tag LOCUS_09460 1075131 1074820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1075290 1075607 gene locus_tag LOCUS_09470 1075290 1075607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1076472 1075684 gene locus_tag LOCUS_09480 1076472 1075684 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 protein_id gnl|my_center|LOCUS_09480 1076446 1076622 gene locus_tag LOCUS_09490 1076446 1076622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1076878 1077153 gene locus_tag LOCUS_09500 1076878 1077153 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_09500 1077143 1077625 gene locus_tag LOCUS_09510 1077143 1077625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1079394 1077766 gene locus_tag LOCUS_09520 gene nadB 1079394 1077766 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_09520 1079868 1080077 gene locus_tag LOCUS_09530 1079868 1080077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1080071 1080655 gene locus_tag LOCUS_09540 gene rpoE 1080071 1080655 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_09540 1080760 1081452 gene locus_tag LOCUS_09550 gene mucA 1080760 1081452 CDS product anti-sigma factor MucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101958.1 protein_id gnl|my_center|LOCUS_09550 1081488 1082528 gene locus_tag LOCUS_09560 gene mucB 1081488 1082528 CDS product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 protein_id gnl|my_center|LOCUS_09560 1082528 1083010 gene locus_tag LOCUS_09570 gene mucC 1082528 1083010 CDS product alginate biosynthesis regulator MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_09570 1083409 1083621 gene locus_tag LOCUS_09580 1083409 1083621 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_09580 1084475 1085701 gene locus_tag LOCUS_09590 gene ltrA 1084475 1085701 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_09590 1086110 1087597 gene locus_tag LOCUS_09600 gene mucD 1086110 1087597 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_09600 1087820 1089619 gene locus_tag LOCUS_09610 gene lepA 1087820 1089619 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_09610 1089688 1090503 gene locus_tag LOCUS_09620 gene lepB 1089688 1090503 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090229819.1 protein_id gnl|my_center|LOCUS_09620 1090679 1091056 gene locus_tag LOCUS_09630 1090679 1091056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1091053 1091742 gene locus_tag LOCUS_09640 gene rnc 1091053 1091742 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 protein_id gnl|my_center|LOCUS_09640 1091739 1092689 gene locus_tag LOCUS_09650 gene era 1091739 1092689 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_09650 1092760 1093485 gene locus_tag LOCUS_09660 gene recO 1092760 1093485 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 protein_id gnl|my_center|LOCUS_09660 1093558 1094304 gene locus_tag LOCUS_09670 gene pdxJ 1093558 1094304 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946036.1 protein_id gnl|my_center|LOCUS_09670 1094301 1094678 gene locus_tag LOCUS_09680 gene acpS 1094301 1094678 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_09680 1096181 1094766 gene locus_tag LOCUS_09690 1096181 1094766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1099226 1096485 gene locus_tag LOCUS_09700 gene gacS 1099226 1096485 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_09700 1099568 1100236 gene locus_tag LOCUS_09710 1099568 1100236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1100493 1100326 gene locus_tag LOCUS_09720 1100493 1100326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1102150 1100750 gene locus_tag LOCUS_09730 1102150 1100750 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_09730 1104104 1102233 gene locus_tag LOCUS_09740 1104104 1102233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1105134 1104256 gene locus_tag LOCUS_09750 gene cysM 1105134 1104256 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_09750 1105325 1106521 gene locus_tag LOCUS_09760 1105325 1106521 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169958.1 protein_id gnl|my_center|LOCUS_09760 1106697 1106518 gene locus_tag LOCUS_09770 1106697 1106518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1106696 1107907 gene locus_tag LOCUS_09780 gene rlmD 1106696 1107907 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947185.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 1107912 1108085 gene locus_tag LOCUS_09790 1107912 1108085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09790 1108145 1110397 gene locus_tag LOCUS_09800 gene relA 1108145 1110397 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_09800 1110480 1111292 gene locus_tag LOCUS_09810 gene mazG 1110480 1111292 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 protein_id gnl|my_center|LOCUS_09810 1111362 1111793 gene locus_tag LOCUS_09820 1111362 1111793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1112898 1112254 gene locus_tag LOCUS_09830 1112898 1112254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1115321 1112964 gene locus_tag LOCUS_09840 1115321 1112964 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_09840 1117848 1115365 gene locus_tag LOCUS_09850 1117848 1115365 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400844.1 protein_id gnl|my_center|LOCUS_09850 1119021 1117852 gene locus_tag LOCUS_09860 1119021 1117852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1119147 1119578 gene locus_tag LOCUS_09870 gene tnpA 1119147 1119578 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_09870 1119862 1119557 gene locus_tag LOCUS_09880 1119862 1119557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1120336 1121673 gene locus_tag LOCUS_09890 1120336 1121673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1121775 1123139 gene locus_tag LOCUS_09900 gene melB 1121775 1123139 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_09900 1123373 1124011 gene locus_tag LOCUS_09910 1123373 1124011 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 protein_id gnl|my_center|LOCUS_09910 1124384 1124800 gene locus_tag LOCUS_09920 1124384 1124800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1125180 1124743 gene locus_tag LOCUS_09930 1125180 1124743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1125931 1125173 gene locus_tag LOCUS_09940 gene trmJ 1125931 1125173 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 protein_id gnl|my_center|LOCUS_09940 1126140 1128002 gene locus_tag LOCUS_09950 gene cydD 1126140 1128002 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075764720.1 protein_id gnl|my_center|LOCUS_09950 1127995 1129665 gene locus_tag LOCUS_09960 gene cydC 1127995 1129665 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261562.1 protein_id gnl|my_center|LOCUS_09960 1129672 1130304 gene locus_tag LOCUS_09970 1129672 1130304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1131151 1130309 gene locus_tag LOCUS_09980 1131151 1130309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1131773 1131312 gene locus_tag LOCUS_09990 1131773 1131312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1131928 1133355 gene locus_tag LOCUS_10000 1131928 1133355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1133684 1133379 gene locus_tag LOCUS_10010 1133684 1133379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1134085 1133852 gene locus_tag LOCUS_10020 1134085 1133852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1134547 1135266 gene locus_tag LOCUS_10030 1134547 1135266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1136865 1135228 gene locus_tag LOCUS_10040 1136865 1135228 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_10040 1136928 1137659 gene locus_tag LOCUS_10050 1136928 1137659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1138551 1137754 gene locus_tag LOCUS_10060 1138551 1137754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1138774 1138932 gene locus_tag LOCUS_10070 1138774 1138932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1141507 1138925 gene locus_tag LOCUS_10080 1141507 1138925 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454675.1 protein_id gnl|my_center|LOCUS_10080 1142590 1141604 gene locus_tag LOCUS_10090 1142590 1141604 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_10090 1142935 1143648 gene locus_tag LOCUS_10100 1142935 1143648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1143865 1144230 gene locus_tag LOCUS_10110 1143865 1144230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1144313 1144489 gene locus_tag LOCUS_10120 1144313 1144489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1144597 1146747 gene locus_tag LOCUS_10130 gene dinG 1144597 1146747 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 protein_id gnl|my_center|LOCUS_10130 1148899 1146779 gene locus_tag LOCUS_10140 1148899 1146779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1149456 1149190 gene locus_tag LOCUS_10150 1149456 1149190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1149938 1150900 gene locus_tag LOCUS_10160 gene prfB 1149938 1150900 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707133.1 protein_id gnl|my_center|LOCUS_10160 1150965 1152458 gene locus_tag LOCUS_10170 gene lysS 1150965 1152458 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266952.1 protein_id gnl|my_center|LOCUS_10170 1152811 1153581 gene locus_tag LOCUS_10180 1152811 1153581 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 protein_id gnl|my_center|LOCUS_10180 1154662 1153595 gene locus_tag LOCUS_10190 1154662 1153595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1154807 1155496 gene locus_tag LOCUS_10200 gene ung 1154807 1155496 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 protein_id gnl|my_center|LOCUS_10200 1156093 1155557 gene locus_tag LOCUS_10210 1156093 1155557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1157330 1156317 gene locus_tag LOCUS_10220 gene ansA 1157330 1156317 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_10220 1158812 1157400 gene locus_tag LOCUS_10230 gene nhaC 1158812 1157400 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938463.1 protein_id gnl|my_center|LOCUS_10230 1159092 1158796 gene locus_tag LOCUS_10240 1159092 1158796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1159827 1159204 gene locus_tag LOCUS_10250 1159827 1159204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1160176 1161147 gene locus_tag LOCUS_10260 1160176 1161147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1161537 1161175 gene locus_tag LOCUS_10270 1161537 1161175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1162354 1164483 gene locus_tag LOCUS_10280 1162354 1164483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1164480 1165502 gene locus_tag LOCUS_10290 1164480 1165502 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932918.1 protein_id gnl|my_center|LOCUS_10290 1165495 1166379 gene locus_tag LOCUS_10300 gene asrB 1165495 1166379 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706396.1 protein_id gnl|my_center|LOCUS_10300 1168513 1166486 gene locus_tag LOCUS_10310 gene recD 1168513 1166486 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261336.1 protein_id gnl|my_center|LOCUS_10310 1172169 1168513 gene locus_tag LOCUS_10320 gene recB 1172169 1168513 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 protein_id gnl|my_center|LOCUS_10320 1175561 1172166 gene locus_tag LOCUS_10330 gene recC 1175561 1172166 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 protein_id gnl|my_center|LOCUS_10330 1176038 1175754 gene locus_tag LOCUS_10340 1176038 1175754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1178087 1176099 gene locus_tag LOCUS_10350 1178087 1176099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1178372 1184269 gene locus_tag LOCUS_10360 1178372 1184269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1184319 1185497 gene locus_tag LOCUS_10370 1184319 1185497 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_10370 1185563 1185805 gene locus_tag LOCUS_10380 gene nqrM 1185563 1185805 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_10380 1185929 1187323 gene locus_tag LOCUS_10390 gene sthA 1185929 1187323 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_10390 1188272 1187364 gene locus_tag LOCUS_10400 1188272 1187364 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970114.1 protein_id gnl|my_center|LOCUS_10400 1188444 1189625 gene locus_tag LOCUS_10410 1188444 1189625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1191805 1189829 gene locus_tag LOCUS_10420 gene betT 1191805 1189829 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 protein_id gnl|my_center|LOCUS_10420 1192069 1193088 gene locus_tag LOCUS_10430 1192069 1193088 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339009.1 protein_id gnl|my_center|LOCUS_10430 1193106 1194005 gene locus_tag LOCUS_10440 1193106 1194005 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384671.1 protein_id gnl|my_center|LOCUS_10440 1193995 1195200 gene locus_tag LOCUS_10450 1193995 1195200 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_10450 1196037 1195204 gene locus_tag LOCUS_10460 1196037 1195204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1196878 1196183 gene locus_tag LOCUS_10470 1196878 1196183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1196959 1198704 gene locus_tag LOCUS_10480 1196959 1198704 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104833.1 protein_id gnl|my_center|LOCUS_10480 1198846 1198637 gene locus_tag LOCUS_10490 1198846 1198637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1199348 1198854 gene locus_tag LOCUS_10500 1199348 1198854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1200437 1199394 gene locus_tag LOCUS_10510 1200437 1199394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1200639 1200430 gene locus_tag LOCUS_10520 1200639 1200430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1201604 1200636 gene locus_tag LOCUS_10530 1201604 1200636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1202544 1201864 gene locus_tag LOCUS_10540 1202544 1201864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1202648 1202878 gene locus_tag LOCUS_10550 1202648 1202878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1202860 1203789 gene locus_tag LOCUS_10560 1202860 1203789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1203776 1205272 gene locus_tag LOCUS_10570 1203776 1205272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1205265 1205504 gene locus_tag LOCUS_10580 1205265 1205504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1205787 1206008 gene locus_tag LOCUS_10590 1205787 1206008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1205998 1206423 gene locus_tag LOCUS_10600 1205998 1206423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1206407 1206823 gene locus_tag LOCUS_10610 1206407 1206823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1206898 1207188 gene locus_tag LOCUS_10620 1206898 1207188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1207278 1207547 gene locus_tag LOCUS_10630 1207278 1207547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1207615 1208052 gene locus_tag LOCUS_10640 1207615 1208052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1208132 1208404 gene locus_tag LOCUS_10650 1208132 1208404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1208779 1208528 gene locus_tag LOCUS_10660 1208779 1208528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1209147 1208776 gene locus_tag LOCUS_10670 1209147 1208776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1210541 1209156 gene locus_tag LOCUS_10680 1210541 1209156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1214893 1210541 gene locus_tag LOCUS_10690 1214893 1210541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1215324 1214893 gene locus_tag LOCUS_10700 1215324 1214893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103839.1 protein_id gnl|my_center|LOCUS_10700 1215896 1215321 gene locus_tag LOCUS_10710 1215896 1215321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187598680.1 protein_id gnl|my_center|LOCUS_10710 1216498 1215896 gene locus_tag LOCUS_10720 1216498 1215896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1216632 1217168 gene locus_tag LOCUS_10730 1216632 1217168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1219511 1217169 gene locus_tag LOCUS_10740 1219511 1217169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1219878 1221101 gene locus_tag LOCUS_10750 1219878 1221101 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_10750 1221370 1221179 gene locus_tag LOCUS_10760 1221370 1221179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1221702 1221367 gene locus_tag LOCUS_10770 1221702 1221367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1222164 1221730 gene locus_tag LOCUS_10780 1222164 1221730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1222542 1222183 gene locus_tag LOCUS_10790 1222542 1222183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1223045 1222539 gene locus_tag LOCUS_10800 1223045 1222539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1223446 1223042 gene locus_tag LOCUS_10810 1223446 1223042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1223737 1223462 gene locus_tag LOCUS_10820 1223737 1223462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1224189 1223734 gene locus_tag LOCUS_10830 1224189 1223734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1224437 1224186 gene locus_tag LOCUS_10840 1224437 1224186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1224763 1224437 gene locus_tag LOCUS_10850 1224763 1224437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1224935 1224756 gene locus_tag LOCUS_10860 1224935 1224756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1226233 1224932 gene locus_tag LOCUS_10870 1226233 1224932 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938792.1 protein_id gnl|my_center|LOCUS_10870 1226842 1226276 gene locus_tag LOCUS_10880 1226842 1226276 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504184.1 protein_id gnl|my_center|LOCUS_10880 1226931 1227110 gene locus_tag LOCUS_10890 1226931 1227110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1227305 1227520 gene locus_tag LOCUS_10900 1227305 1227520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1228012 1227578 gene locus_tag LOCUS_10910 1228012 1227578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1229396 1228248 gene locus_tag LOCUS_10920 1229396 1228248 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_10920 1231288 1229612 gene locus_tag LOCUS_10930 1231288 1229612 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_10930 1231806 1231288 gene locus_tag LOCUS_10940 1231806 1231288 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938796.1 protein_id gnl|my_center|LOCUS_10940 1233018 1231951 gene locus_tag LOCUS_10950 1233018 1231951 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 1233588 1233286 gene locus_tag LOCUS_10960 1233588 1233286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1233766 1233572 gene locus_tag LOCUS_10970 1233766 1233572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1234613 1233951 gene locus_tag LOCUS_10980 1234613 1233951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1235050 1234841 gene locus_tag LOCUS_10990 1235050 1234841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344389.1 protein_id gnl|my_center|LOCUS_10990 1236488 1235487 gene locus_tag LOCUS_11000 1236488 1235487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1236958 1236764 gene locus_tag LOCUS_11010 1236958 1236764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1238007 1236955 gene locus_tag LOCUS_11020 1238007 1236955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1238309 1238004 gene locus_tag LOCUS_11030 1238309 1238004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1238470 1238306 gene locus_tag LOCUS_11040 1238470 1238306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1239245 1238697 gene locus_tag LOCUS_11050 1239245 1238697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1239584 1240657 gene locus_tag LOCUS_11060 1239584 1240657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1240760 1241668 gene locus_tag LOCUS_11070 1240760 1241668 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064705.1 protein_id gnl|my_center|LOCUS_11070 1242395 1241676 gene locus_tag LOCUS_11080 1242395 1241676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1242592 1243614 gene locus_tag LOCUS_11090 gene prmB 1242592 1243614 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_11090 1243707 1244807 gene locus_tag LOCUS_11100 gene aroC 1243707 1244807 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_11100 1245370 1244855 gene locus_tag LOCUS_11110 1245370 1244855 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951420.1 protein_id gnl|my_center|LOCUS_11110 1247343 1245535 gene locus_tag LOCUS_11120 1247343 1245535 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 protein_id gnl|my_center|LOCUS_11120 1247605 1248258 gene locus_tag LOCUS_11130 1247605 1248258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1249811 1248369 gene locus_tag LOCUS_11140 1249811 1248369 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421530.1 protein_id gnl|my_center|LOCUS_11140 1250913 1249933 gene locus_tag LOCUS_11150 1250913 1249933 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458694.1 protein_id gnl|my_center|LOCUS_11150 1252538 1251084 gene locus_tag LOCUS_11160 1252538 1251084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1253555 1252647 gene locus_tag LOCUS_11170 1253555 1252647 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_11170 1253695 1255110 gene locus_tag LOCUS_11180 gene leuC 1253695 1255110 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_11180 1255114 1255752 gene locus_tag LOCUS_11190 gene leuD 1255114 1255752 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_11190 1255840 1256916 gene locus_tag LOCUS_11200 gene leuB 1255840 1256916 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_11200 1256961 1258070 gene locus_tag LOCUS_11210 gene asd 1256961 1258070 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_11210 1258244 1259233 gene locus_tag LOCUS_11220 1258244 1259233 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706496.1 protein_id gnl|my_center|LOCUS_11220 1259528 1261813 gene locus_tag LOCUS_11230 1259528 1261813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1261894 1262700 gene locus_tag LOCUS_11240 gene truA 1261894 1262700 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091390.1 protein_id gnl|my_center|LOCUS_11240 1262788 1263516 gene locus_tag LOCUS_11250 1262788 1263516 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_11250 1263549 1264796 gene locus_tag LOCUS_11260 gene trpB 1263549 1264796 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_11260 1264809 1265609 gene locus_tag LOCUS_11270 gene trpA 1264809 1265609 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_11270 1265706 1266632 gene locus_tag LOCUS_11280 gene accD 1265706 1266632 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_11280 1266743 1268182 gene locus_tag LOCUS_11290 1266743 1268182 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_11290 1268204 1268806 gene locus_tag LOCUS_11300 1268204 1268806 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 protein_id gnl|my_center|LOCUS_11300 1268787 1272188 gene locus_tag LOCUS_11310 1268787 1272188 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_11310 1272190 1273374 gene locus_tag LOCUS_11320 1272190 1273374 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_11320 1273464 1274738 gene locus_tag LOCUS_11330 gene folC 1273464 1274738 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262248.1 protein_id gnl|my_center|LOCUS_11330 1275125 1276435 gene locus_tag LOCUS_11340 1275125 1276435 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_11340 1276432 1277802 gene locus_tag LOCUS_11350 gene cpsG 1276432 1277802 CDS product phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 protein_id gnl|my_center|LOCUS_11350 1277808 1278602 gene locus_tag LOCUS_11360 1277808 1278602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419153.1 protein_id gnl|my_center|LOCUS_11360 1278599 1279831 gene locus_tag LOCUS_11370 1278599 1279831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419151.1 protein_id gnl|my_center|LOCUS_11370 1279841 1281079 gene locus_tag LOCUS_11380 1279841 1281079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1281051 1282205 gene locus_tag LOCUS_11390 1281051 1282205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1282195 1283037 gene locus_tag LOCUS_11400 1282195 1283037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1283165 1283797 gene locus_tag LOCUS_11410 1283165 1283797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_11410 1283790 1284416 gene locus_tag LOCUS_11420 1283790 1284416 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769043.1 protein_id gnl|my_center|LOCUS_11420 1284422 1285153 gene locus_tag LOCUS_11430 1284422 1285153 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245498.1 protein_id gnl|my_center|LOCUS_11430 1285167 1285496 gene locus_tag LOCUS_11440 1285167 1285496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044391358.1 protein_id gnl|my_center|LOCUS_11440 1285493 1286221 gene locus_tag LOCUS_11450 1285493 1286221 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103245.1 protein_id gnl|my_center|LOCUS_11450 1286349 1287383 gene locus_tag LOCUS_11460 gene gmd 1286349 1287383 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_11460 1287383 1288273 gene locus_tag LOCUS_11470 1287383 1288273 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525198.1 protein_id gnl|my_center|LOCUS_11470 1288280 1289398 gene locus_tag LOCUS_11480 1288280 1289398 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_11480 1289398 1290528 gene locus_tag LOCUS_11490 1289398 1290528 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189296.1 protein_id gnl|my_center|LOCUS_11490 1290621 1291940 gene locus_tag LOCUS_11500 1290621 1291940 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934990.1 protein_id gnl|my_center|LOCUS_11500 1292766 1294649 gene locus_tag LOCUS_11510 1292766 1294649 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770766.1 protein_id gnl|my_center|LOCUS_11510 1295407 1294646 gene locus_tag LOCUS_11520 gene xni 1295407 1294646 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927567.1 protein_id gnl|my_center|LOCUS_11520 1296307 1295645 gene locus_tag LOCUS_11530 1296307 1295645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1296636 1297841 gene locus_tag LOCUS_11540 1296636 1297841 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_11540 1297941 1298840 gene locus_tag LOCUS_11550 1297941 1298840 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_11550 1298852 1299853 gene locus_tag LOCUS_11560 1298852 1299853 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_11560 1299855 1301936 gene locus_tag LOCUS_11570 1299855 1301936 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 protein_id gnl|my_center|LOCUS_11570 1303065 1301857 gene locus_tag LOCUS_11580 1303065 1301857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1303927 1303478 gene locus_tag LOCUS_11590 1303927 1303478 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074046.1 protein_id gnl|my_center|LOCUS_11590 1306586 1303995 gene locus_tag LOCUS_11600 gene acnB 1306586 1303995 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_11600 1307106 1306903 gene locus_tag LOCUS_11610 1307106 1306903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1307419 1307895 gene locus_tag LOCUS_11620 1307419 1307895 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_11620 1308014 1308574 gene locus_tag LOCUS_11630 gene yfcD 1308014 1308574 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815932.1 protein_id gnl|my_center|LOCUS_11630 1308631 1309242 gene locus_tag LOCUS_11640 1308631 1309242 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_11640 1313668 1309310 gene locus_tag LOCUS_11650 1313668 1309310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1316922 1313737 gene locus_tag LOCUS_11660 1316922 1313737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1319619 1317175 gene locus_tag LOCUS_11670 gene lon 1319619 1317175 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_11670 1319766 1320350 gene locus_tag LOCUS_11680 1319766 1320350 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_11680 1320374 1320565 gene locus_tag LOCUS_11690 1320374 1320565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1322447 1320813 gene locus_tag LOCUS_11700 1322447 1320813 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_11700 1322687 1322776 gene locus_tag LOCUS_t00260 1322687 1322776 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1322814 1322890 gene locus_tag LOCUS_t00270 1322814 1322890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1323698 1324924 gene locus_tag LOCUS_11710 gene ltrA 1323698 1324924 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_11710 1329529 1325093 gene locus_tag LOCUS_11720 gene mukB 1329529 1325093 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105766.1 protein_id gnl|my_center|LOCUS_11720 1330323 1329526 gene locus_tag LOCUS_11730 1330323 1329526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1331683 1330313 gene locus_tag LOCUS_11740 1331683 1330313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1333477 1331933 gene locus_tag LOCUS_11750 1333477 1331933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1334890 1333604 gene locus_tag LOCUS_11760 1334890 1333604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1334945 1335121 gene locus_tag LOCUS_11770 1334945 1335121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1336815 1335139 gene locus_tag LOCUS_11780 1336815 1335139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1337658 1336915 gene locus_tag LOCUS_11790 1337658 1336915 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_11790 1338394 1337651 gene locus_tag LOCUS_11800 1338394 1337651 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_11800 1339231 1338470 gene locus_tag LOCUS_11810 1339231 1338470 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_11810 1339468 1339899 gene locus_tag LOCUS_11820 gene tnpA 1339468 1339899 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_11820 1340058 1340588 gene locus_tag LOCUS_11830 1340058 1340588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1341134 1343785 gene locus_tag LOCUS_11840 gene gyrA 1341134 1343785 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314654.1 protein_id gnl|my_center|LOCUS_11840 1343895 1345028 gene locus_tag LOCUS_11850 gene serC 1343895 1345028 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057143.1 protein_id gnl|my_center|LOCUS_11850 1345118 1346203 gene locus_tag LOCUS_11860 gene pheA 1345118 1346203 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_11860 1346240 1347355 gene locus_tag LOCUS_11870 gene hisC 1346240 1347355 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_11870 1347355 1349610 gene locus_tag LOCUS_11880 1347355 1349610 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_11880 1349607 1350374 gene locus_tag LOCUS_11890 gene cmk 1349607 1350374 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 protein_id gnl|my_center|LOCUS_11890 1350643 1352319 gene locus_tag LOCUS_11900 gene rpsA 1350643 1352319 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_11900 1352567 1352899 gene locus_tag LOCUS_11910 gene ihfB 1352567 1352899 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_11910 1352916 1353296 gene locus_tag LOCUS_11920 1352916 1353296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1353296 1354474 gene locus_tag LOCUS_11930 gene lapB 1353296 1354474 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_11930 1354567 1354848 gene locus_tag LOCUS_11940 1354567 1354848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1354963 1355238 gene locus_tag LOCUS_11950 1354963 1355238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1355658 1355281 gene locus_tag LOCUS_11960 1355658 1355281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1356267 1356028 gene locus_tag LOCUS_11970 1356267 1356028 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072745.1 protein_id gnl|my_center|LOCUS_11970 1356548 1357618 gene locus_tag LOCUS_11980 1356548 1357618 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_11980 1357820 1360273 gene locus_tag LOCUS_11990 gene ftsK 1357820 1360273 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 protein_id gnl|my_center|LOCUS_11990 1360319 1361014 gene locus_tag LOCUS_12000 gene lolA 1360319 1361014 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946715.1 protein_id gnl|my_center|LOCUS_12000 1361021 1362352 gene locus_tag LOCUS_12010 1361021 1362352 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_12010 1363884 1364753 gene locus_tag LOCUS_12020 1363884 1364753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1366011 1364827 gene locus_tag LOCUS_12030 1366011 1364827 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876398.1 protein_id gnl|my_center|LOCUS_12030 1366482 1367669 gene locus_tag LOCUS_12040 1366482 1367669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1367865 1369151 gene locus_tag LOCUS_12050 gene serS 1367865 1369151 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_12050 1370640 1369234 gene locus_tag LOCUS_12060 1370640 1369234 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705189.1 protein_id gnl|my_center|LOCUS_12060 1372047 1372619 gene locus_tag LOCUS_12070 1372047 1372619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1375291 1374113 gene locus_tag LOCUS_12080 1375291 1374113 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_12080 1375874 1376203 gene locus_tag LOCUS_12090 1375874 1376203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1376286 1377686 gene locus_tag LOCUS_12100 1376286 1377686 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_12100 1378153 1378563 gene locus_tag LOCUS_12110 1378153 1378563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1378770 1380776 gene locus_tag LOCUS_12120 gene uvrB 1378770 1380776 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_12120 1380851 1380927 gene locus_tag LOCUS_t00280 1380851 1380927 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1381359 1381021 gene locus_tag LOCUS_12130 1381359 1381021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1381243 1381956 gene locus_tag LOCUS_12140 1381243 1381956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1381913 1382290 gene locus_tag LOCUS_12150 1381913 1382290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1382321 1382677 gene locus_tag LOCUS_12160 1382321 1382677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1382785 1383981 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccggaacctccctgactttgaagggattaagac 1384123 1384401 gene locus_tag LOCUS_12170 1384123 1384401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1384404 1385354 gene locus_tag LOCUS_12180 gene cas1 1384404 1385354 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_12180 1385344 1385664 gene locus_tag LOCUS_12190 gene cas2 1385344 1385664 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 protein_id gnl|my_center|LOCUS_12190 1385674 1386600 gene locus_tag LOCUS_12200 gene cas1 1385674 1386600 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_12200 1386942 1386661 gene locus_tag LOCUS_12210 1386942 1386661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1387384 1387115 gene locus_tag LOCUS_12220 1387384 1387115 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_12220 1387647 1387384 gene locus_tag LOCUS_12230 1387647 1387384 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_12230 1388002 1388604 gene locus_tag LOCUS_12240 1388002 1388604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1388714 1389034 gene locus_tag LOCUS_12250 1388714 1389034 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_12250 1389027 1389323 gene locus_tag LOCUS_12260 1389027 1389323 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099359.1 protein_id gnl|my_center|LOCUS_12260 1389373 1390091 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccttcaaagtcagggaagctccggaac 1391486 1390236 gene locus_tag LOCUS_12270 1391486 1390236 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_12270 1392397 1391489 gene locus_tag LOCUS_12280 gene cas6 1392397 1391489 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_12280 1393569 1392397 gene locus_tag LOCUS_12290 1393569 1392397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1394033 1393572 gene locus_tag LOCUS_12300 1394033 1393572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1394901 1394035 gene locus_tag LOCUS_12310 gene cmr4 1394901 1394035 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_12310 1396041 1394914 gene locus_tag LOCUS_12320 gene cmr3 1396041 1394914 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155321014.1 protein_id gnl|my_center|LOCUS_12320 1398060 1396105 gene locus_tag LOCUS_12330 1398060 1396105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1399219 1398050 gene locus_tag LOCUS_12340 1399219 1398050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1400422 1399256 gene locus_tag LOCUS_12350 1400422 1399256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1401249 1400569 gene locus_tag LOCUS_12360 1401249 1400569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1401956 1401336 gene locus_tag LOCUS_12370 1401956 1401336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1402113 1402406 gene locus_tag LOCUS_12380 1402113 1402406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12380 1402423 1402830 gene locus_tag LOCUS_12390 1402423 1402830 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173804.1 protein_id gnl|my_center|LOCUS_12390 1402947 1403939 gene locus_tag LOCUS_12400 1402947 1403939 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_12400 1404312 1404013 gene locus_tag LOCUS_12410 1404312 1404013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1404509 1404964 gene locus_tag LOCUS_12420 gene tnpA 1404509 1404964 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_12420 1404957 1406192 gene locus_tag LOCUS_12430 1404957 1406192 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_12430 1406983 1407435 gene locus_tag LOCUS_12440 1406983 1407435 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581517.1 protein_id gnl|my_center|LOCUS_12440 1407445 1408029 gene locus_tag LOCUS_12450 1407445 1408029 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124312.1 protein_id gnl|my_center|LOCUS_12450 1409113 1410120 gene locus_tag LOCUS_12460 1409113 1410120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1410665 1412092 gene locus_tag LOCUS_12470 1410665 1412092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1413810 1412176 gene locus_tag LOCUS_12480 1413810 1412176 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_12480 1414611 1413901 gene locus_tag LOCUS_12490 1414611 1413901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1415249 1414797 gene locus_tag LOCUS_12500 1415249 1414797 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019213468.1 protein_id gnl|my_center|LOCUS_12500 1416662 1416459 gene locus_tag LOCUS_12510 1416662 1416459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1416917 1418530 gene locus_tag LOCUS_12520 1416917 1418530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1418877 1419143 gene locus_tag LOCUS_12530 1418877 1419143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1419144 1419350 gene locus_tag LOCUS_12540 1419144 1419350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1419494 1419327 gene locus_tag LOCUS_12550 1419494 1419327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1419730 1420665 gene locus_tag LOCUS_12560 1419730 1420665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1422090 1420816 gene locus_tag LOCUS_12570 1422090 1420816 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_12570 1422405 1422094 gene locus_tag LOCUS_12580 1422405 1422094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1422602 1422793 gene locus_tag LOCUS_12590 1422602 1422793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1423796 1422756 gene locus_tag LOCUS_12600 1423796 1422756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1424266 1428027 gene locus_tag LOCUS_12610 1424266 1428027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1428138 1429499 gene locus_tag LOCUS_12620 1428138 1429499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1429603 1430181 gene locus_tag LOCUS_12630 1429603 1430181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1430227 1431009 gene locus_tag LOCUS_12640 1430227 1431009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1431615 1433885 gene locus_tag LOCUS_12650 1431615 1433885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1435634 1434126 gene locus_tag LOCUS_12660 1435634 1434126 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114786309.1 protein_id gnl|my_center|LOCUS_12660 1436192 1435830 gene locus_tag LOCUS_12670 1436192 1435830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1436591 1437979 gene locus_tag LOCUS_12680 1436591 1437979 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657823.1 protein_id gnl|my_center|LOCUS_12680 1438459 1438737 gene locus_tag LOCUS_12690 1438459 1438737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_12690 1438734 1439018 gene locus_tag LOCUS_12700 1438734 1439018 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_12700 1439481 1444343 gene locus_tag LOCUS_12710 1439481 1444343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1444975 1444547 gene locus_tag LOCUS_12720 1444975 1444547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1445410 1446843 gene locus_tag LOCUS_12730 1445410 1446843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_12730 1447529 1447191 gene locus_tag LOCUS_12740 1447529 1447191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1448766 1447735 gene locus_tag LOCUS_12750 1448766 1447735 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448174.1 protein_id gnl|my_center|LOCUS_12750 1449187 1448915 gene locus_tag LOCUS_12760 1449187 1448915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704401.1 protein_id gnl|my_center|LOCUS_12760 1451701 1449293 gene locus_tag LOCUS_12770 1451701 1449293 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_12770 1452001 1452549 gene locus_tag LOCUS_12780 1452001 1452549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1452595 1453023 gene locus_tag LOCUS_12790 1452595 1453023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1453128 1454420 gene locus_tag LOCUS_12800 1453128 1454420 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209214.1 protein_id gnl|my_center|LOCUS_12800 1455665 1454718 gene locus_tag LOCUS_12810 1455665 1454718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1457132 1456455 gene locus_tag LOCUS_12820 1457132 1456455 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_12820 1457266 1457934 gene locus_tag LOCUS_12830 1457266 1457934 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813004.1 protein_id gnl|my_center|LOCUS_12830 1457940 1459151 gene locus_tag LOCUS_12840 gene pncB 1457940 1459151 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228013.1 protein_id gnl|my_center|LOCUS_12840 1459625 1461772 gene locus_tag LOCUS_12850 gene dnaX 1459625 1461772 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_12850 1461833 1462159 gene locus_tag LOCUS_12860 1461833 1462159 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_12860 1462178 1462777 gene locus_tag LOCUS_12870 gene recR 1462178 1462777 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 protein_id gnl|my_center|LOCUS_12870 1463020 1464435 gene locus_tag LOCUS_12880 1463020 1464435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1465429 1464368 gene locus_tag LOCUS_12890 1465429 1464368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1465983 1466840 gene locus_tag LOCUS_12900 1465983 1466840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1466968 1467276 gene locus_tag LOCUS_12910 1466968 1467276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1467438 1468787 gene locus_tag LOCUS_12920 1467438 1468787 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071896.1 protein_id gnl|my_center|LOCUS_12920 1469145 1469069 gene locus_tag LOCUS_t00290 1469145 1469069 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1469290 1469445 gene locus_tag LOCUS_12930 1469290 1469445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1469393 1469995 gene locus_tag LOCUS_12940 1469393 1469995 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_12940 1470140 1471450 gene locus_tag LOCUS_12950 1470140 1471450 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097038.1 protein_id gnl|my_center|LOCUS_12950 1471454 1473661 gene locus_tag LOCUS_12960 1471454 1473661 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_12960 1474229 1473690 gene locus_tag LOCUS_12970 1474229 1473690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1474375 1474623 gene locus_tag LOCUS_12980 1474375 1474623 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004873700.1 protein_id gnl|my_center|LOCUS_12980 1475545 1474646 gene locus_tag LOCUS_12990 1475545 1474646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1476180 1475542 gene locus_tag LOCUS_13000 gene pdxH 1476180 1475542 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169486.1 protein_id gnl|my_center|LOCUS_13000 1477336 1476296 gene locus_tag LOCUS_13010 1477336 1476296 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963360.1 protein_id gnl|my_center|LOCUS_13010 1478780 1477482 gene locus_tag LOCUS_13020 1478780 1477482 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418543.1 protein_id gnl|my_center|LOCUS_13020 1478963 1479172 gene locus_tag LOCUS_13030 1478963 1479172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1479332 1482211 gene locus_tag LOCUS_13040 1479332 1482211 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_13040 1483726 1482302 gene locus_tag LOCUS_13050 1483726 1482302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1484123 1485259 gene locus_tag LOCUS_13060 1484123 1485259 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_13060 1486020 1485394 gene locus_tag LOCUS_13070 1486020 1485394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1487295 1486255 gene locus_tag LOCUS_13080 1487295 1486255 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804313.1 protein_id gnl|my_center|LOCUS_13080 1487622 1487855 gene locus_tag LOCUS_13090 1487622 1487855 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_13090 1487852 1490230 gene locus_tag LOCUS_13100 gene feoB 1487852 1490230 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_13100 1490211 1490459 gene locus_tag LOCUS_13110 1490211 1490459 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337004.1 protein_id gnl|my_center|LOCUS_13110 1491006 1490377 gene locus_tag LOCUS_13120 1491006 1490377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1492013 1491003 gene locus_tag LOCUS_13130 1492013 1491003 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123657.1 protein_id gnl|my_center|LOCUS_13130 1492198 1494030 gene locus_tag LOCUS_13140 gene fabY 1492198 1494030 CDS product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 protein_id gnl|my_center|LOCUS_13140 1494391 1495782 gene locus_tag LOCUS_13150 1494391 1495782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1496261 1496869 gene locus_tag LOCUS_13160 1496261 1496869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1496888 1497607 gene locus_tag LOCUS_13170 gene cobB 1496888 1497607 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191856.1 protein_id gnl|my_center|LOCUS_13170 1498703 1497732 gene locus_tag LOCUS_13180 1498703 1497732 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 protein_id gnl|my_center|LOCUS_13180 1499229 1498804 gene locus_tag LOCUS_13190 1499229 1498804 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090555.1 protein_id gnl|my_center|LOCUS_13190 1499552 1500886 gene locus_tag LOCUS_13200 1499552 1500886 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 protein_id gnl|my_center|LOCUS_13200 1501002 1501973 gene locus_tag LOCUS_13210 gene cysK 1501002 1501973 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_13210 1502262 1503182 gene locus_tag LOCUS_13220 1502262 1503182 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263064.1 protein_id gnl|my_center|LOCUS_13220 1503219 1503677 gene locus_tag LOCUS_13230 1503219 1503677 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529725.1 protein_id gnl|my_center|LOCUS_13230 1505475 1503781 gene locus_tag LOCUS_13240 1505475 1503781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1506499 1505519 gene locus_tag LOCUS_13250 1506499 1505519 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071820.1 protein_id gnl|my_center|LOCUS_13250 1507660 1506512 gene locus_tag LOCUS_13260 1507660 1506512 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_13260 1507989 1508930 gene locus_tag LOCUS_13270 1507989 1508930 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 protein_id gnl|my_center|LOCUS_13270 1509556 1508966 gene locus_tag LOCUS_13280 1509556 1508966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1509901 1510386 gene locus_tag LOCUS_13290 gene greB 1509901 1510386 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 protein_id gnl|my_center|LOCUS_13290 1510595 1511008 gene locus_tag LOCUS_13300 1510595 1511008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1512129 1511059 gene locus_tag LOCUS_13310 1512129 1511059 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_13310 1513028 1512339 gene locus_tag LOCUS_13320 1513028 1512339 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206645.1 protein_id gnl|my_center|LOCUS_13320 1513308 1514282 gene locus_tag LOCUS_13330 gene cysB 1513308 1514282 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_13330 1514681 1514385 gene locus_tag LOCUS_13340 1514681 1514385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087777.1 protein_id gnl|my_center|LOCUS_13340 1515197 1514874 gene locus_tag LOCUS_13350 1515197 1514874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1515326 1516885 gene locus_tag LOCUS_13360 1515326 1516885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707382.1 protein_id gnl|my_center|LOCUS_13360 1516943 1518016 gene locus_tag LOCUS_13370 1516943 1518016 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 protein_id gnl|my_center|LOCUS_13370 1518286 1522323 gene locus_tag LOCUS_13380 1518286 1522323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1523064 1522375 gene locus_tag LOCUS_13390 1523064 1522375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1523397 1523909 gene locus_tag LOCUS_13400 1523397 1523909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1524217 1525743 gene locus_tag LOCUS_13410 1524217 1525743 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009697454.1 protein_id gnl|my_center|LOCUS_13410 1525884 1527623 gene locus_tag LOCUS_13420 1525884 1527623 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_13420 1527620 1530952 gene locus_tag LOCUS_13430 1527620 1530952 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_13430 1531104 1532486 gene locus_tag LOCUS_13440 gene ppnN 1531104 1532486 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_13440 1533311 1532553 gene locus_tag LOCUS_13450 1533311 1532553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1533395 1535098 gene locus_tag LOCUS_13460 1533395 1535098 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_13460 1535623 1535060 gene locus_tag LOCUS_13470 1535623 1535060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1535758 1536939 gene locus_tag LOCUS_13480 1535758 1536939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1537018 1537338 gene locus_tag LOCUS_13490 1537018 1537338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1537401 1538309 gene locus_tag LOCUS_13500 1537401 1538309 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_13500 1539557 1538445 gene locus_tag LOCUS_13510 1539557 1538445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1540786 1539593 gene locus_tag LOCUS_13520 1540786 1539593 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_13520 1541018 1541641 gene locus_tag LOCUS_13530 1541018 1541641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1541696 1543009 gene locus_tag LOCUS_13540 1541696 1543009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1546854 1543315 gene locus_tag LOCUS_13550 1546854 1543315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 protein_id gnl|my_center|LOCUS_13550 1548112 1547042 gene locus_tag LOCUS_13560 1548112 1547042 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815525.1 protein_id gnl|my_center|LOCUS_13560 1548757 1548344 gene locus_tag LOCUS_13570 1548757 1548344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1549114 1548791 gene locus_tag LOCUS_13580 1549114 1548791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13580 1549804 1550946 gene locus_tag LOCUS_13590 1549804 1550946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1550966 1551757 gene locus_tag LOCUS_13600 1550966 1551757 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209330306.1 protein_id gnl|my_center|LOCUS_13600 1551849 1552364 gene locus_tag LOCUS_13610 1551849 1552364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1553040 1554401 gene locus_tag LOCUS_13620 1553040 1554401 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_13620 1555002 1556204 gene locus_tag LOCUS_13630 1555002 1556204 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_13630 1556201 1557187 gene locus_tag LOCUS_13640 1556201 1557187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1558698 1557337 gene locus_tag LOCUS_13650 1558698 1557337 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_13650 1559138 1559001 gene locus_tag LOCUS_13660 1559138 1559001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1559667 1559263 gene locus_tag LOCUS_13670 1559667 1559263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1559590 1560825 gene locus_tag LOCUS_13680 1559590 1560825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1561380 1560976 gene locus_tag LOCUS_13690 1561380 1560976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1561303 1562538 gene locus_tag LOCUS_13700 1561303 1562538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1562927 1563991 gene locus_tag LOCUS_13710 1562927 1563991 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_13710 1564224 1565021 gene locus_tag LOCUS_13720 1564224 1565021 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_13720 1565415 1566236 gene locus_tag LOCUS_13730 1565415 1566236 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_13730 1566527 1566451 gene locus_tag LOCUS_t00300 1566527 1566451 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1566847 1568322 gene locus_tag LOCUS_13740 1566847 1568322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1568537 1569343 gene locus_tag LOCUS_13750 1568537 1569343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1569987 1569391 gene locus_tag LOCUS_13760 1569987 1569391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1571361 1570036 gene locus_tag LOCUS_13770 1571361 1570036 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_13770 1575216 1571500 gene locus_tag LOCUS_13780 gene metH 1575216 1571500 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_13780 1576645 1575437 gene locus_tag LOCUS_13790 1576645 1575437 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536506.1 protein_id gnl|my_center|LOCUS_13790 1577689 1576886 gene locus_tag LOCUS_13800 1577689 1576886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1577966 1578907 gene locus_tag LOCUS_13810 gene glaH 1577966 1578907 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993092.1 protein_id gnl|my_center|LOCUS_13810 1578939 1580207 gene locus_tag LOCUS_13820 gene lhgO 1578939 1580207 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479979.1 protein_id gnl|my_center|LOCUS_13820 1580245 1580826 gene locus_tag LOCUS_13830 gene nfuA 1580245 1580826 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_13830 1581683 1580919 gene locus_tag LOCUS_13840 1581683 1580919 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262409.1 protein_id gnl|my_center|LOCUS_13840 1582176 1581778 gene locus_tag LOCUS_13850 1582176 1581778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1582475 1583197 gene locus_tag LOCUS_13860 1582475 1583197 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_13860 1583325 1585247 gene locus_tag LOCUS_13870 gene htpG 1583325 1585247 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_13870 1586474 1585323 gene locus_tag LOCUS_13880 1586474 1585323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1586702 1587610 gene locus_tag LOCUS_13890 1586702 1587610 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 protein_id gnl|my_center|LOCUS_13890 1588012 1587719 gene locus_tag LOCUS_13900 1588012 1587719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1588178 1588957 gene locus_tag LOCUS_13910 1588178 1588957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1589855 1589136 gene locus_tag LOCUS_13920 1589855 1589136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1591493 1590078 gene locus_tag LOCUS_13930 1591493 1590078 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446851.1 protein_id gnl|my_center|LOCUS_13930 1592937 1591663 gene locus_tag LOCUS_13940 1592937 1591663 CDS product serine/threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706270.1 protein_id gnl|my_center|LOCUS_13940 1593510 1593229 gene locus_tag LOCUS_13950 1593510 1593229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1593706 1593467 gene locus_tag LOCUS_13960 1593706 1593467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1594247 1593726 gene locus_tag LOCUS_13970 1594247 1593726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1594592 1595209 gene locus_tag LOCUS_13980 1594592 1595209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1596584 1595223 gene locus_tag LOCUS_13990 1596584 1595223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1596788 1597132 gene locus_tag LOCUS_14000 1596788 1597132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1598156 1597251 gene locus_tag LOCUS_14010 1598156 1597251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1599585 1598344 gene locus_tag LOCUS_14020 1599585 1598344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1600234 1599578 gene locus_tag LOCUS_14030 1600234 1599578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1600610 1600203 gene locus_tag LOCUS_14040 1600610 1600203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1601127 1600600 gene locus_tag LOCUS_14050 1601127 1600600 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_14050 1602469 1601120 gene locus_tag LOCUS_14060 1602469 1601120 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_14060 1603227 1602472 gene locus_tag LOCUS_14070 1603227 1602472 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819032.1 protein_id gnl|my_center|LOCUS_14070 1603563 1604426 gene locus_tag LOCUS_14080 gene yghU 1603563 1604426 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 protein_id gnl|my_center|LOCUS_14080 1604562 1604335 gene locus_tag LOCUS_14090 1604562 1604335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1605427 1604546 gene locus_tag LOCUS_14100 1605427 1604546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395918.1 protein_id gnl|my_center|LOCUS_14100 1605565 1606683 gene locus_tag LOCUS_14110 1605565 1606683 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_14110 1607009 1606680 gene locus_tag LOCUS_14120 1607009 1606680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1607931 1607023 gene locus_tag LOCUS_14130 1607931 1607023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1608924 1607989 gene locus_tag LOCUS_14140 1608924 1607989 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819964.1 protein_id gnl|my_center|LOCUS_14140 1609811 1609326 gene locus_tag LOCUS_14150 1609811 1609326 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_14150 1610196 1611578 gene locus_tag LOCUS_14160 1610196 1611578 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_14160 1614538 1611695 gene locus_tag LOCUS_14170 1614538 1611695 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693992.1 protein_id gnl|my_center|LOCUS_14170 1616260 1614605 gene locus_tag LOCUS_14180 1616260 1614605 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105053.1 protein_id gnl|my_center|LOCUS_14180 1617972 1616359 gene locus_tag LOCUS_14190 1617972 1616359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14190 1618672 1617962 gene locus_tag LOCUS_14200 1618672 1617962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 1618983 1618795 gene locus_tag LOCUS_14210 1618983 1618795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1619239 1619538 gene locus_tag LOCUS_14220 1619239 1619538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1621119 1619719 gene locus_tag LOCUS_14230 gene pabB 1621119 1619719 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765730.1 protein_id gnl|my_center|LOCUS_14230 1621373 1622218 gene locus_tag LOCUS_14240 gene prpB 1621373 1622218 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_14240 1622301 1623425 gene locus_tag LOCUS_14250 gene prpC 1622301 1623425 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070709.1 protein_id gnl|my_center|LOCUS_14250 1623512 1626121 gene locus_tag LOCUS_14260 gene acnD 1623512 1626121 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070708.1 protein_id gnl|my_center|LOCUS_14260 1626208 1627434 gene locus_tag LOCUS_14270 gene prpF 1626208 1627434 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_14270 1627685 1627479 gene locus_tag LOCUS_14280 1627685 1627479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1628433 1627672 gene locus_tag LOCUS_14290 1628433 1627672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1629463 1628642 gene locus_tag LOCUS_14300 1629463 1628642 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382474.1 protein_id gnl|my_center|LOCUS_14300 1629603 1632089 gene locus_tag LOCUS_14310 gene ppsA 1629603 1632089 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_14310 1635880 1632086 gene locus_tag LOCUS_14320 1635880 1632086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1637071 1637619 gene locus_tag LOCUS_14330 1637071 1637619 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268649.1 protein_id gnl|my_center|LOCUS_14330 1637659 1639119 gene locus_tag LOCUS_14340 1637659 1639119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1640171 1639170 gene locus_tag LOCUS_14350 1640171 1639170 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162996.1 protein_id gnl|my_center|LOCUS_14350 1642065 1640695 gene locus_tag LOCUS_14360 gene purB 1642065 1640695 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_14360 1644666 1643305 gene locus_tag LOCUS_14370 1644666 1643305 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_14370 1646436 1645825 gene locus_tag LOCUS_14380 gene hflD 1646436 1645825 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090440.1 protein_id gnl|my_center|LOCUS_14380 1647632 1646511 gene locus_tag LOCUS_14390 gene mnmA 1647632 1646511 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_14390 1648320 1647787 gene locus_tag LOCUS_14400 1648320 1647787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1649420 1648641 gene locus_tag LOCUS_14410 1649420 1648641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1650061 1649579 gene locus_tag LOCUS_14420 1650061 1649579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1652032 1650524 gene locus_tag LOCUS_14430 1652032 1650524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1652997 1655219 gene locus_tag LOCUS_14440 1652997 1655219 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_14440 1655562 1655918 gene locus_tag LOCUS_14450 gene clpS 1655562 1655918 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380148.1 protein_id gnl|my_center|LOCUS_14450 1655939 1658230 gene locus_tag LOCUS_14460 gene clpA 1655939 1658230 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_14460 1658535 1658317 gene locus_tag LOCUS_14470 gene infA 1658535 1658317 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_14470 1659376 1658669 gene locus_tag LOCUS_14480 1659376 1658669 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_14480 1660091 1659402 gene locus_tag LOCUS_14490 gene aat 1660091 1659402 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_14490 1660514 1660915 gene locus_tag LOCUS_14500 1660514 1660915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1661226 1661501 gene locus_tag LOCUS_14510 1661226 1661501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1662845 1662495 gene locus_tag LOCUS_14520 1662845 1662495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1662849 1663136 gene locus_tag LOCUS_14530 1662849 1663136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1663498 1663707 gene locus_tag LOCUS_14540 1663498 1663707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1663820 1664005 gene locus_tag LOCUS_14550 1663820 1664005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1664914 1664015 gene locus_tag LOCUS_14560 1664914 1664015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1668407 1664949 gene locus_tag LOCUS_14570 gene mfd 1668407 1664949 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_14570 1668630 1670066 gene locus_tag LOCUS_14580 1668630 1670066 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244218.1 protein_id gnl|my_center|LOCUS_14580 1670492 1673095 gene locus_tag LOCUS_14590 1670492 1673095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1673189 1673671 gene locus_tag LOCUS_14600 1673189 1673671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1673710 1674612 gene locus_tag LOCUS_14610 1673710 1674612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 1675339 1675022 gene locus_tag LOCUS_14620 1675339 1675022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1675526 1675314 gene locus_tag LOCUS_14630 1675526 1675314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1678313 1676661 gene locus_tag LOCUS_14640 1678313 1676661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087940.1 protein_id gnl|my_center|LOCUS_14640 1679348 1678317 gene locus_tag LOCUS_14650 1679348 1678317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_14650 1680443 1679355 gene locus_tag LOCUS_14660 1680443 1679355 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_14660 1682482 1680458 gene locus_tag LOCUS_14670 1682482 1680458 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_14670 1683680 1682682 gene locus_tag LOCUS_14680 1683680 1682682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1685042 1684263 gene locus_tag LOCUS_14690 1685042 1684263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1685683 1685201 gene locus_tag LOCUS_14700 1685683 1685201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1685815 1689399 gene locus_tag LOCUS_14710 1685815 1689399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1691262 1689412 gene locus_tag LOCUS_14720 1691262 1689412 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_14720 1693743 1691353 gene locus_tag LOCUS_14730 1693743 1691353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1695392 1693830 gene locus_tag LOCUS_14740 1695392 1693830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1697016 1695526 gene locus_tag LOCUS_14750 1697016 1695526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1698949 1697276 gene locus_tag LOCUS_14760 1698949 1697276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1701188 1699374 gene locus_tag LOCUS_14770 1701188 1699374 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267221.1 protein_id gnl|my_center|LOCUS_14770 1703043 1701181 gene locus_tag LOCUS_14780 1703043 1701181 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_14780 1704962 1703040 gene locus_tag LOCUS_14790 1704962 1703040 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 protein_id gnl|my_center|LOCUS_14790 1706518 1705022 gene locus_tag LOCUS_14800 1706518 1705022 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_14800 1707497 1706700 gene locus_tag LOCUS_14810 gene gloB 1707497 1706700 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 protein_id gnl|my_center|LOCUS_14810 1707737 1708567 gene locus_tag LOCUS_14820 1707737 1708567 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 protein_id gnl|my_center|LOCUS_14820 1709587 1710039 gene locus_tag LOCUS_14830 gene rnhA 1709587 1710039 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390802.1 protein_id gnl|my_center|LOCUS_14830 1710149 1712704 gene locus_tag LOCUS_14840 1710149 1712704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1712835 1713527 gene locus_tag LOCUS_14850 gene dnaQ 1712835 1713527 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_14850 1713901 1715298 gene locus_tag LOCUS_14860 1713901 1715298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1715393 1716181 gene locus_tag LOCUS_14870 gene nudC 1715393 1716181 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 protein_id gnl|my_center|LOCUS_14870 1716390 1717442 gene locus_tag LOCUS_14880 gene sohB 1716390 1717442 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_14880 1718693 1717521 gene locus_tag LOCUS_14890 1718693 1717521 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_14890 1719430 1718930 gene locus_tag LOCUS_14900 1719430 1718930 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_14900 1721069 1719411 gene locus_tag LOCUS_14910 1721069 1719411 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_14910 1721773 1721411 gene locus_tag LOCUS_14920 1721773 1721411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1723112 1721757 gene locus_tag LOCUS_14930 1723112 1721757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1724941 1723217 gene locus_tag LOCUS_14940 1724941 1723217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1727109 1725148 gene locus_tag LOCUS_14950 1727109 1725148 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_14950 1727254 1727508 gene locus_tag LOCUS_14960 1727254 1727508 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631987.1 protein_id gnl|my_center|LOCUS_14960 1727602 1728471 gene locus_tag LOCUS_14970 gene fieF 1727602 1728471 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712635.1 protein_id gnl|my_center|LOCUS_14970 1729240 1728449 gene locus_tag LOCUS_14980 1729240 1728449 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 protein_id gnl|my_center|LOCUS_14980 1729460 1730212 gene locus_tag LOCUS_14990 1729460 1730212 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_14990 1731040 1730222 gene locus_tag LOCUS_15000 gene xthA 1731040 1730222 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942186.1 protein_id gnl|my_center|LOCUS_15000 1733545 1731128 gene locus_tag LOCUS_15010 1733545 1731128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1733722 1734840 gene locus_tag LOCUS_15020 gene vexE 1733722 1734840 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_15020 1734845 1737976 gene locus_tag LOCUS_15030 gene vmeK 1734845 1737976 CDS product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_15030 1738589 1738416 gene locus_tag LOCUS_15040 1738589 1738416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1739011 1738601 gene locus_tag LOCUS_15050 1739011 1738601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1739140 1739367 gene locus_tag LOCUS_15060 1739140 1739367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1739436 1741622 gene locus_tag LOCUS_15070 1739436 1741622 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070968.1 protein_id gnl|my_center|LOCUS_15070 1741721 1742437 gene locus_tag LOCUS_15080 1741721 1742437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_15080 1742554 1743078 gene locus_tag LOCUS_15090 1742554 1743078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1743091 1743462 gene locus_tag LOCUS_15100 1743091 1743462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1743462 1743713 gene locus_tag LOCUS_15110 1743462 1743713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1743857 1744105 gene locus_tag LOCUS_15120 1743857 1744105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1744179 1744910 gene locus_tag LOCUS_15130 1744179 1744910 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_15130 1745364 1745666 gene locus_tag LOCUS_15140 1745364 1745666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1745663 1746337 gene locus_tag LOCUS_15150 1745663 1746337 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706579.1 protein_id gnl|my_center|LOCUS_15150 1746334 1746564 gene locus_tag LOCUS_15160 1746334 1746564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1746554 1747078 gene locus_tag LOCUS_15170 1746554 1747078 CDS product gp16 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214362.1 protein_id gnl|my_center|LOCUS_15170 1747075 1747455 gene locus_tag LOCUS_15180 1747075 1747455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1747468 1747887 gene locus_tag LOCUS_15190 1747468 1747887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1747978 1748493 gene locus_tag LOCUS_15200 1747978 1748493 CDS product N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072618.1 protein_id gnl|my_center|LOCUS_15200 1748490 1748828 gene locus_tag LOCUS_15210 1748490 1748828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1748831 1749058 gene locus_tag LOCUS_15220 1748831 1749058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1749048 1749371 gene locus_tag LOCUS_15230 1749048 1749371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1749375 1749668 gene locus_tag LOCUS_15240 1749375 1749668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_15240 1749774 1750343 gene locus_tag LOCUS_15250 1749774 1750343 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070988.1 protein_id gnl|my_center|LOCUS_15250 1750343 1750777 gene locus_tag LOCUS_15260 1750343 1750777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1750813 1752351 gene locus_tag LOCUS_15270 1750813 1752351 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072626.1 protein_id gnl|my_center|LOCUS_15270 1752348 1753943 gene locus_tag LOCUS_15280 1752348 1753943 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_15280 1753936 1754712 gene locus_tag LOCUS_15290 1753936 1754712 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072628.1 protein_id gnl|my_center|LOCUS_15290 1754709 1754867 gene locus_tag LOCUS_15300 1754709 1754867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1754860 1755120 gene locus_tag LOCUS_15310 1754860 1755120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1755157 1755681 gene locus_tag LOCUS_15320 1755157 1755681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1755859 1756092 gene locus_tag LOCUS_15330 1755859 1756092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1757700 1756066 gene locus_tag LOCUS_15340 1757700 1756066 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_15340 1757755 1758477 gene locus_tag LOCUS_15350 1757755 1758477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1758626 1759654 gene locus_tag LOCUS_15360 1758626 1759654 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072631.1 protein_id gnl|my_center|LOCUS_15360 1759701 1760603 gene locus_tag LOCUS_15370 1759701 1760603 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939979.1 protein_id gnl|my_center|LOCUS_15370 1760687 1761076 gene locus_tag LOCUS_15380 1760687 1761076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1761090 1761524 gene locus_tag LOCUS_15390 1761090 1761524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1761524 1761973 gene locus_tag LOCUS_15400 1761524 1761973 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072637.1 protein_id gnl|my_center|LOCUS_15400 1761952 1762509 gene locus_tag LOCUS_15410 1761952 1762509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1762493 1763086 gene locus_tag LOCUS_15420 1762493 1763086 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038105.1 protein_id gnl|my_center|LOCUS_15420 1763083 1763418 gene locus_tag LOCUS_15430 1763083 1763418 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244785.1 protein_id gnl|my_center|LOCUS_15430 1763418 1764320 gene locus_tag LOCUS_15440 1763418 1764320 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038101.1 protein_id gnl|my_center|LOCUS_15440 1764313 1765371 gene locus_tag LOCUS_15450 1764313 1765371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1765368 1766948 gene locus_tag LOCUS_15460 1765368 1766948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1767032 1767523 gene locus_tag LOCUS_15470 1767032 1767523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1767763 1768932 gene locus_tag LOCUS_15480 1767763 1768932 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 protein_id gnl|my_center|LOCUS_15480 1768932 1769438 gene locus_tag LOCUS_15490 1768932 1769438 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 protein_id gnl|my_center|LOCUS_15490 1769454 1769723 gene locus_tag LOCUS_15500 1769454 1769723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1769723 1769854 gene locus_tag LOCUS_15510 1769723 1769854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1770076 1769819 gene locus_tag LOCUS_15520 1770076 1769819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1770124 1772556 gene locus_tag LOCUS_15530 1770124 1772556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1772549 1772962 gene locus_tag LOCUS_15540 1772549 1772962 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 protein_id gnl|my_center|LOCUS_15540 1772959 1773162 gene locus_tag LOCUS_15550 1772959 1773162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1773153 1774139 gene locus_tag LOCUS_15560 1773153 1774139 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204752.1 protein_id gnl|my_center|LOCUS_15560 1775025 1775354 gene locus_tag LOCUS_15570 1775025 1775354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1775821 1775537 gene locus_tag LOCUS_15580 1775821 1775537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1776038 1777117 gene locus_tag LOCUS_15590 1776038 1777117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1777152 1778264 gene locus_tag LOCUS_15600 1777152 1778264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1778283 1778951 gene locus_tag LOCUS_15610 1778283 1778951 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_15610 1779192 1779992 gene locus_tag LOCUS_15620 1779192 1779992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1780116 1780436 gene locus_tag LOCUS_15630 1780116 1780436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1781832 1780549 gene locus_tag LOCUS_15640 1781832 1780549 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_15640 1782452 1781847 gene locus_tag LOCUS_15650 1782452 1781847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1782616 1783941 gene locus_tag LOCUS_15660 1782616 1783941 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 protein_id gnl|my_center|LOCUS_15660 1783956 1785503 gene locus_tag LOCUS_15670 1783956 1785503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_15670 1787646 1785532 gene locus_tag LOCUS_15680 1787646 1785532 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 protein_id gnl|my_center|LOCUS_15680 1787895 1787764 gene locus_tag LOCUS_15690 1787895 1787764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1788452 1787928 gene locus_tag LOCUS_15700 1788452 1787928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1788553 1788984 gene locus_tag LOCUS_15710 gene tnpA 1788553 1788984 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_15710 1791651 1789051 gene locus_tag LOCUS_15720 1791651 1789051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1790692 1790787 gene locus_tag LOCUS_t00310 1790692 1790787 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1791926 1793149 gene locus_tag LOCUS_15730 1791926 1793149 CDS product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 protein_id gnl|my_center|LOCUS_15730 1793213 1793881 gene locus_tag LOCUS_15740 1793213 1793881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1794684 1793914 gene locus_tag LOCUS_15750 1794684 1793914 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 protein_id gnl|my_center|LOCUS_15750 1795630 1794749 gene locus_tag LOCUS_15760 gene mmsB 1795630 1794749 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071832.1 protein_id gnl|my_center|LOCUS_15760 1796478 1795690 gene locus_tag LOCUS_15770 1796478 1795690 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_15770 1797635 1796475 gene locus_tag LOCUS_15780 1797635 1796475 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_15780 1799187 1797691 gene locus_tag LOCUS_15790 1799187 1797691 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_15790 1799428 1799862 gene locus_tag LOCUS_15800 1799428 1799862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1800336 1800263 gene locus_tag LOCUS_t00320 1800336 1800263 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1800460 1800387 gene locus_tag LOCUS_t00330 1800460 1800387 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1800895 1800719 gene locus_tag LOCUS_15810 1800895 1800719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1801019 1802353 gene locus_tag LOCUS_15820 gene brnQ 1801019 1802353 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261715.1 protein_id gnl|my_center|LOCUS_15820 1802606 1803190 gene locus_tag LOCUS_15830 1802606 1803190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1803267 1804070 gene locus_tag LOCUS_15840 1803267 1804070 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_15840 1805595 1804267 gene locus_tag LOCUS_15850 1805595 1804267 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_15850 1805950 1807446 gene locus_tag LOCUS_15860 1805950 1807446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1807746 1808048 gene locus_tag LOCUS_15870 1807746 1808048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15870 1810210 1808795 gene locus_tag LOCUS_15880 1810210 1808795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1811260 1810232 gene locus_tag LOCUS_15890 1811260 1810232 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_15890 1813396 1811693 gene locus_tag LOCUS_15900 1813396 1811693 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_15900 1814742 1813417 gene locus_tag LOCUS_15910 1814742 1813417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1815204 1814779 gene locus_tag LOCUS_15920 1815204 1814779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15920 1815826 1815335 gene locus_tag LOCUS_15930 1815826 1815335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1816118 1815975 gene locus_tag LOCUS_15940 1816118 1815975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1817534 1816506 gene locus_tag LOCUS_15950 1817534 1816506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1817765 1817571 gene locus_tag LOCUS_15960 1817765 1817571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1818265 1818912 gene locus_tag LOCUS_15970 1818265 1818912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1818946 1819572 gene locus_tag LOCUS_15980 1818946 1819572 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 protein_id gnl|my_center|LOCUS_15980 1822042 1819730 gene locus_tag LOCUS_15990 1822042 1819730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1822227 1822087 gene locus_tag LOCUS_16000 1822227 1822087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1822434 1822865 gene locus_tag LOCUS_16010 gene tnpA 1822434 1822865 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_16010 1825369 1822844 gene locus_tag LOCUS_16020 1825369 1822844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1825845 1830158 gene locus_tag LOCUS_16030 1825845 1830158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1830200 1832539 gene locus_tag LOCUS_16040 1830200 1832539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1832625 1833347 gene locus_tag LOCUS_16050 1832625 1833347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1834212 1833598 gene locus_tag LOCUS_16060 1834212 1833598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1834342 1834629 gene locus_tag LOCUS_16070 1834342 1834629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16070 1834646 1835098 gene locus_tag LOCUS_16080 1834646 1835098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16080 1837499 1835112 gene locus_tag LOCUS_16090 1837499 1835112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1837647 1838195 gene locus_tag LOCUS_16100 1837647 1838195 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042545835.1 protein_id gnl|my_center|LOCUS_16100 1838206 1838607 gene locus_tag LOCUS_16110 1838206 1838607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1839222 1838530 gene locus_tag LOCUS_16120 1839222 1838530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16120 1839792 1839238 gene locus_tag LOCUS_16130 1839792 1839238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16130 1840723 1840319 gene locus_tag LOCUS_16140 1840723 1840319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1840646 1841881 gene locus_tag LOCUS_16150 1840646 1841881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1842336 1842112 gene locus_tag LOCUS_16160 1842336 1842112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1842857 1844257 gene locus_tag LOCUS_16170 1842857 1844257 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_16170 1844809 1844459 gene locus_tag LOCUS_16180 1844809 1844459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1845303 1846703 gene locus_tag LOCUS_16190 1845303 1846703 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_16190 1847430 1848692 gene locus_tag LOCUS_16200 gene ltrA 1847430 1848692 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_16200 1849944 1851206 gene locus_tag LOCUS_16210 gene ltrA 1849944 1851206 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_16210 1851546 1851289 gene locus_tag LOCUS_16220 1851546 1851289 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_16220 1851824 1851555 gene locus_tag LOCUS_16230 1851824 1851555 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785693.1 protein_id gnl|my_center|LOCUS_16230 1853340 1852015 gene locus_tag LOCUS_16240 1853340 1852015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1854827 1853466 gene locus_tag LOCUS_16250 1854827 1853466 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_16250 1855793 1856899 gene locus_tag LOCUS_16260 1855793 1856899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 1857158 1857448 gene locus_tag LOCUS_16270 1857158 1857448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1858099 1859361 gene locus_tag LOCUS_16280 gene ltrA 1858099 1859361 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_16280 1859440 1859790 gene locus_tag LOCUS_16290 1859440 1859790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1860476 1861738 gene locus_tag LOCUS_16300 gene ltrA 1860476 1861738 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_16300 1862367 1861816 gene locus_tag LOCUS_16310 1862367 1861816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1862366 1862608 gene locus_tag LOCUS_16320 1862366 1862608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1862895 1863845 gene locus_tag LOCUS_16330 1862895 1863845 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_16330 1864751 1865146 gene locus_tag LOCUS_16340 1864751 1865146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1866010 1865171 gene locus_tag LOCUS_16350 1866010 1865171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1867570 1866017 gene locus_tag LOCUS_16360 1867570 1866017 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409202.1 protein_id gnl|my_center|LOCUS_16360 1867986 1867627 gene locus_tag LOCUS_16370 gene tnpB 1867986 1867627 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_16370 1868330 1867983 gene locus_tag LOCUS_16380 1868330 1867983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1870683 1868371 gene locus_tag LOCUS_16390 1870683 1868371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1870834 1872069 gene locus_tag LOCUS_16400 1870834 1872069 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_16400 1873019 1872657 gene locus_tag LOCUS_16410 1873019 1872657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1873748 1873038 gene locus_tag LOCUS_16420 1873748 1873038 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132600.1 protein_id gnl|my_center|LOCUS_16420 1874611 1875183 gene locus_tag LOCUS_16430 1874611 1875183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1875167 1876585 gene locus_tag LOCUS_16440 1875167 1876585 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 protein_id gnl|my_center|LOCUS_16440 1876587 1879874 gene locus_tag LOCUS_16450 1876587 1879874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1880260 1882677 gene locus_tag LOCUS_16460 gene trhC 1880260 1882677 CDS product IncHI-type conjugal transfer ATPase TrhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255538.1 protein_id gnl|my_center|LOCUS_16460 1883044 1884681 gene locus_tag LOCUS_16470 1883044 1884681 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_16470 1884732 1886681 gene locus_tag LOCUS_16480 1884732 1886681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1886678 1889500 gene locus_tag LOCUS_16490 1886678 1889500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1889997 1889491 gene locus_tag LOCUS_16500 1889997 1889491 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345473.1 protein_id gnl|my_center|LOCUS_16500 1890242 1889988 gene locus_tag LOCUS_16510 1890242 1889988 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801912.1 protein_id gnl|my_center|LOCUS_16510 1890322 1890603 gene locus_tag LOCUS_16520 1890322 1890603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1890600 1891154 gene locus_tag LOCUS_16530 1890600 1891154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1891175 1891960 gene locus_tag LOCUS_16540 1891175 1891960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1891983 1893152 gene locus_tag LOCUS_16550 1891983 1893152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1893608 1893949 gene locus_tag LOCUS_16560 1893608 1893949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1893952 1895163 gene locus_tag LOCUS_16570 1893952 1895163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1895150 1896985 gene locus_tag LOCUS_16580 gene traD 1895150 1896985 CDS product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 protein_id gnl|my_center|LOCUS_16580 1897008 1897628 gene locus_tag LOCUS_16590 1897008 1897628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1897628 1898482 gene locus_tag LOCUS_16600 gene traF 1897628 1898482 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 protein_id gnl|my_center|LOCUS_16600 1898495 1898779 gene locus_tag LOCUS_16610 1898495 1898779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1899832 1898792 gene locus_tag LOCUS_16620 1899832 1898792 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 protein_id gnl|my_center|LOCUS_16620 1900159 1900073 gene locus_tag LOCUS_t00340 1900159 1900073 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1900293 1900220 gene locus_tag LOCUS_t00350 1900293 1900220 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1900453 1900378 gene locus_tag LOCUS_t00360 1900453 1900378 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1901106 1900546 gene locus_tag LOCUS_16630 gene pgsA 1901106 1900546 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_16630 1903081 1901240 gene locus_tag LOCUS_16640 gene uvrC 1903081 1901240 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_16640 1903447 1903139 gene locus_tag LOCUS_16650 1903447 1903139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16650 1903834 1903499 gene locus_tag LOCUS_16660 1903834 1903499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16660 1904890 1903949 gene locus_tag LOCUS_16670 1904890 1903949 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_16670 1905639 1904890 gene locus_tag LOCUS_16680 1905639 1904890 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_16680 1906017 1907675 gene locus_tag LOCUS_16690 1906017 1907675 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 protein_id gnl|my_center|LOCUS_16690 1908326 1907760 gene locus_tag LOCUS_16700 1908326 1907760 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_16700 1908502 1909413 gene locus_tag LOCUS_16710 1908502 1909413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1909844 1910395 gene locus_tag LOCUS_16720 1909844 1910395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1912901 1912617 gene locus_tag LOCUS_16730 1912901 1912617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1915141 1913342 gene locus_tag LOCUS_16740 1915141 1913342 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_16740 1916277 1915252 gene locus_tag LOCUS_16750 1916277 1915252 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939321.1 protein_id gnl|my_center|LOCUS_16750 1917346 1916297 gene locus_tag LOCUS_16760 1917346 1916297 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_16760 1918499 1917450 gene locus_tag LOCUS_16770 1918499 1917450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1919508 1918522 gene locus_tag LOCUS_16780 1919508 1918522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1922037 1920706 gene locus_tag LOCUS_16790 1922037 1920706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1923015 1922137 gene locus_tag LOCUS_16800 1923015 1922137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1924432 1923953 gene locus_tag LOCUS_16810 1924432 1923953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1924591 1925520 gene locus_tag LOCUS_16820 1924591 1925520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1925513 1927615 gene locus_tag LOCUS_16830 1925513 1927615 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 protein_id gnl|my_center|LOCUS_16830 1927916 1928371 gene locus_tag LOCUS_16840 1927916 1928371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16840 1928335 1928610 gene locus_tag LOCUS_16850 1928335 1928610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1929917 1929015 gene locus_tag LOCUS_16860 1929917 1929015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16860 1930438 1929956 gene locus_tag LOCUS_16870 1930438 1929956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1930481 1931914 gene locus_tag LOCUS_16880 1930481 1931914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1933384 1933719 gene locus_tag LOCUS_16890 1933384 1933719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1933721 1934089 gene locus_tag LOCUS_16900 gene tnpB 1933721 1934089 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_16900 1934099 1935652 gene locus_tag LOCUS_16910 1934099 1935652 CDS product IS66-like element ISBj7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084592.1 protein_id gnl|my_center|LOCUS_16910 1936457 1937374 gene locus_tag LOCUS_16920 1936457 1937374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1937433 1939070 gene locus_tag LOCUS_16930 1937433 1939070 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_16930 1939083 1939358 gene locus_tag LOCUS_16940 1939083 1939358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1939568 1940278 gene locus_tag LOCUS_16950 1939568 1940278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1941550 1940303 gene locus_tag LOCUS_16960 gene ltrA 1941550 1940303 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_16960 1942103 1942597 gene locus_tag LOCUS_16970 1942103 1942597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1943308 1942526 gene locus_tag LOCUS_16980 1943308 1942526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1944987 1943482 gene locus_tag LOCUS_16990 1944987 1943482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1945726 1945094 gene locus_tag LOCUS_17000 1945726 1945094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1945888 1946340 gene locus_tag LOCUS_17010 1945888 1946340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1946685 1946533 gene locus_tag LOCUS_17020 1946685 1946533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1947093 1948796 gene locus_tag LOCUS_17030 1947093 1948796 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_17030 1948810 1949100 gene locus_tag LOCUS_17040 1948810 1949100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1949531 1949187 gene locus_tag LOCUS_17050 1949531 1949187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17050 1951651 1950416 gene locus_tag LOCUS_17060 1951651 1950416 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_17060 1952001 1952627 gene locus_tag LOCUS_17070 1952001 1952627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1953542 1956646 gene locus_tag LOCUS_17080 1953542 1956646 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_17080 1956640 1957761 gene locus_tag LOCUS_17090 1956640 1957761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1957864 1958754 gene locus_tag LOCUS_17100 1957864 1958754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1960241 1958880 gene locus_tag LOCUS_17110 1960241 1958880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1960348 1960863 gene locus_tag LOCUS_17120 1960348 1960863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1961032 1961550 gene locus_tag LOCUS_17130 1961032 1961550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1961543 1962859 gene locus_tag LOCUS_17140 1961543 1962859 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922229.1 protein_id gnl|my_center|LOCUS_17140 1962948 1964549 gene locus_tag LOCUS_17150 1962948 1964549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1965343 1965783 gene locus_tag LOCUS_17160 1965343 1965783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1965783 1966388 gene locus_tag LOCUS_17170 1965783 1966388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1966438 1966890 gene locus_tag LOCUS_17180 1966438 1966890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1966982 1967380 gene locus_tag LOCUS_17190 1966982 1967380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1967610 1967377 gene locus_tag LOCUS_17200 1967610 1967377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1967648 1968043 gene locus_tag LOCUS_17210 1967648 1968043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1968682 1968191 gene locus_tag LOCUS_17220 1968682 1968191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1969191 1968658 gene locus_tag LOCUS_17230 1969191 1968658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1969324 1969542 gene locus_tag LOCUS_17240 1969324 1969542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1969591 1970991 gene locus_tag LOCUS_17250 1969591 1970991 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_17250 1971163 1972224 gene locus_tag LOCUS_17260 gene istA 1971163 1972224 CDS product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 protein_id gnl|my_center|LOCUS_17260 1972224 1972985 gene locus_tag LOCUS_17270 gene istB 1972224 1972985 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_17270 1973352 1973071 gene locus_tag LOCUS_17280 1973352 1973071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1973644 1974156 gene locus_tag LOCUS_17290 1973644 1974156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1974210 1975847 gene locus_tag LOCUS_17300 1974210 1975847 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_17300 1975860 1976123 gene locus_tag LOCUS_17310 1975860 1976123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1976317 1976733 gene locus_tag LOCUS_17320 1976317 1976733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1977117 1977737 gene locus_tag LOCUS_17330 1977117 1977737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1978048 1979571 gene locus_tag LOCUS_17340 gene istA 1978048 1979571 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_17340 1979591 1980346 gene locus_tag LOCUS_17350 gene istB 1979591 1980346 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_17350 1980291 1981802 gene locus_tag LOCUS_17360 1980291 1981802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1986601 1982138 gene locus_tag LOCUS_17370 1986601 1982138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1987031 1986765 gene locus_tag LOCUS_17380 1987031 1986765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1987443 1987228 gene locus_tag LOCUS_17390 1987443 1987228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1987498 1988112 gene locus_tag LOCUS_17400 1987498 1988112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1989045 1988266 gene locus_tag LOCUS_17410 1989045 1988266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1989044 1990246 gene locus_tag LOCUS_17420 1989044 1990246 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_17420 1991154 1990213 gene locus_tag LOCUS_17430 1991154 1990213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1991570 1991211 gene locus_tag LOCUS_17440 gene tnpB 1991570 1991211 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_17440 1991908 1991567 gene locus_tag LOCUS_17450 1991908 1991567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1992551 1992946 gene locus_tag LOCUS_17460 1992551 1992946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17460 1992953 1993393 gene locus_tag LOCUS_17470 1992953 1993393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1994398 1993331 gene locus_tag LOCUS_17480 1994398 1993331 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_17480 1995627 1994662 gene locus_tag LOCUS_17490 1995627 1994662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1996625 1997257 gene locus_tag LOCUS_17500 1996625 1997257 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453500.1 protein_id gnl|my_center|LOCUS_17500 1997317 1998843 gene locus_tag LOCUS_17510 1997317 1998843 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_17510 1998870 1999472 gene locus_tag LOCUS_17520 1998870 1999472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1999929 1999675 gene locus_tag LOCUS_17530 1999929 1999675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2001163 2002800 gene locus_tag LOCUS_17540 2001163 2002800 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_17540 2003207 2002791 gene locus_tag LOCUS_17550 2003207 2002791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2003989 2005404 gene locus_tag LOCUS_17560 2003989 2005404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2005748 2005422 gene locus_tag LOCUS_17570 2005748 2005422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2006105 2005752 gene locus_tag LOCUS_17580 2006105 2005752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2006768 2006166 gene locus_tag LOCUS_17590 2006768 2006166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2007496 2007672 gene locus_tag LOCUS_17600 2007496 2007672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2009299 2009156 gene locus_tag LOCUS_17610 2009299 2009156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2009620 2009336 gene locus_tag LOCUS_17620 2009620 2009336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2010401 2009994 gene locus_tag LOCUS_17630 2010401 2009994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17630 2011941 2010970 gene locus_tag LOCUS_17640 2011941 2010970 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122320241.1 protein_id gnl|my_center|LOCUS_17640 2013589 2011931 gene locus_tag LOCUS_17650 2013589 2011931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2014190 2013579 gene locus_tag LOCUS_17660 2014190 2013579 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_17660 2014728 2014429 gene locus_tag LOCUS_17670 2014728 2014429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2014727 2017327 gene locus_tag LOCUS_17680 2014727 2017327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2017327 2017665 gene locus_tag LOCUS_17690 2017327 2017665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2018602 2021094 gene locus_tag LOCUS_17700 2018602 2021094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2021460 2022206 gene locus_tag LOCUS_17710 2021460 2022206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17710 2022203 2022349 gene locus_tag LOCUS_17720 2022203 2022349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17720 2024169 2022718 gene locus_tag LOCUS_17730 gene katB 2024169 2022718 CDS product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071324.1 protein_id gnl|my_center|LOCUS_17730 2025122 2024520 gene locus_tag LOCUS_17740 2025122 2024520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17740 2025370 2025074 gene locus_tag LOCUS_17750 2025370 2025074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17750 2025927 2025370 gene locus_tag LOCUS_17760 2025927 2025370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2026711 2026193 gene locus_tag LOCUS_17770 2026711 2026193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2027225 2027016 gene locus_tag LOCUS_17780 2027225 2027016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2027231 2027473 gene locus_tag LOCUS_17790 2027231 2027473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2027732 2029237 gene locus_tag LOCUS_17800 2027732 2029237 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551119.1 protein_id gnl|my_center|LOCUS_17800 2029258 2029797 gene locus_tag LOCUS_17810 2029258 2029797 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490844.1 protein_id gnl|my_center|LOCUS_17810 2033915 2031042 gene locus_tag LOCUS_17820 2033915 2031042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2034086 2034364 gene locus_tag LOCUS_17830 2034086 2034364 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246904.1 protein_id gnl|my_center|LOCUS_17830 2034391 2034843 gene locus_tag LOCUS_17840 2034391 2034843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 2035817 2036572 gene locus_tag LOCUS_17850 2035817 2036572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2036863 2037225 gene locus_tag LOCUS_17860 2036863 2037225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2037868 2037227 gene locus_tag LOCUS_17870 2037868 2037227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2038869 2037877 gene locus_tag LOCUS_17880 2038869 2037877 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_17880 2039485 2040045 gene locus_tag LOCUS_17890 2039485 2040045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2040128 2041444 gene locus_tag LOCUS_17900 2040128 2041444 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 protein_id gnl|my_center|LOCUS_17900 2041448 2044654 gene locus_tag LOCUS_17910 2041448 2044654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2044964 2044641 gene locus_tag LOCUS_17920 2044964 2044641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2045070 2047496 gene locus_tag LOCUS_17930 gene trhC 2045070 2047496 CDS product IncHI-type conjugal transfer ATPase TrhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255538.1 protein_id gnl|my_center|LOCUS_17930 2047607 2049406 gene locus_tag LOCUS_17940 2047607 2049406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2049485 2051122 gene locus_tag LOCUS_17950 2049485 2051122 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_17950 2051142 2053955 gene locus_tag LOCUS_17960 gene trhN 2051142 2053955 CDS product IncHI-type conjugal transfer protein TrhN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682729.1 protein_id gnl|my_center|LOCUS_17960 2054276 2053974 gene locus_tag LOCUS_17970 2054276 2053974 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_17970 2054526 2054281 gene locus_tag LOCUS_17980 2054526 2054281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2054590 2054871 gene locus_tag LOCUS_17990 2054590 2054871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2054868 2055422 gene locus_tag LOCUS_18000 2054868 2055422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2055456 2056226 gene locus_tag LOCUS_18010 2055456 2056226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2056240 2057418 gene locus_tag LOCUS_18020 2056240 2057418 CDS product TraB/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331475.1 protein_id gnl|my_center|LOCUS_18020 2057433 2057840 gene locus_tag LOCUS_18030 2057433 2057840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2057864 2058211 gene locus_tag LOCUS_18040 2057864 2058211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2058254 2059501 gene locus_tag LOCUS_18050 2058254 2059501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2059495 2061354 gene locus_tag LOCUS_18060 gene traD 2059495 2061354 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095172.1 protein_id gnl|my_center|LOCUS_18060 2061381 2062001 gene locus_tag LOCUS_18070 2061381 2062001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2062002 2062835 gene locus_tag LOCUS_18080 gene traF 2062002 2062835 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 protein_id gnl|my_center|LOCUS_18080 2062901 2063095 gene locus_tag LOCUS_18090 2062901 2063095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2063065 2064261 gene locus_tag LOCUS_18100 2063065 2064261 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040839.1 protein_id gnl|my_center|LOCUS_18100 2065400 2064702 gene locus_tag LOCUS_18110 2065400 2064702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2067373 2065601 gene locus_tag LOCUS_18120 2067373 2065601 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_18120 2068477 2067485 gene locus_tag LOCUS_18130 2068477 2067485 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_18130 2069475 2068474 gene locus_tag LOCUS_18140 2069475 2068474 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_18140 2070606 2069572 gene locus_tag LOCUS_18150 2070606 2069572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2071597 2070617 gene locus_tag LOCUS_18160 gene bet 2071597 2070617 CDS product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100829.1 protein_id gnl|my_center|LOCUS_18160 2072884 2071649 gene locus_tag LOCUS_18170 2072884 2071649 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_18170 2073358 2073669 gene locus_tag LOCUS_18180 2073358 2073669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2074662 2073646 gene locus_tag LOCUS_18190 2074662 2073646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2077418 2075394 gene locus_tag LOCUS_18200 gene brxL 2077418 2075394 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_18200 2080151 2077434 gene locus_tag LOCUS_18210 gene pglZ 2080151 2077434 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_18210 2080785 2080144 gene locus_tag LOCUS_18220 2080785 2080144 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105321.1 protein_id gnl|my_center|LOCUS_18220 2082038 2080782 gene locus_tag LOCUS_18230 2082038 2080782 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_18230 2085680 2082117 gene locus_tag LOCUS_18240 gene pglX 2085680 2082117 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_18240 2089367 2085702 gene locus_tag LOCUS_18250 gene brxC 2089367 2085702 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_18250 2090006 2089425 gene locus_tag LOCUS_18260 2090006 2089425 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_18260 2090602 2090003 gene locus_tag LOCUS_18270 2090602 2090003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2093541 2090947 gene locus_tag LOCUS_18280 2093541 2090947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2093771 2093550 gene locus_tag LOCUS_18290 2093771 2093550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2093658 2094140 gene locus_tag LOCUS_18300 2093658 2094140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2094299 2095078 gene locus_tag LOCUS_18310 2094299 2095078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2097047 2095764 gene locus_tag LOCUS_18320 gene umuC 2097047 2095764 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705911.1 protein_id gnl|my_center|LOCUS_18320 2097292 2097047 gene locus_tag LOCUS_18330 2097292 2097047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2097782 2098126 gene locus_tag LOCUS_18340 2097782 2098126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18340 2100534 2098213 gene locus_tag LOCUS_18350 2100534 2098213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2100836 2102359 gene locus_tag LOCUS_18360 gene istA 2100836 2102359 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_18360 2102379 2103134 gene locus_tag LOCUS_18370 gene istB 2102379 2103134 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_18370 2103537 2103154 gene locus_tag LOCUS_18380 2103537 2103154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2104858 2104472 gene locus_tag LOCUS_18390 2104858 2104472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2104913 2106547 gene locus_tag LOCUS_18400 2104913 2106547 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_18400 2107036 2106521 gene locus_tag LOCUS_18410 2107036 2106521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2107181 2107660 gene locus_tag LOCUS_18420 2107181 2107660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2108591 2108986 gene locus_tag LOCUS_18430 2108591 2108986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2112094 2109011 gene locus_tag LOCUS_18440 2112094 2109011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2112906 2113220 gene locus_tag LOCUS_18450 2112906 2113220 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839885.1 protein_id gnl|my_center|LOCUS_18450 2113327 2113959 gene locus_tag LOCUS_18460 2113327 2113959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2114902 2113988 gene locus_tag LOCUS_18470 2114902 2113988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2116182 2115166 gene locus_tag LOCUS_18480 2116182 2115166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2117224 2117844 gene locus_tag LOCUS_18490 2117224 2117844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2117841 2118542 gene locus_tag LOCUS_18500 2117841 2118542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_18500 2118542 2119237 gene locus_tag LOCUS_18510 2118542 2119237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2119676 2119338 gene locus_tag LOCUS_18520 2119676 2119338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2119751 2120032 gene locus_tag LOCUS_18530 2119751 2120032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2120029 2120583 gene locus_tag LOCUS_18540 2120029 2120583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2120604 2121389 gene locus_tag LOCUS_18550 2120604 2121389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2121412 2122587 gene locus_tag LOCUS_18560 2121412 2122587 CDS product TraB/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331475.1 protein_id gnl|my_center|LOCUS_18560 2122698 2123027 gene locus_tag LOCUS_18570 2122698 2123027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2123043 2123384 gene locus_tag LOCUS_18580 2123043 2123384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2123387 2124541 gene locus_tag LOCUS_18590 2123387 2124541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2124654 2124935 gene locus_tag LOCUS_18600 2124654 2124935 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070963.1 protein_id gnl|my_center|LOCUS_18600 2124932 2125426 gene locus_tag LOCUS_18610 2124932 2125426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982260.1 protein_id gnl|my_center|LOCUS_18610 2125517 2127340 gene locus_tag LOCUS_18620 gene traD 2125517 2127340 CDS product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 protein_id gnl|my_center|LOCUS_18620 2127363 2127983 gene locus_tag LOCUS_18630 2127363 2127983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2127983 2128846 gene locus_tag LOCUS_18640 gene traF 2127983 2128846 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 protein_id gnl|my_center|LOCUS_18640 2128881 2129069 gene locus_tag LOCUS_18650 2128881 2129069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2129039 2130334 gene locus_tag LOCUS_18660 2129039 2130334 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062683015.1 protein_id gnl|my_center|LOCUS_18660 2130417 2131451 gene locus_tag LOCUS_18670 2130417 2131451 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_18670 2131508 2132467 gene locus_tag LOCUS_18680 2131508 2132467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2133971 2132568 gene locus_tag LOCUS_18690 2133971 2132568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2134341 2134180 gene locus_tag LOCUS_18700 2134341 2134180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2134684 2136090 gene locus_tag LOCUS_18710 2134684 2136090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2137154 2136459 gene locus_tag LOCUS_18720 2137154 2136459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2138732 2138301 gene locus_tag LOCUS_18730 gene tnpA 2138732 2138301 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_18730 2140922 2139156 gene locus_tag LOCUS_18740 2140922 2139156 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_18740 2142023 2141040 gene locus_tag LOCUS_18750 2142023 2141040 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_18750 2143021 2142020 gene locus_tag LOCUS_18760 2143021 2142020 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_18760 2144152 2143118 gene locus_tag LOCUS_18770 2144152 2143118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2145138 2144164 gene locus_tag LOCUS_18780 gene bet 2145138 2144164 CDS product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100829.1 protein_id gnl|my_center|LOCUS_18780 2147407 2146016 gene locus_tag LOCUS_18790 2147407 2146016 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_18790 2147805 2148116 gene locus_tag LOCUS_18800 2147805 2148116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2149057 2148278 gene locus_tag LOCUS_18810 2149057 2148278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2149873 2150355 gene locus_tag LOCUS_18820 2149873 2150355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2150514 2151293 gene locus_tag LOCUS_18830 2150514 2151293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2151430 2151861 gene locus_tag LOCUS_18840 2151430 2151861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2152161 2151991 gene locus_tag LOCUS_18850 2152161 2151991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2152505 2152182 gene locus_tag LOCUS_18860 2152505 2152182 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 protein_id gnl|my_center|LOCUS_18860 2152839 2152537 gene locus_tag LOCUS_18870 2152839 2152537 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_18870 2153771 2152869 gene locus_tag LOCUS_18880 2153771 2152869 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_18880 2154746 2154048 gene locus_tag LOCUS_18890 2154746 2154048 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_18890 2155016 2155468 gene locus_tag LOCUS_18900 2155016 2155468 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444234.1 protein_id gnl|my_center|LOCUS_18900 2155520 2155798 gene locus_tag LOCUS_18910 2155520 2155798 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640710.1 protein_id gnl|my_center|LOCUS_18910 2155930 2156814 gene locus_tag LOCUS_18920 2155930 2156814 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508789.1 protein_id gnl|my_center|LOCUS_18920 2156811 2157587 gene locus_tag LOCUS_18930 2156811 2157587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2157608 2158063 gene locus_tag LOCUS_18940 2157608 2158063 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946402.1 protein_id gnl|my_center|LOCUS_18940 2159083 2160120 gene locus_tag LOCUS_18950 2159083 2160120 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267558.1 protein_id gnl|my_center|LOCUS_18950 2160460 2160170 gene locus_tag LOCUS_18960 2160460 2160170 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762682.1 protein_id gnl|my_center|LOCUS_18960 2160625 2161740 gene locus_tag LOCUS_18970 gene ribBA 2160625 2161740 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267655.1 protein_id gnl|my_center|LOCUS_18970 2162355 2161801 gene locus_tag LOCUS_18980 2162355 2161801 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267657.1 protein_id gnl|my_center|LOCUS_18980 2163163 2162411 gene locus_tag LOCUS_18990 2163163 2162411 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104136.1 protein_id gnl|my_center|LOCUS_18990 2163598 2163209 gene locus_tag LOCUS_19000 2163598 2163209 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_19000 2165056 2163611 gene locus_tag LOCUS_19010 gene gabD 2165056 2163611 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_19010 2165572 2165075 gene locus_tag LOCUS_19020 2165572 2165075 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382778.1 protein_id gnl|my_center|LOCUS_19020 2167114 2165636 gene locus_tag LOCUS_19030 2167114 2165636 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 protein_id gnl|my_center|LOCUS_19030 2167932 2167120 gene locus_tag LOCUS_19040 2167932 2167120 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_19040 2168538 2167945 gene locus_tag LOCUS_19050 2168538 2167945 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267660.1 protein_id gnl|my_center|LOCUS_19050 2170346 2168730 gene locus_tag LOCUS_19060 2170346 2168730 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_19060 2170638 2170985 gene locus_tag LOCUS_19070 2170638 2170985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2171662 2173995 gene locus_tag LOCUS_19080 2171662 2173995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2176272 2174893 gene locus_tag LOCUS_19090 2176272 2174893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2177901 2176396 gene locus_tag LOCUS_19100 2177901 2176396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2178363 2177995 gene locus_tag LOCUS_19110 2178363 2177995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2179464 2178481 gene locus_tag LOCUS_19120 2179464 2178481 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942805.1 protein_id gnl|my_center|LOCUS_19120 2180066 2179461 gene locus_tag LOCUS_19130 2180066 2179461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2182231 2180282 gene locus_tag LOCUS_19140 2182231 2180282 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272172.1 protein_id gnl|my_center|LOCUS_19140 2183072 2182725 gene locus_tag LOCUS_19150 2183072 2182725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2184105 2183062 gene locus_tag LOCUS_19160 2184105 2183062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2185096 2184116 gene locus_tag LOCUS_19170 2185096 2184116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2185594 2186469 gene locus_tag LOCUS_19180 gene arcC 2185594 2186469 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083065.1 protein_id gnl|my_center|LOCUS_19180 2186488 2187111 gene locus_tag LOCUS_19190 2186488 2187111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2190556 2187152 gene locus_tag LOCUS_19200 2190556 2187152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2192374 2191148 gene locus_tag LOCUS_19210 gene ltrA 2192374 2191148 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_19210 2192995 2193312 gene locus_tag LOCUS_19220 2192995 2193312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2194218 2193289 gene locus_tag LOCUS_19230 2194218 2193289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2194715 2194972 gene locus_tag LOCUS_19240 2194715 2194972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2194984 2195190 gene locus_tag LOCUS_19250 2194984 2195190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2196303 2195476 gene locus_tag LOCUS_19260 gene panB 2196303 2195476 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973079.1 protein_id gnl|my_center|LOCUS_19260 2196409 2198112 gene locus_tag LOCUS_19270 2196409 2198112 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_19270 2198783 2199160 gene locus_tag LOCUS_19280 2198783 2199160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2199455 2200810 gene locus_tag LOCUS_19290 2199455 2200810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2201058 2202122 gene locus_tag LOCUS_19300 2201058 2202122 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_19300 2202260 2202099 gene locus_tag LOCUS_19310 2202260 2202099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2202770 2203993 gene locus_tag LOCUS_19320 2202770 2203993 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_19320 2204709 2204443 gene locus_tag LOCUS_19330 2204709 2204443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2206402 2204699 gene locus_tag LOCUS_19340 2206402 2204699 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_19340 2206648 2207286 gene locus_tag LOCUS_19350 2206648 2207286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2207306 2208061 gene locus_tag LOCUS_19360 gene istB 2207306 2208061 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_19360 2208006 2208899 gene locus_tag LOCUS_19370 2208006 2208899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2210410 2209394 gene locus_tag LOCUS_19380 2210410 2209394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2213528 2211864 gene locus_tag LOCUS_19390 2213528 2211864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2214052 2213522 gene locus_tag LOCUS_19400 2214052 2213522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2214503 2214102 gene locus_tag LOCUS_19410 2214503 2214102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2215062 2214478 gene locus_tag LOCUS_19420 2215062 2214478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2215342 2215046 gene locus_tag LOCUS_19430 2215342 2215046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2216322 2215327 gene locus_tag LOCUS_19440 2216322 2215327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2216480 2216319 gene locus_tag LOCUS_19450 2216480 2216319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2217611 2216493 gene locus_tag LOCUS_19460 2217611 2216493 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 protein_id gnl|my_center|LOCUS_19460 2219256 2217856 gene locus_tag LOCUS_19470 2219256 2217856 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_19470 2219566 2219366 gene locus_tag LOCUS_19480 2219566 2219366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2221417 2219570 gene locus_tag LOCUS_19490 2221417 2219570 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_19490 2221905 2221414 gene locus_tag LOCUS_19500 2221905 2221414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2222059 2222232 gene locus_tag LOCUS_19510 2222059 2222232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2222251 2222730 gene locus_tag LOCUS_19520 2222251 2222730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2222727 2223068 gene locus_tag LOCUS_19530 2222727 2223068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2224025 2223657 gene locus_tag LOCUS_19540 2224025 2223657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2224465 2224022 gene locus_tag LOCUS_19550 2224465 2224022 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_19550 2224744 2224469 gene locus_tag LOCUS_19560 2224744 2224469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2225987 2224710 gene locus_tag LOCUS_19570 2225987 2224710 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_19570 2226540 2226175 gene locus_tag LOCUS_19580 2226540 2226175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2228966 2226861 gene locus_tag LOCUS_19590 2228966 2226861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2229642 2229019 gene locus_tag LOCUS_19600 2229642 2229019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2230487 2229639 gene locus_tag LOCUS_19610 2230487 2229639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2230963 2230487 gene locus_tag LOCUS_19620 2230963 2230487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2231181 2230960 gene locus_tag LOCUS_19630 2231181 2230960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2232661 2231414 gene locus_tag LOCUS_19640 gene ltrA 2232661 2231414 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_19640 2234469 2233243 gene locus_tag LOCUS_19650 gene ltrA 2234469 2233243 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_19650 2235090 2235242 gene locus_tag LOCUS_19660 2235090 2235242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2236549 2235323 gene locus_tag LOCUS_19670 gene ltrA 2236549 2235323 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_19670 2238253 2237360 gene locus_tag LOCUS_19680 2238253 2237360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2239547 2238324 gene locus_tag LOCUS_19690 2239547 2238324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2239734 2239916 gene locus_tag LOCUS_19700 2239734 2239916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2239913 2240347 gene locus_tag LOCUS_19710 2239913 2240347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2240344 2241681 gene locus_tag LOCUS_19720 2240344 2241681 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_19720 2241678 2242124 gene locus_tag LOCUS_19730 2241678 2242124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2243542 2242340 gene locus_tag LOCUS_19740 2243542 2242340 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_19740 2244532 2243720 gene locus_tag LOCUS_19750 2244532 2243720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2245435 2244959 gene locus_tag LOCUS_19760 2245435 2244959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2246479 2245706 gene locus_tag LOCUS_19770 2246479 2245706 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_19770 2247265 2246780 gene locus_tag LOCUS_19780 2247265 2246780 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_19780 2247696 2247436 gene locus_tag LOCUS_19790 2247696 2247436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2248038 2247736 gene locus_tag LOCUS_19800 2248038 2247736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2248650 2248051 gene locus_tag LOCUS_19810 2248650 2248051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2250290 2248890 gene locus_tag LOCUS_19820 2250290 2248890 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_19820 2251284 2251194 gene locus_tag LOCUS_t00370 2251284 2251194 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2251431 2251341 gene locus_tag LOCUS_t00380 2251431 2251341 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2251578 2251488 gene locus_tag LOCUS_t00390 2251578 2251488 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2251793 2252464 gene locus_tag LOCUS_19830 2251793 2252464 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_19830 2252542 2252934 gene locus_tag LOCUS_19840 gene tusD 2252542 2252934 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268263.1 protein_id gnl|my_center|LOCUS_19840 2252943 2253302 gene locus_tag LOCUS_19850 gene tusC 2252943 2253302 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072359.1 protein_id gnl|my_center|LOCUS_19850 2253302 2253589 gene locus_tag LOCUS_19860 gene tusB 2253302 2253589 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 protein_id gnl|my_center|LOCUS_19860 2253608 2253922 gene locus_tag LOCUS_19870 2253608 2253922 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_19870 2254049 2255023 gene locus_tag LOCUS_19880 2254049 2255023 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_19880 2255374 2255159 gene locus_tag LOCUS_19890 2255374 2255159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2256197 2255580 gene locus_tag LOCUS_19900 2256197 2255580 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275226.1 protein_id gnl|my_center|LOCUS_19900 2257128 2256295 gene locus_tag LOCUS_19910 2257128 2256295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2258663 2258223 gene locus_tag LOCUS_19920 2258663 2258223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2258998 2258666 gene locus_tag LOCUS_19930 2258998 2258666 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_19930 2260210 2259017 gene locus_tag LOCUS_19940 2260210 2259017 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463782.1 protein_id gnl|my_center|LOCUS_19940 2261315 2260296 gene locus_tag LOCUS_19950 gene nagZ 2261315 2260296 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104591.1 protein_id gnl|my_center|LOCUS_19950 2261851 2261363 gene locus_tag LOCUS_19960 2261851 2261363 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_19960 2262541 2261915 gene locus_tag LOCUS_19970 gene psrA 2262541 2261915 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245354.1 protein_id gnl|my_center|LOCUS_19970 2262707 2263306 gene locus_tag LOCUS_19980 gene lexA 2262707 2263306 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704040.1 protein_id gnl|my_center|LOCUS_19980 2263331 2263744 gene locus_tag LOCUS_19990 2263331 2263744 CDS product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245353.1 protein_id gnl|my_center|LOCUS_19990 2264012 2263767 gene locus_tag LOCUS_20000 2264012 2263767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2264632 2264147 gene locus_tag LOCUS_20010 2264632 2264147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2267379 2264731 gene locus_tag LOCUS_20020 gene topA 2267379 2264731 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091201.1 protein_id gnl|my_center|LOCUS_20020 2268406 2268023 gene locus_tag LOCUS_20030 2268406 2268023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2270049 2268412 gene locus_tag LOCUS_20040 2270049 2268412 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_20040 2270565 2270092 gene locus_tag LOCUS_20050 2270565 2270092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2271316 2272332 gene locus_tag LOCUS_20060 2271316 2272332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2273083 2272400 gene locus_tag LOCUS_20070 2273083 2272400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2273571 2273095 gene locus_tag LOCUS_20080 2273571 2273095 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634132.1 protein_id gnl|my_center|LOCUS_20080 2274605 2273625 gene locus_tag LOCUS_20090 2274605 2273625 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 protein_id gnl|my_center|LOCUS_20090 2275447 2274887 gene locus_tag LOCUS_20100 2275447 2274887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2276114 2277283 gene locus_tag LOCUS_20110 2276114 2277283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2277315 2277827 gene locus_tag LOCUS_20120 2277315 2277827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2278559 2277879 gene locus_tag LOCUS_20130 2278559 2277879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2278558 2279625 gene locus_tag LOCUS_20140 2278558 2279625 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_20140 2281271 2279871 gene locus_tag LOCUS_20150 2281271 2279871 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_20150 2282087 2282935 gene locus_tag LOCUS_20160 2282087 2282935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2284234 2283059 gene locus_tag LOCUS_20170 gene fadA 2284234 2283059 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113978.1 protein_id gnl|my_center|LOCUS_20170 2286429 2284279 gene locus_tag LOCUS_20180 gene fadB 2286429 2284279 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_20180 2286758 2287213 gene locus_tag LOCUS_20190 2286758 2287213 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_20190 2287313 2287861 gene locus_tag LOCUS_20200 2287313 2287861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2289768 2287858 gene locus_tag LOCUS_20210 2289768 2287858 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_20210 2290260 2290913 gene locus_tag LOCUS_20220 2290260 2290913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2291502 2290945 gene locus_tag LOCUS_20230 2291502 2290945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2292015 2291572 gene locus_tag LOCUS_20240 gene sixA 2292015 2291572 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_20240 2292364 2292071 gene locus_tag LOCUS_20250 2292364 2292071 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_20250 2293413 2292385 gene locus_tag LOCUS_20260 2293413 2292385 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769608.1 protein_id gnl|my_center|LOCUS_20260 2293811 2294377 gene locus_tag LOCUS_20270 gene fabA 2293811 2294377 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_20270 2294407 2295624 gene locus_tag LOCUS_20280 gene fabB 2294407 2295624 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_20280 2296090 2297040 gene locus_tag LOCUS_20290 2296090 2297040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2298126 2297281 gene locus_tag LOCUS_20300 2298126 2297281 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_20300 2299546 2298239 gene locus_tag LOCUS_20310 2299546 2298239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2300466 2299672 gene locus_tag LOCUS_20320 gene phhA 2300466 2299672 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114241.1 protein_id gnl|my_center|LOCUS_20320 2301557 2300469 gene locus_tag LOCUS_20330 gene hppD 2301557 2300469 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083171.1 protein_id gnl|my_center|LOCUS_20330 2301950 2302507 gene locus_tag LOCUS_20340 2301950 2302507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2304517 2302610 gene locus_tag LOCUS_20350 2304517 2302610 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_20350 2305154 2304879 gene locus_tag LOCUS_20360 gene hupB 2305154 2304879 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_20360 2308144 2305727 gene locus_tag LOCUS_20370 gene lon 2308144 2305727 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_20370 2309492 2309181 gene locus_tag LOCUS_20380 2309492 2309181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2309979 2311346 gene locus_tag LOCUS_20390 gene dcuC 2309979 2311346 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891426.1 protein_id gnl|my_center|LOCUS_20390 2311566 2312525 gene locus_tag LOCUS_20400 2311566 2312525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2313918 2312608 gene locus_tag LOCUS_20410 gene clpX 2313918 2312608 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_20410 2314823 2314188 gene locus_tag LOCUS_20420 gene clpP 2314823 2314188 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_20420 2316427 2315057 gene locus_tag LOCUS_20430 gene tig 2316427 2315057 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 protein_id gnl|my_center|LOCUS_20430 2316779 2316695 gene locus_tag LOCUS_t00400 2316779 2316695 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2316954 2316879 gene locus_tag LOCUS_t00410 2316954 2316879 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2317069 2316993 gene locus_tag LOCUS_t00420 2317069 2316993 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2317218 2317142 gene locus_tag LOCUS_t00430 2317218 2317142 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2317591 2318445 gene locus_tag LOCUS_20440 gene folD 2317591 2318445 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_20440 2318767 2319807 gene locus_tag LOCUS_20450 2318767 2319807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2320148 2319897 gene locus_tag LOCUS_20460 2320148 2319897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2321889 2320165 gene locus_tag LOCUS_20470 2321889 2320165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2323066 2322116 gene locus_tag LOCUS_20480 2323066 2322116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2324690 2323308 gene locus_tag LOCUS_20490 gene cysS 2324690 2323308 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_20490 2326449 2324779 gene locus_tag LOCUS_20500 2326449 2324779 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_20500 2326694 2327671 gene locus_tag LOCUS_20510 2326694 2327671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2327800 2328291 gene locus_tag LOCUS_20520 2327800 2328291 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_20520 2328292 2329011 gene locus_tag LOCUS_20530 gene lpxH 2328292 2329011 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_20530 2329433 2329074 gene locus_tag LOCUS_20540 2329433 2329074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2330150 2329518 gene locus_tag LOCUS_20550 gene miaE 2330150 2329518 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104701.1 protein_id gnl|my_center|LOCUS_20550 2332083 2330518 gene locus_tag LOCUS_20560 2332083 2330518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2332162 2332596 gene locus_tag LOCUS_20570 2332162 2332596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2332982 2333176 gene locus_tag LOCUS_20580 2332982 2333176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2333214 2333531 gene locus_tag LOCUS_20590 2333214 2333531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20590 2333548 2334000 gene locus_tag LOCUS_20600 2333548 2334000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20600 2334061 2334624 gene locus_tag LOCUS_20610 2334061 2334624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2334631 2337765 gene locus_tag LOCUS_20620 2334631 2337765 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_20620 2337894 2338754 gene locus_tag LOCUS_20630 gene uspE 2337894 2338754 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262143.1 protein_id gnl|my_center|LOCUS_20630 2338924 2340324 gene locus_tag LOCUS_20640 2338924 2340324 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_20640 2341294 2340707 gene locus_tag LOCUS_20650 2341294 2340707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 2342351 2341359 gene locus_tag LOCUS_20660 2342351 2341359 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_20660 2343192 2342455 gene locus_tag LOCUS_20670 2343192 2342455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2344103 2343444 gene locus_tag LOCUS_20680 2344103 2343444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2344209 2345201 gene locus_tag LOCUS_20690 2344209 2345201 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_20690 2346724 2345204 gene locus_tag LOCUS_20700 2346724 2345204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2347481 2347963 gene locus_tag LOCUS_20710 2347481 2347963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2348122 2348901 gene locus_tag LOCUS_20720 2348122 2348901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2349447 2351609 gene locus_tag LOCUS_20730 2349447 2351609 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 protein_id gnl|my_center|LOCUS_20730 2351606 2352976 gene locus_tag LOCUS_20740 2351606 2352976 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_20740 2353226 2360680 gene locus_tag LOCUS_20750 2353226 2360680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2360785 2361057 gene locus_tag LOCUS_20760 2360785 2361057 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_20760 2361643 2361314 gene locus_tag LOCUS_20770 2361643 2361314 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035759.1 protein_id gnl|my_center|LOCUS_20770 2362989 2361757 gene locus_tag LOCUS_20780 2362989 2361757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2364241 2362994 gene locus_tag LOCUS_20790 2364241 2362994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2365968 2364496 gene locus_tag LOCUS_20800 2365968 2364496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2369452 2366357 gene locus_tag LOCUS_20810 2369452 2366357 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_20810 2370522 2369452 gene locus_tag LOCUS_20820 gene vexC 2370522 2369452 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 protein_id gnl|my_center|LOCUS_20820 2370710 2371753 gene locus_tag LOCUS_20830 2370710 2371753 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_20830 2372560 2371892 gene locus_tag LOCUS_20840 2372560 2371892 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_20840 2372849 2374225 gene locus_tag LOCUS_20850 gene dcuC 2372849 2374225 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705380.1 protein_id gnl|my_center|LOCUS_20850 2374956 2374342 gene locus_tag LOCUS_20860 2374956 2374342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2375547 2376608 gene locus_tag LOCUS_20870 2375547 2376608 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_20870 2376605 2379160 gene locus_tag LOCUS_20880 2376605 2379160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2379373 2379843 gene locus_tag LOCUS_20890 2379373 2379843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2380044 2380325 gene locus_tag LOCUS_20900 2380044 2380325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2380518 2380901 gene locus_tag LOCUS_20910 2380518 2380901 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_20910 2380999 2381580 gene locus_tag LOCUS_20920 2380999 2381580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2381866 2381588 gene locus_tag LOCUS_20930 2381866 2381588 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373489.1 protein_id gnl|my_center|LOCUS_20930 2383098 2381914 gene locus_tag LOCUS_20940 2383098 2381914 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_20940 2383500 2383222 gene locus_tag LOCUS_20950 2383500 2383222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2385824 2383674 gene locus_tag LOCUS_20960 gene ovoA 2385824 2383674 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704222.1 protein_id gnl|my_center|LOCUS_20960 2387319 2386234 gene locus_tag LOCUS_20970 2387319 2386234 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430586.1 protein_id gnl|my_center|LOCUS_20970 2387957 2388496 gene locus_tag LOCUS_20980 2387957 2388496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2391203 2388543 gene locus_tag LOCUS_20990 2391203 2388543 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488937.1 protein_id gnl|my_center|LOCUS_20990 2393293 2391407 gene locus_tag LOCUS_21000 gene nadN 2393293 2391407 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_21000 2394737 2393409 gene locus_tag LOCUS_21010 2394737 2393409 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071444.1 protein_id gnl|my_center|LOCUS_21010 2395587 2396363 gene locus_tag LOCUS_21020 gene deoC 2395587 2396363 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 protein_id gnl|my_center|LOCUS_21020 2396365 2397684 gene locus_tag LOCUS_21030 gene deoA 2396365 2397684 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707412.1 protein_id gnl|my_center|LOCUS_21030 2398101 2397808 gene locus_tag LOCUS_21040 2398101 2397808 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073879.1 protein_id gnl|my_center|LOCUS_21040 2398535 2399242 gene locus_tag LOCUS_21050 gene deoD 2398535 2399242 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707410.1 protein_id gnl|my_center|LOCUS_21050 2399301 2400527 gene locus_tag LOCUS_21060 gene deoB 2399301 2400527 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 protein_id gnl|my_center|LOCUS_21060 2400524 2401477 gene locus_tag LOCUS_21070 gene tal 2400524 2401477 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463537.1 protein_id gnl|my_center|LOCUS_21070 2401877 2402656 gene locus_tag LOCUS_21080 2401877 2402656 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208648.1 protein_id gnl|my_center|LOCUS_21080 2403207 2402911 gene locus_tag LOCUS_21090 2403207 2402911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2403343 2404647 gene locus_tag LOCUS_21100 2403343 2404647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2405379 2404777 gene locus_tag LOCUS_21110 2405379 2404777 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420789.1 protein_id gnl|my_center|LOCUS_21110 2406796 2405498 gene locus_tag LOCUS_21120 gene grdB 2406796 2405498 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957155.1 transl_except (pos:complement(2405750..2405752),aa:Sec) note codon on position 349 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_21120 2408148 2406856 gene locus_tag LOCUS_21130 2408148 2406856 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948884.1 protein_id gnl|my_center|LOCUS_21130 2409356 2408196 gene locus_tag LOCUS_21140 gene grdD 2409356 2408196 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956704.1 protein_id gnl|my_center|LOCUS_21140 2410909 2409362 gene locus_tag LOCUS_21150 gene grdC 2410909 2409362 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681153.1 protein_id gnl|my_center|LOCUS_21150 2411445 2411119 gene locus_tag LOCUS_21160 2411445 2411119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2412057 2411740 gene locus_tag LOCUS_21170 2412057 2411740 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869886.1 protein_id gnl|my_center|LOCUS_21170 2413285 2412080 gene locus_tag LOCUS_21180 2413285 2412080 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_21180 2414192 2414743 gene locus_tag LOCUS_21190 2414192 2414743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2415193 2416314 gene locus_tag LOCUS_21200 2415193 2416314 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_21200 2416513 2416965 gene locus_tag LOCUS_21210 gene wzb 2416513 2416965 CDS product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 protein_id gnl|my_center|LOCUS_21210 2417035 2419251 gene locus_tag LOCUS_21220 2417035 2419251 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458358.1 protein_id gnl|my_center|LOCUS_21220 2419414 2419788 gene locus_tag LOCUS_21230 2419414 2419788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2419940 2420242 gene locus_tag LOCUS_21240 2419940 2420242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2420293 2420805 gene locus_tag LOCUS_21250 2420293 2420805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2420925 2421425 gene locus_tag LOCUS_21260 2420925 2421425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2421415 2421714 gene locus_tag LOCUS_21270 2421415 2421714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2422091 2423368 gene locus_tag LOCUS_21280 gene tviB 2422091 2423368 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_21280 2423916 2423548 gene locus_tag LOCUS_21290 2423916 2423548 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_21290 2424204 2425280 gene locus_tag LOCUS_21300 2424204 2425280 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 protein_id gnl|my_center|LOCUS_21300 2425406 2426701 gene locus_tag LOCUS_21310 2425406 2426701 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391442.1 protein_id gnl|my_center|LOCUS_21310 2426762 2427979 gene locus_tag LOCUS_21320 2426762 2427979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2428282 2428022 gene locus_tag LOCUS_21330 2428282 2428022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2428281 2429135 gene locus_tag LOCUS_21340 2428281 2429135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2430631 2430413 gene locus_tag LOCUS_21350 2430631 2430413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2430765 2431421 gene locus_tag LOCUS_21360 2430765 2431421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2431483 2432091 gene locus_tag LOCUS_21370 2431483 2432091 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 protein_id gnl|my_center|LOCUS_21370 2432084 2432755 gene locus_tag LOCUS_21380 gene perB 2432084 2432755 CDS product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055391.1 protein_id gnl|my_center|LOCUS_21380 2432762 2433202 gene locus_tag LOCUS_21390 2432762 2433202 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_21390 2433581 2434753 gene locus_tag LOCUS_21400 2433581 2434753 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_21400 2435046 2437079 gene locus_tag LOCUS_21410 2435046 2437079 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_21410 2437280 2437453 gene locus_tag LOCUS_21420 2437280 2437453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2437915 2437493 gene locus_tag LOCUS_21430 2437915 2437493 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_21430 2438172 2437915 gene locus_tag LOCUS_21440 2438172 2437915 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 protein_id gnl|my_center|LOCUS_21440 2439099 2438344 gene locus_tag LOCUS_21450 gene istB 2439099 2438344 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_21450 2440642 2439119 gene locus_tag LOCUS_21460 gene istA 2440642 2439119 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_21460 2441107 2441388 gene locus_tag LOCUS_21470 2441107 2441388 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_21470 2441485 2442306 gene locus_tag LOCUS_21480 gene galU 2441485 2442306 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467169.1 protein_id gnl|my_center|LOCUS_21480 2442548 2443345 gene locus_tag LOCUS_21490 2442548 2443345 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_21490 2444826 2443591 gene locus_tag LOCUS_21500 2444826 2443591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2444749 2445153 gene locus_tag LOCUS_21510 2444749 2445153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2445651 2445175 gene locus_tag LOCUS_21520 2445651 2445175 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_21520 2445977 2445654 gene locus_tag LOCUS_21530 2445977 2445654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2446065 2446313 gene locus_tag LOCUS_21540 2446065 2446313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2446864 2446409 gene locus_tag LOCUS_21550 gene higA 2446864 2446409 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560253.1 protein_id gnl|my_center|LOCUS_21550 2447106 2446942 gene locus_tag LOCUS_21560 2447106 2446942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2447226 2447696 gene locus_tag LOCUS_21570 2447226 2447696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2447843 2449270 gene locus_tag LOCUS_21580 2447843 2449270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2449236 2449622 gene locus_tag LOCUS_21590 2449236 2449622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2449806 2451167 gene locus_tag LOCUS_21600 2449806 2451167 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_21600 2451227 2451382 gene locus_tag LOCUS_21610 2451227 2451382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2451728 2452549 gene locus_tag LOCUS_21620 gene galU 2451728 2452549 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467169.1 protein_id gnl|my_center|LOCUS_21620 2452962 2454185 gene locus_tag LOCUS_21630 2452962 2454185 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_21630 2454553 2455776 gene locus_tag LOCUS_21640 2454553 2455776 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_21640 2456144 2457367 gene locus_tag LOCUS_21650 2456144 2457367 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_21650 2457551 2458348 gene locus_tag LOCUS_21660 2457551 2458348 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_21660 2458478 2458771 gene locus_tag LOCUS_21670 2458478 2458771 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403013.1 protein_id gnl|my_center|LOCUS_21670 2458758 2459138 gene locus_tag LOCUS_21680 2458758 2459138 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_21680 2459644 2459270 gene locus_tag LOCUS_21690 2459644 2459270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21690 2459907 2459668 gene locus_tag LOCUS_21700 2459907 2459668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2461588 2460572 gene locus_tag LOCUS_21710 2461588 2460572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2462566 2463993 gene locus_tag LOCUS_21720 2462566 2463993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2464611 2465786 gene locus_tag LOCUS_21730 gene wecA 2464611 2465786 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176219.1 protein_id gnl|my_center|LOCUS_21730 2465864 2466880 gene locus_tag LOCUS_21740 2465864 2466880 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 protein_id gnl|my_center|LOCUS_21740 2467030 2467926 gene locus_tag LOCUS_21750 2467030 2467926 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_21750 2468070 2469287 gene locus_tag LOCUS_21760 2468070 2469287 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706687.1 protein_id gnl|my_center|LOCUS_21760 2469752 2469471 gene locus_tag LOCUS_21770 2469752 2469471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21770 2470963 2469899 gene locus_tag LOCUS_21780 2470963 2469899 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_21780 2471196 2471642 gene locus_tag LOCUS_21790 2471196 2471642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2471665 2472045 gene locus_tag LOCUS_21800 2471665 2472045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2472153 2473274 gene locus_tag LOCUS_21810 2472153 2473274 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107723.1 protein_id gnl|my_center|LOCUS_21810 2473271 2474152 gene locus_tag LOCUS_21820 2473271 2474152 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795343.1 protein_id gnl|my_center|LOCUS_21820 2474183 2475349 gene locus_tag LOCUS_21830 2474183 2475349 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_21830 2475444 2476271 gene locus_tag LOCUS_21840 gene galU 2475444 2476271 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467169.1 protein_id gnl|my_center|LOCUS_21840 2476362 2477159 gene locus_tag LOCUS_21850 2476362 2477159 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_21850 2477799 2477293 gene locus_tag LOCUS_21860 2477799 2477293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2478133 2477792 gene locus_tag LOCUS_21870 2478133 2477792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2478768 2478418 gene locus_tag LOCUS_21880 2478768 2478418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 2478761 2479093 gene locus_tag LOCUS_21890 2478761 2479093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2479298 2479834 gene locus_tag LOCUS_21900 2479298 2479834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2480022 2479882 gene locus_tag LOCUS_21910 2480022 2479882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2480047 2480637 gene locus_tag LOCUS_21920 2480047 2480637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2480649 2481788 gene locus_tag LOCUS_21930 2480649 2481788 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 protein_id gnl|my_center|LOCUS_21930 2482238 2484844 gene locus_tag LOCUS_21940 gene mutS 2482238 2484844 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_21940 2484952 2486352 gene locus_tag LOCUS_21950 2484952 2486352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2486768 2487091 gene locus_tag LOCUS_21960 2486768 2487091 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_21960 2488263 2487238 gene locus_tag LOCUS_21970 gene rpoS 2488263 2487238 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_21970 2489154 2488375 gene locus_tag LOCUS_21980 2489154 2488375 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_21980 2489892 2489488 gene locus_tag LOCUS_21990 2489892 2489488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2490158 2489904 gene locus_tag LOCUS_22000 2490158 2489904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2491375 2490449 gene locus_tag LOCUS_22010 2491375 2490449 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_22010 2492117 2491452 gene locus_tag LOCUS_22020 2492117 2491452 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_22020 2492864 2492121 gene locus_tag LOCUS_22030 gene surE 2492864 2492121 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092341.1 protein_id gnl|my_center|LOCUS_22030 2493903 2492842 gene locus_tag LOCUS_22040 gene truD 2493903 2492842 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_22040 2494471 2493980 gene locus_tag LOCUS_22050 gene ispF 2494471 2493980 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_22050 2495205 2494471 gene locus_tag LOCUS_22060 gene ispD 2495205 2494471 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 protein_id gnl|my_center|LOCUS_22060 2495547 2495275 gene locus_tag LOCUS_22070 2495547 2495275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2497040 2495730 gene locus_tag LOCUS_22080 gene eno 2497040 2495730 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073296.1 protein_id gnl|my_center|LOCUS_22080 2498464 2497358 gene locus_tag LOCUS_22090 2498464 2497358 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947926.1 protein_id gnl|my_center|LOCUS_22090 2498758 2499750 gene locus_tag LOCUS_22100 2498758 2499750 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_22100 2500377 2500027 gene locus_tag LOCUS_22110 2500377 2500027 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_22110 2500601 2500377 gene locus_tag LOCUS_22120 2500601 2500377 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_22120 2501606 2500755 gene locus_tag LOCUS_22130 gene kdsA 2501606 2500755 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811046.1 protein_id gnl|my_center|LOCUS_22130 2503338 2501713 gene locus_tag LOCUS_22140 2503338 2501713 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_22140 2504936 2503470 gene locus_tag LOCUS_22150 gene tilS 2504936 2503470 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602174.1 protein_id gnl|my_center|LOCUS_22150 2505886 2504936 gene locus_tag LOCUS_22160 gene accA 2505886 2504936 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_22160 2509643 2506134 gene locus_tag LOCUS_22170 gene dnaE 2509643 2506134 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266980.1 protein_id gnl|my_center|LOCUS_22170 2510474 2511481 gene locus_tag LOCUS_22180 2510474 2511481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2511901 2511518 gene locus_tag LOCUS_22190 2511901 2511518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2512354 2511950 gene locus_tag LOCUS_22200 2512354 2511950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2512277 2513512 gene locus_tag LOCUS_22210 2512277 2513512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2513887 2513630 gene locus_tag LOCUS_22220 2513887 2513630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2515031 2513877 gene locus_tag LOCUS_22230 gene lpxB 2515031 2513877 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 protein_id gnl|my_center|LOCUS_22230 2515941 2515099 gene locus_tag LOCUS_22240 gene lpxA 2515941 2515099 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103594.1 protein_id gnl|my_center|LOCUS_22240 2516384 2515944 gene locus_tag LOCUS_22250 gene fabZ 2516384 2515944 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 protein_id gnl|my_center|LOCUS_22250 2517555 2516536 gene locus_tag LOCUS_22260 gene lpxD 2517555 2516536 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_22260 2518063 2517560 gene locus_tag LOCUS_22270 2518063 2517560 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266977.1 protein_id gnl|my_center|LOCUS_22270 2520819 2518414 gene locus_tag LOCUS_22280 gene bamA 2520819 2518414 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_22280 2522268 2520883 gene locus_tag LOCUS_22290 gene rseP 2522268 2520883 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_22290 2523616 2522375 gene locus_tag LOCUS_22300 gene ispC 2523616 2522375 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_22300 2524420 2523620 gene locus_tag LOCUS_22310 2524420 2523620 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266974.1 protein_id gnl|my_center|LOCUS_22310 2525193 2524414 gene locus_tag LOCUS_22320 gene uppS 2525193 2524414 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113863.1 protein_id gnl|my_center|LOCUS_22320 2525855 2525298 gene locus_tag LOCUS_22330 gene frr 2525855 2525298 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_22330 2526589 2525852 gene locus_tag LOCUS_22340 gene pyrH 2526589 2525852 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_22340 2527815 2526886 gene locus_tag LOCUS_22350 gene tsf 2527815 2526886 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 protein_id gnl|my_center|LOCUS_22350 2528683 2527907 gene locus_tag LOCUS_22360 gene rpsB 2528683 2527907 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_22360 2528861 2529046 gene locus_tag LOCUS_22370 2528861 2529046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2529173 2529964 gene locus_tag LOCUS_22380 gene map 2529173 2529964 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_22380 2530059 2532776 gene locus_tag LOCUS_22390 2530059 2532776 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_22390 2532831 2533382 gene locus_tag LOCUS_22400 2532831 2533382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2533592 2534098 gene locus_tag LOCUS_22410 2533592 2534098 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486498.1 protein_id gnl|my_center|LOCUS_22410 2534437 2535771 gene locus_tag LOCUS_22420 gene brnQ 2534437 2535771 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261227.1 protein_id gnl|my_center|LOCUS_22420 2535953 2537110 gene locus_tag LOCUS_22430 2535953 2537110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2537107 2538642 gene locus_tag LOCUS_22440 2537107 2538642 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_22440 2538649 2539632 gene locus_tag LOCUS_22450 2538649 2539632 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_22450 2539790 2541181 gene locus_tag LOCUS_22460 2539790 2541181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2541691 2543283 gene locus_tag LOCUS_22470 gene cydA 2541691 2543283 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261597.1 protein_id gnl|my_center|LOCUS_22470 2543295 2544431 gene locus_tag LOCUS_22480 gene cydB 2543295 2544431 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_22480 2546133 2544706 gene locus_tag LOCUS_22490 2546133 2544706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2546898 2546296 gene locus_tag LOCUS_22500 2546898 2546296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 2548264 2546903 gene locus_tag LOCUS_22510 2548264 2546903 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_22510 2548500 2549243 gene locus_tag LOCUS_22520 2548500 2549243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2549266 2550009 gene locus_tag LOCUS_22530 2549266 2550009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2550120 2550449 gene locus_tag LOCUS_22540 2550120 2550449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2550465 2550806 gene locus_tag LOCUS_22550 2550465 2550806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2550995 2550837 gene locus_tag LOCUS_22560 2550995 2550837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2551110 2551994 gene locus_tag LOCUS_22570 2551110 2551994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2551991 2553826 gene locus_tag LOCUS_22580 gene traD 2551991 2553826 CDS product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 protein_id gnl|my_center|LOCUS_22580 2553849 2554469 gene locus_tag LOCUS_22590 2553849 2554469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2554469 2555329 gene locus_tag LOCUS_22600 gene traF 2554469 2555329 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 protein_id gnl|my_center|LOCUS_22600 2555349 2555609 gene locus_tag LOCUS_22610 2555349 2555609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2555720 2556511 gene locus_tag LOCUS_22620 2555720 2556511 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210326921.1 protein_id gnl|my_center|LOCUS_22620 2556508 2556774 gene locus_tag LOCUS_22630 2556508 2556774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2558077 2556878 gene locus_tag LOCUS_22640 2558077 2556878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2558856 2558197 gene locus_tag LOCUS_22650 2558856 2558197 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_22650 2559938 2558853 gene locus_tag LOCUS_22660 2559938 2558853 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_22660 2560798 2560199 gene locus_tag LOCUS_22670 2560798 2560199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2562250 2561390 gene locus_tag LOCUS_22680 2562250 2561390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2564425 2563025 gene locus_tag LOCUS_22690 2564425 2563025 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_22690 2566328 2564508 gene locus_tag LOCUS_22700 2566328 2564508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2566433 2566627 gene locus_tag LOCUS_22710 2566433 2566627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2567372 2566629 gene locus_tag LOCUS_22720 2567372 2566629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2567822 2567421 gene locus_tag LOCUS_22730 2567822 2567421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2568396 2567797 gene locus_tag LOCUS_22740 2568396 2567797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2568748 2568380 gene locus_tag LOCUS_22750 2568748 2568380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2569339 2568749 gene locus_tag LOCUS_22760 2569339 2568749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2570097 2569387 gene locus_tag LOCUS_22770 2570097 2569387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2570775 2570113 gene locus_tag LOCUS_22780 2570775 2570113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2570979 2570779 gene locus_tag LOCUS_22790 2570979 2570779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2571025 2571411 gene locus_tag LOCUS_22800 2571025 2571411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2572875 2571493 gene locus_tag LOCUS_22810 2572875 2571493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2572957 2573127 gene locus_tag LOCUS_22820 2572957 2573127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2573188 2573442 gene locus_tag LOCUS_22830 2573188 2573442 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 protein_id gnl|my_center|LOCUS_22830 2573432 2573719 gene locus_tag LOCUS_22840 gene relE 2573432 2573719 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323025.1 protein_id gnl|my_center|LOCUS_22840 2574196 2573723 gene locus_tag LOCUS_22850 2574196 2573723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2574414 2574668 gene locus_tag LOCUS_22860 2574414 2574668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2574686 2575078 gene locus_tag LOCUS_22870 2574686 2575078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2576332 2575253 gene locus_tag LOCUS_22880 2576332 2575253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2576871 2576311 gene locus_tag LOCUS_22890 2576871 2576311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2577245 2576877 gene locus_tag LOCUS_22900 2577245 2576877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2577667 2577242 gene locus_tag LOCUS_22910 2577667 2577242 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_22910 2577946 2577671 gene locus_tag LOCUS_22920 2577946 2577671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2578425 2578655 gene locus_tag LOCUS_22930 2578425 2578655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2580512 2578809 gene locus_tag LOCUS_22940 2580512 2578809 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_22940 2580796 2581059 gene locus_tag LOCUS_22950 2580796 2581059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2582306 2581071 gene locus_tag LOCUS_22960 2582306 2581071 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_22960 2582359 2582838 gene locus_tag LOCUS_22970 2582359 2582838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2582927 2583130 gene locus_tag LOCUS_22980 2582927 2583130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2584795 2583092 gene locus_tag LOCUS_22990 2584795 2583092 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_22990 2585139 2586167 gene locus_tag LOCUS_23000 2585139 2586167 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_23000 2587245 2586673 gene locus_tag LOCUS_23010 2587245 2586673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2587712 2587242 gene locus_tag LOCUS_23020 2587712 2587242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087299.1 protein_id gnl|my_center|LOCUS_23020 2589965 2588067 gene locus_tag LOCUS_23030 2589965 2588067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2590151 2590315 gene locus_tag LOCUS_23040 2590151 2590315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2590434 2591474 gene locus_tag LOCUS_23050 2590434 2591474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2591553 2591735 gene locus_tag LOCUS_23060 2591553 2591735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2591758 2592018 gene locus_tag LOCUS_23070 2591758 2592018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2592075 2592419 gene locus_tag LOCUS_23080 2592075 2592419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2592664 2592425 gene locus_tag LOCUS_23090 2592664 2592425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2593704 2592814 gene locus_tag LOCUS_23100 2593704 2592814 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187842.1 protein_id gnl|my_center|LOCUS_23100 2593872 2594819 gene locus_tag LOCUS_23110 2593872 2594819 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_23110 2594996 2595250 gene locus_tag LOCUS_23120 2594996 2595250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2597046 2595331 gene locus_tag LOCUS_23130 2597046 2595331 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_23130 2597725 2597186 gene locus_tag LOCUS_23140 2597725 2597186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2597878 2600028 gene locus_tag LOCUS_23150 2597878 2600028 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_23150 2600065 2601198 gene locus_tag LOCUS_23160 2600065 2601198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_23160 2601407 2601483 gene locus_tag LOCUS_t00440 2601407 2601483 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2601522 2601598 gene locus_tag LOCUS_t00450 2601522 2601598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2601671 2601763 gene locus_tag LOCUS_t00460 2601671 2601763 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2603507 2601996 gene locus_tag LOCUS_23170 gene purF 2603507 2601996 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_23170 2603767 2604204 gene locus_tag LOCUS_23180 2603767 2604204 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_23180 2604748 2604236 gene locus_tag LOCUS_23190 2604748 2604236 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_23190 2605036 2605260 gene locus_tag LOCUS_23200 2605036 2605260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2605260 2605673 gene locus_tag LOCUS_23210 2605260 2605673 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_23210 2605959 2605645 gene locus_tag LOCUS_23220 2605959 2605645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2609972 2606292 gene locus_tag LOCUS_23230 2609972 2606292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2610049 2610573 gene locus_tag LOCUS_23240 2610049 2610573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2611103 2611801 gene locus_tag LOCUS_23250 2611103 2611801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2611893 2611817 gene locus_tag LOCUS_t00470 2611893 2611817 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2612009 2611917 gene locus_tag LOCUS_t00480 2612009 2611917 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2612110 2612034 gene locus_tag LOCUS_t00490 2612110 2612034 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2612226 2612134 gene locus_tag LOCUS_t00500 2612226 2612134 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2612646 2612443 gene locus_tag LOCUS_23260 gene csrA 2612646 2612443 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_23260 2614347 2613106 gene locus_tag LOCUS_23270 2614347 2613106 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_23270 2617095 2614474 gene locus_tag LOCUS_23280 gene alaS 2617095 2614474 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_23280 2617686 2617225 gene locus_tag LOCUS_23290 2617686 2617225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2618368 2617898 gene locus_tag LOCUS_23300 gene recX 2618368 2617898 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 protein_id gnl|my_center|LOCUS_23300 2619411 2618368 gene locus_tag LOCUS_23310 gene recA 2619411 2618368 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_23310 2620105 2619521 gene locus_tag LOCUS_23320 2620105 2619521 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_23320 2623509 2620219 gene locus_tag LOCUS_23330 2623509 2620219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2627047 2623607 gene locus_tag LOCUS_23340 2627047 2623607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2628270 2628049 gene locus_tag LOCUS_23350 2628270 2628049 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103440.1 protein_id gnl|my_center|LOCUS_23350 2628804 2628283 gene locus_tag LOCUS_23360 2628804 2628283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2629109 2630254 gene locus_tag LOCUS_23370 2629109 2630254 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421706.1 protein_id gnl|my_center|LOCUS_23370 2630312 2630644 gene locus_tag LOCUS_23380 2630312 2630644 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_23380 2631215 2630610 gene locus_tag LOCUS_23390 2631215 2630610 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_23390 2631424 2632068 gene locus_tag LOCUS_23400 2631424 2632068 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103566.1 protein_id gnl|my_center|LOCUS_23400 2632268 2633881 gene locus_tag LOCUS_23410 2632268 2633881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2634708 2633968 gene locus_tag LOCUS_23420 2634708 2633968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2635196 2634711 gene locus_tag LOCUS_23430 2635196 2634711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2636612 2635362 gene locus_tag LOCUS_23440 2636612 2635362 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_23440 2637496 2636699 gene locus_tag LOCUS_23450 2637496 2636699 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_23450 2637742 2639631 gene locus_tag LOCUS_23460 2637742 2639631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2639849 2641255 gene locus_tag LOCUS_23470 gene ffh 2639849 2641255 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_23470 2642462 2641326 gene locus_tag LOCUS_23480 2642462 2641326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2643653 2642730 gene locus_tag LOCUS_23490 2643653 2642730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2643903 2644232 gene locus_tag LOCUS_23500 gene rpsP 2643903 2644232 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 protein_id gnl|my_center|LOCUS_23500 2644257 2644814 gene locus_tag LOCUS_23510 gene rimM 2644257 2644814 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_23510 2644821 2645609 gene locus_tag LOCUS_23520 gene trmD 2644821 2645609 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_23520 2645656 2646009 gene locus_tag LOCUS_23530 gene rplS 2645656 2646009 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_23530 2646747 2646151 gene locus_tag LOCUS_23540 2646747 2646151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2646989 2647894 gene locus_tag LOCUS_23550 gene xerD 2646989 2647894 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_23550 2648026 2648874 gene locus_tag LOCUS_23560 gene dsbC 2648026 2648874 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 protein_id gnl|my_center|LOCUS_23560 2649078 2650583 gene locus_tag LOCUS_23570 2649078 2650583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2650679 2651113 gene locus_tag LOCUS_23580 2650679 2651113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2651333 2652634 gene locus_tag LOCUS_23590 2651333 2652634 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_23590 2652681 2654105 gene locus_tag LOCUS_23600 gene thrC 2652681 2654105 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_23600 2654395 2657295 gene locus_tag LOCUS_23610 2654395 2657295 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 protein_id gnl|my_center|LOCUS_23610 2657628 2658428 gene locus_tag LOCUS_23620 2657628 2658428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2659959 2658346 gene locus_tag LOCUS_23630 2659959 2658346 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_23630 2661413 2660034 gene locus_tag LOCUS_23640 2661413 2660034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2662881 2661652 gene locus_tag LOCUS_23650 gene nqrF 2662881 2661652 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_23650 2663455 2662898 gene locus_tag LOCUS_23660 gene nqrE 2663455 2662898 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_23660 2664163 2663498 gene locus_tag LOCUS_23670 2664163 2663498 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 protein_id gnl|my_center|LOCUS_23670 2664957 2664163 gene locus_tag LOCUS_23680 2664957 2664163 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_23680 2666153 2664957 gene locus_tag LOCUS_23690 2666153 2664957 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_23690 2667481 2666159 gene locus_tag LOCUS_23700 2667481 2666159 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_23700 2668268 2668762 gene locus_tag LOCUS_23710 2668268 2668762 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_23710 2668769 2669323 gene locus_tag LOCUS_23720 2668769 2669323 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_23720 2670928 2669423 gene locus_tag LOCUS_23730 2670928 2669423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2671899 2671123 gene locus_tag LOCUS_23740 2671899 2671123 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_23740 2672341 2671991 gene locus_tag LOCUS_23750 2672341 2671991 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_23750 2673404 2672409 gene locus_tag LOCUS_23760 2673404 2672409 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_23760 2674057 2673404 gene locus_tag LOCUS_23770 gene tmk 2674057 2673404 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_23770 2675100 2674057 gene locus_tag LOCUS_23780 gene mltG 2675100 2674057 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770618.1 protein_id gnl|my_center|LOCUS_23780 2675938 2675093 gene locus_tag LOCUS_23790 gene pabC 2675938 2675093 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267151.1 protein_id gnl|my_center|LOCUS_23790 2677114 2675942 gene locus_tag LOCUS_23800 gene fabF 2677114 2675942 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_23800 2677415 2678407 gene locus_tag LOCUS_23810 2677415 2678407 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_23810 2678777 2678544 gene locus_tag LOCUS_23820 gene acpP 2678777 2678544 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_23820 2679836 2679063 gene locus_tag LOCUS_23830 gene fabG 2679836 2679063 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770626.1 protein_id gnl|my_center|LOCUS_23830 2680768 2679836 gene locus_tag LOCUS_23840 gene fabD 2680768 2679836 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706105.1 protein_id gnl|my_center|LOCUS_23840 2682014 2680977 gene locus_tag LOCUS_23850 gene plsX 2682014 2680977 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443174.1 protein_id gnl|my_center|LOCUS_23850 2682199 2682026 gene locus_tag LOCUS_23860 gene rpmF 2682199 2682026 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 protein_id gnl|my_center|LOCUS_23860 2682766 2682212 gene locus_tag LOCUS_23870 2682766 2682212 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_23870 2682979 2683554 gene locus_tag LOCUS_23880 2682979 2683554 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_23880 2683588 2683863 gene locus_tag LOCUS_23890 2683588 2683863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2684159 2684434 gene locus_tag LOCUS_23900 2684159 2684434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2686465 2685479 gene locus_tag LOCUS_23910 gene sppA 2686465 2685479 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_23910 2687197 2686532 gene locus_tag LOCUS_23920 2687197 2686532 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770637.1 protein_id gnl|my_center|LOCUS_23920 2688337 2687324 gene locus_tag LOCUS_23930 gene rluC 2688337 2687324 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_23930 2688814 2688981 gene locus_tag LOCUS_23940 2688814 2688981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2689007 2692099 gene locus_tag LOCUS_23950 gene rne 2689007 2692099 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_23950 2693292 2692276 gene locus_tag LOCUS_23960 gene murB 2693292 2692276 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_23960 2694071 2693292 gene locus_tag LOCUS_23970 gene kdsB 2694071 2693292 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770642.1 protein_id gnl|my_center|LOCUS_23970 2694326 2694114 gene locus_tag LOCUS_23980 2694326 2694114 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381112.1 protein_id gnl|my_center|LOCUS_23980 2695485 2694409 gene locus_tag LOCUS_23990 gene lpxK 2695485 2694409 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018915793.1 protein_id gnl|my_center|LOCUS_23990 2695925 2695497 gene locus_tag LOCUS_24000 2695925 2695497 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_24000 2696557 2695925 gene locus_tag LOCUS_24010 2696557 2695925 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_24010 2699703 2697622 gene locus_tag LOCUS_24020 2699703 2697622 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113988.1 protein_id gnl|my_center|LOCUS_24020 2700340 2700873 gene locus_tag LOCUS_24030 2700340 2700873 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_24030 2700893 2701183 gene locus_tag LOCUS_24040 2700893 2701183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2702317 2702946 gene locus_tag LOCUS_24050 2702317 2702946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2703672 2702965 gene locus_tag LOCUS_24060 gene lolD 2703672 2702965 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_24060 2704819 2703665 gene locus_tag LOCUS_24070 2704819 2703665 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_24070 2707266 2705098 gene locus_tag LOCUS_24080 gene rlmKL 2707266 2705098 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_24080 2707550 2707383 gene locus_tag LOCUS_24090 2707550 2707383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2707657 2707941 gene locus_tag LOCUS_24100 2707657 2707941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2709097 2708075 gene locus_tag LOCUS_24110 2709097 2708075 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_24110 2709346 2713149 gene locus_tag LOCUS_24120 2709346 2713149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2713863 2713153 gene locus_tag LOCUS_24130 gene ccmB 2713863 2713153 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114289.1 protein_id gnl|my_center|LOCUS_24130 2714537 2713860 gene locus_tag LOCUS_24140 gene ccmA 2714537 2713860 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_24140 2715101 2716021 gene locus_tag LOCUS_24150 2715101 2716021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2720944 2716067 gene locus_tag LOCUS_24160 gene gdhB 2720944 2716067 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_24160 2721471 2722433 gene locus_tag LOCUS_24170 2721471 2722433 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_24170 2722495 2723442 gene locus_tag LOCUS_24180 2722495 2723442 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318876.1 protein_id gnl|my_center|LOCUS_24180 2723449 2723940 gene locus_tag LOCUS_24190 2723449 2723940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2723933 2724994 gene locus_tag LOCUS_24200 2723933 2724994 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_24200 2724997 2726892 gene locus_tag LOCUS_24210 2724997 2726892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2726886 2728703 gene locus_tag LOCUS_24220 2726886 2728703 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_24220 2731143 2728774 gene locus_tag LOCUS_24230 2731143 2728774 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_24230 2732164 2731127 gene locus_tag LOCUS_24240 2732164 2731127 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_24240 2733558 2732185 gene locus_tag LOCUS_24250 2733558 2732185 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_24250 2735652 2733583 gene locus_tag LOCUS_24260 2735652 2733583 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 protein_id gnl|my_center|LOCUS_24260 2738497 2735834 gene locus_tag LOCUS_24270 gene pepN 2738497 2735834 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_24270 2739376 2738522 gene locus_tag LOCUS_24280 2739376 2738522 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_24280 2740105 2739413 gene locus_tag LOCUS_24290 2740105 2739413 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_24290 2740411 2740145 gene locus_tag LOCUS_24300 2740411 2740145 CDS product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554502.1 protein_id gnl|my_center|LOCUS_24300 2740509 2742272 gene locus_tag LOCUS_24310 2740509 2742272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2742509 2743822 gene locus_tag LOCUS_24320 2742509 2743822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2744219 2745340 gene locus_tag LOCUS_24330 2744219 2745340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2745708 2745433 gene locus_tag LOCUS_24340 2745708 2745433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2746274 2745804 gene locus_tag LOCUS_24350 2746274 2745804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 2747286 2746417 gene locus_tag LOCUS_24360 2747286 2746417 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463338.1 protein_id gnl|my_center|LOCUS_24360 2748234 2747341 gene locus_tag LOCUS_24370 2748234 2747341 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_24370 2748400 2749356 gene locus_tag LOCUS_24380 2748400 2749356 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_24380 2749975 2750271 gene locus_tag LOCUS_24390 2749975 2750271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2751441 2750362 gene locus_tag LOCUS_24400 2751441 2750362 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_24400 2752679 2751477 gene locus_tag LOCUS_24410 2752679 2751477 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463289.1 protein_id gnl|my_center|LOCUS_24410 2753986 2752682 gene locus_tag LOCUS_24420 gene guaD 2753986 2752682 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_24420 2754519 2753983 gene locus_tag LOCUS_24430 2754519 2753983 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193471.1 protein_id gnl|my_center|LOCUS_24430 2754943 2754605 gene locus_tag LOCUS_24440 gene uraH 2754943 2754605 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094857.1 protein_id gnl|my_center|LOCUS_24440 2755525 2755004 gene locus_tag LOCUS_24450 gene uraD 2755525 2755004 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 protein_id gnl|my_center|LOCUS_24450 2756538 2755522 gene locus_tag LOCUS_24460 gene alc 2756538 2755522 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553942.1 protein_id gnl|my_center|LOCUS_24460 2756648 2757655 gene locus_tag LOCUS_24470 gene puuE 2756648 2757655 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_24470 2758548 2757688 gene locus_tag LOCUS_24480 gene xdhC 2758548 2757688 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_24480 2760949 2758538 gene locus_tag LOCUS_24490 gene xdhB 2760949 2758538 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_24490 2762372 2760942 gene locus_tag LOCUS_24500 gene xdhA 2762372 2760942 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_24500 2763127 2762495 gene locus_tag LOCUS_24510 2763127 2762495 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_24510 2763788 2763132 gene locus_tag LOCUS_24520 2763788 2763132 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 protein_id gnl|my_center|LOCUS_24520 2764021 2764788 gene locus_tag LOCUS_24530 2764021 2764788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2765337 2764933 gene locus_tag LOCUS_24540 2765337 2764933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2766107 2766256 gene locus_tag LOCUS_24550 2766107 2766256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2766407 2769949 gene locus_tag LOCUS_24560 2766407 2769949 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946472.1 protein_id gnl|my_center|LOCUS_24560 2771390 2770164 gene locus_tag LOCUS_24570 gene ltrA 2771390 2770164 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_24570 2772277 2772201 gene locus_tag LOCUS_t00510 2772277 2772201 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2772396 2772321 gene locus_tag LOCUS_t00520 2772396 2772321 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2772570 2772494 gene locus_tag LOCUS_t00530 2772570 2772494 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2772689 2772614 gene locus_tag LOCUS_t00540 2772689 2772614 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2772843 2772767 gene locus_tag LOCUS_t00550 2772843 2772767 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2772962 2772887 gene locus_tag LOCUS_t00560 2772962 2772887 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2773135 2773059 gene locus_tag LOCUS_t00570 2773135 2773059 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2773254 2773179 gene locus_tag LOCUS_t00580 2773254 2773179 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2773412 2773336 gene locus_tag LOCUS_t00590 2773412 2773336 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2773531 2773456 gene locus_tag LOCUS_t00600 2773531 2773456 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2773689 2773613 gene locus_tag LOCUS_t00610 2773689 2773613 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2773808 2773733 gene locus_tag LOCUS_t00620 2773808 2773733 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2774015 2773939 gene locus_tag LOCUS_t00630 2774015 2773939 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2774180 2774105 gene locus_tag LOCUS_t00640 2774180 2774105 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2774377 2775288 gene locus_tag LOCUS_24580 gene rdgC 2774377 2775288 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_24580 2776202 2775330 gene locus_tag LOCUS_24590 gene cnoX 2776202 2775330 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037936.1 protein_id gnl|my_center|LOCUS_24590 2777752 2776649 gene locus_tag LOCUS_24600 2777752 2776649 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 protein_id gnl|my_center|LOCUS_24600 2779123 2777978 gene locus_tag LOCUS_24610 gene bamC 2779123 2777978 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_24610 2780113 2779226 gene locus_tag LOCUS_24620 gene dapA 2780113 2779226 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379025.1 protein_id gnl|my_center|LOCUS_24620 2780271 2780738 gene locus_tag LOCUS_24630 2780271 2780738 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 protein_id gnl|my_center|LOCUS_24630 2781858 2780821 gene locus_tag LOCUS_24640 2781858 2780821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2784267 2784076 gene locus_tag LOCUS_24650 2784267 2784076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2785628 2784567 gene locus_tag LOCUS_24660 2785628 2784567 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_24660 2785882 2785652 gene locus_tag LOCUS_24670 2785882 2785652 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_24670 2786159 2787610 gene locus_tag LOCUS_24680 2786159 2787610 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 protein_id gnl|my_center|LOCUS_24680 2788978 2787686 gene locus_tag LOCUS_24690 2788978 2787686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2790193 2789147 gene locus_tag LOCUS_24700 gene nadA 2790193 2789147 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_24700 2790806 2792041 gene locus_tag LOCUS_24710 2790806 2792041 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_24710 2792113 2792391 gene locus_tag LOCUS_24720 2792113 2792391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2793116 2792442 gene locus_tag LOCUS_24730 gene queC 2793116 2792442 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_24730 2793777 2793127 gene locus_tag LOCUS_24740 gene queE 2793777 2793127 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_24740 2794814 2793924 gene locus_tag LOCUS_24750 2794814 2793924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2795402 2794830 gene locus_tag LOCUS_24760 2795402 2794830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2796892 2795552 gene locus_tag LOCUS_24770 gene tolB 2796892 2795552 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 protein_id gnl|my_center|LOCUS_24770 2797827 2796958 gene locus_tag LOCUS_24780 2797827 2796958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2798283 2797840 gene locus_tag LOCUS_24790 gene tolR 2798283 2797840 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_24790 2798996 2798298 gene locus_tag LOCUS_24800 gene tolQ 2798996 2798298 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_24800 2799484 2799044 gene locus_tag LOCUS_24810 gene ybgC 2799484 2799044 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406122.1 protein_id gnl|my_center|LOCUS_24810 2799707 2799495 gene locus_tag LOCUS_24820 2799707 2799495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2800152 2799622 gene locus_tag LOCUS_24830 2800152 2799622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2803570 2800127 gene locus_tag LOCUS_24840 2803570 2800127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2804914 2803910 gene locus_tag LOCUS_24850 gene ruvB 2804914 2803910 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_24850 2805046 2805984 gene locus_tag LOCUS_24860 gene rarD 2805046 2805984 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765209.1 protein_id gnl|my_center|LOCUS_24860 2806647 2806036 gene locus_tag LOCUS_24870 gene ruvA 2806647 2806036 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418603.1 protein_id gnl|my_center|LOCUS_24870 2806784 2807326 gene locus_tag LOCUS_24880 2806784 2807326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2807885 2807361 gene locus_tag LOCUS_24890 gene ruvC 2807885 2807361 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 protein_id gnl|my_center|LOCUS_24890 2807805 2808155 gene locus_tag LOCUS_24900 2807805 2808155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2808588 2808265 gene locus_tag LOCUS_24910 2808588 2808265 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560819.1 protein_id gnl|my_center|LOCUS_24910 2808911 2808585 gene locus_tag LOCUS_24920 2808911 2808585 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001779357.1 protein_id gnl|my_center|LOCUS_24920 2809021 2810505 gene locus_tag LOCUS_24930 2809021 2810505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2812984 2810768 gene locus_tag LOCUS_24940 2812984 2810768 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 protein_id gnl|my_center|LOCUS_24940 2817251 2813268 gene locus_tag LOCUS_24950 2817251 2813268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2819862 2817280 gene locus_tag LOCUS_24960 2819862 2817280 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968588.1 protein_id gnl|my_center|LOCUS_24960 2820424 2819852 gene locus_tag LOCUS_24970 2820424 2819852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2827362 2820523 gene locus_tag LOCUS_24980 2827362 2820523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2830279 2827517 gene locus_tag LOCUS_24990 2830279 2827517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2830989 2830495 gene locus_tag LOCUS_25000 2830989 2830495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2832138 2831392 gene locus_tag LOCUS_25010 2832138 2831392 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086107.1 protein_id gnl|my_center|LOCUS_25010 2834009 2832228 gene locus_tag LOCUS_25020 gene aspS 2834009 2832228 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 protein_id gnl|my_center|LOCUS_25020 2834853 2834149 gene locus_tag LOCUS_25030 2834853 2834149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2836551 2834947 gene locus_tag LOCUS_25040 2836551 2834947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2837057 2836548 gene locus_tag LOCUS_25050 2837057 2836548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2837319 2838803 gene locus_tag LOCUS_25060 2837319 2838803 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112647.1 protein_id gnl|my_center|LOCUS_25060 2839035 2840324 gene locus_tag LOCUS_25070 2839035 2840324 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104816.1 protein_id gnl|my_center|LOCUS_25070 2840810 2840469 gene locus_tag LOCUS_25080 2840810 2840469 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_25080 2841418 2842014 gene locus_tag LOCUS_25090 2841418 2842014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2842304 2842101 gene locus_tag LOCUS_25100 2842304 2842101 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364741.1 protein_id gnl|my_center|LOCUS_25100 2842747 2842331 gene locus_tag LOCUS_25110 2842747 2842331 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 protein_id gnl|my_center|LOCUS_25110 2842975 2844690 gene locus_tag LOCUS_25120 2842975 2844690 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_25120 2845038 2845613 gene locus_tag LOCUS_25130 2845038 2845613 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 protein_id gnl|my_center|LOCUS_25130 2845894 2845622 gene locus_tag LOCUS_25140 2845894 2845622 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947603.1 protein_id gnl|my_center|LOCUS_25140 2846366 2845887 gene locus_tag LOCUS_25150 2846366 2845887 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739010.1 protein_id gnl|my_center|LOCUS_25150 2847644 2846457 gene locus_tag LOCUS_25160 gene purT 2847644 2846457 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_25160 2850780 2847949 gene locus_tag LOCUS_25170 2850780 2847949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2852152 2850881 gene locus_tag LOCUS_25180 2852152 2850881 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_25180 2852787 2852221 gene locus_tag LOCUS_25190 2852787 2852221 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_25190 2853101 2853448 gene locus_tag LOCUS_25200 gene arsC 2853101 2853448 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 protein_id gnl|my_center|LOCUS_25200 2853473 2853856 gene locus_tag LOCUS_25210 2853473 2853856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2855922 2853853 gene locus_tag LOCUS_25220 2855922 2853853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2856665 2855958 gene locus_tag LOCUS_25230 gene hda 2856665 2855958 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_25230 2857897 2856785 gene locus_tag LOCUS_25240 2857897 2856785 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_25240 2859046 2857922 gene locus_tag LOCUS_25250 2859046 2857922 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_25250 2859302 2860387 gene locus_tag LOCUS_25260 gene purM 2859302 2860387 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262407.1 protein_id gnl|my_center|LOCUS_25260 2860414 2861106 gene locus_tag LOCUS_25270 gene purN 2860414 2861106 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209778.1 protein_id gnl|my_center|LOCUS_25270 2861070 2861864 gene locus_tag LOCUS_25280 2861070 2861864 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_25280 2861938 2862327 gene locus_tag LOCUS_25290 gene gloA 2861938 2862327 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 protein_id gnl|my_center|LOCUS_25290 2862466 2863578 gene locus_tag LOCUS_25300 gene mltC 2862466 2863578 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230176.1 protein_id gnl|my_center|LOCUS_25300 2864791 2863580 gene locus_tag LOCUS_25310 2864791 2863580 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_25310 2866159 2867484 gene locus_tag LOCUS_25320 2866159 2867484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2867646 2868695 gene locus_tag LOCUS_25330 gene pyrC 2867646 2868695 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_25330 2868727 2869347 gene locus_tag LOCUS_25340 gene rnt 2868727 2869347 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412908.1 protein_id gnl|my_center|LOCUS_25340 2869580 2869867 gene locus_tag LOCUS_25350 2869580 2869867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 2870295 2870011 gene locus_tag LOCUS_25360 2870295 2870011 CDS product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 protein_id gnl|my_center|LOCUS_25360 2871998 2870322 gene locus_tag LOCUS_25370 2871998 2870322 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706282.1 protein_id gnl|my_center|LOCUS_25370 2872935 2872132 gene locus_tag LOCUS_25380 gene yigL 2872935 2872132 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368853.1 protein_id gnl|my_center|LOCUS_25380 2875644 2873077 gene locus_tag LOCUS_25390 gene clpB 2875644 2873077 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_25390 2876455 2875706 gene locus_tag LOCUS_25400 gene pgeF 2876455 2875706 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_25400 2877430 2876471 gene locus_tag LOCUS_25410 gene rluD 2877430 2876471 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266591.1 protein_id gnl|my_center|LOCUS_25410 2877672 2878604 gene locus_tag LOCUS_25420 2877672 2878604 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102590.1 protein_id gnl|my_center|LOCUS_25420 2878656 2878874 gene locus_tag LOCUS_25430 gene yacG 2878656 2878874 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381207.1 protein_id gnl|my_center|LOCUS_25430 2880132 2878840 gene locus_tag LOCUS_25440 2880132 2878840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2881174 2880188 gene locus_tag LOCUS_25450 2881174 2880188 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_25450 2882498 2881281 gene locus_tag LOCUS_25460 gene argJ 2882498 2881281 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_25460 2885404 2882663 gene locus_tag LOCUS_25470 gene secA 2885404 2882663 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_25470 2886603 2885668 gene locus_tag LOCUS_25480 2886603 2885668 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_25480 2887818 2886904 gene locus_tag LOCUS_25490 gene lpxC 2887818 2886904 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_25490 2889141 2887918 gene locus_tag LOCUS_25500 gene ftsZ 2889141 2887918 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_25500 2890442 2889207 gene locus_tag LOCUS_25510 gene ftsA 2890442 2889207 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_25510 2891190 2890579 gene locus_tag LOCUS_25520 2891190 2890579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2892424 2891363 gene locus_tag LOCUS_25530 2892424 2891363 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_25530 2893930 2892479 gene locus_tag LOCUS_25540 gene murC 2893930 2892479 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268845.1 protein_id gnl|my_center|LOCUS_25540 2895086 2893923 gene locus_tag LOCUS_25550 gene murG 2895086 2893923 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_25550 2896287 2895079 gene locus_tag LOCUS_25560 gene ftsW 2896287 2895079 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 protein_id gnl|my_center|LOCUS_25560 2897669 2896284 gene locus_tag LOCUS_25570 gene murD 2897669 2896284 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_25570 2898768 2897686 gene locus_tag LOCUS_25580 gene mraY 2898768 2897686 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_25580 2900168 2898771 gene locus_tag LOCUS_25590 2900168 2898771 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_25590 2901676 2900165 gene locus_tag LOCUS_25600 2901676 2900165 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766562.1 protein_id gnl|my_center|LOCUS_25600 2903533 2901764 gene locus_tag LOCUS_25610 gene ftsI 2903533 2901764 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_25610 2903826 2903530 gene locus_tag LOCUS_25620 2903826 2903530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2904757 2903831 gene locus_tag LOCUS_25630 gene rsmH 2904757 2903831 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_25630 2905249 2904794 gene locus_tag LOCUS_25640 gene mraZ 2905249 2904794 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_25640 2907081 2906242 gene locus_tag LOCUS_25650 gene rsmI 2907081 2906242 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_25650 2907272 2909179 gene locus_tag LOCUS_25660 2907272 2909179 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766553.1 protein_id gnl|my_center|LOCUS_25660 2909151 2909561 gene locus_tag LOCUS_25670 2909151 2909561 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_25670 2909603 2910187 gene locus_tag LOCUS_25680 2909603 2910187 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_25680 2910323 2910910 gene locus_tag LOCUS_25690 2910323 2910910 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406039.1 protein_id gnl|my_center|LOCUS_25690 2910991 2911581 gene locus_tag LOCUS_25700 2910991 2911581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2912224 2911616 gene locus_tag LOCUS_25710 2912224 2911616 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_25710 2913245 2912217 gene locus_tag LOCUS_25720 2913245 2912217 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_25720 2913976 2913500 gene locus_tag LOCUS_25730 2913976 2913500 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_25730 2914699 2914070 gene locus_tag LOCUS_25740 2914699 2914070 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_25740 2915443 2915604 gene locus_tag LOCUS_25750 2915443 2915604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2916710 2918029 gene locus_tag LOCUS_25760 2916710 2918029 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967516.1 protein_id gnl|my_center|LOCUS_25760 2918144 2918641 gene locus_tag LOCUS_25770 2918144 2918641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2919626 2918808 gene locus_tag LOCUS_25780 gene metQ 2919626 2918808 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704853.1 protein_id gnl|my_center|LOCUS_25780 2920382 2919726 gene locus_tag LOCUS_25790 2920382 2919726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 protein_id gnl|my_center|LOCUS_25790 2921403 2920372 gene locus_tag LOCUS_25800 gene metN 2921403 2920372 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569878.1 protein_id gnl|my_center|LOCUS_25800 2922413 2921694 gene locus_tag LOCUS_25810 2922413 2921694 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261750.1 protein_id gnl|my_center|LOCUS_25810 2923226 2922633 gene locus_tag LOCUS_25820 gene tdk 2923226 2922633 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068076.1 protein_id gnl|my_center|LOCUS_25820 2923546 2924409 gene locus_tag LOCUS_25830 2923546 2924409 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_25830 2925118 2924417 gene locus_tag LOCUS_25840 gene idi 2925118 2924417 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261194.1 protein_id gnl|my_center|LOCUS_25840 2925470 2925892 gene locus_tag LOCUS_25850 gene hpaR 2925470 2925892 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093470.1 protein_id gnl|my_center|LOCUS_25850 2926195 2926662 gene locus_tag LOCUS_25860 2926195 2926662 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703940.1 protein_id gnl|my_center|LOCUS_25860 2927436 2926732 gene locus_tag LOCUS_25870 2927436 2926732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2927902 2927826 gene locus_tag LOCUS_t00650 2927902 2927826 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2928204 2928013 gene locus_tag LOCUS_25880 2928204 2928013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2928528 2929253 gene locus_tag LOCUS_25890 2928528 2929253 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382959.1 protein_id gnl|my_center|LOCUS_25890 2929526 2930704 gene locus_tag LOCUS_25900 2929526 2930704 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_25900 2930705 2931265 gene locus_tag LOCUS_25910 2930705 2931265 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_25910 2932336 2931254 gene locus_tag LOCUS_25920 gene dusA 2932336 2931254 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103861.1 protein_id gnl|my_center|LOCUS_25920 2932426 2933478 gene locus_tag LOCUS_25930 2932426 2933478 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693486.1 protein_id gnl|my_center|LOCUS_25930 2933743 2933489 gene locus_tag LOCUS_25940 2933743 2933489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 2934078 2933812 gene locus_tag LOCUS_25950 2934078 2933812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2934257 2934078 gene locus_tag LOCUS_25960 2934257 2934078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2934608 2934375 gene locus_tag LOCUS_25970 2934608 2934375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2935094 2934678 gene locus_tag LOCUS_25980 2935094 2934678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2935570 2935178 gene locus_tag LOCUS_25990 2935570 2935178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 2935899 2935615 gene locus_tag LOCUS_26000 2935899 2935615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2936185 2935892 gene locus_tag LOCUS_26010 2936185 2935892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2936379 2936185 gene locus_tag LOCUS_26020 2936379 2936185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2939162 2936379 gene locus_tag LOCUS_26030 2939162 2936379 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204748.1 protein_id gnl|my_center|LOCUS_26030 2939349 2939149 gene locus_tag LOCUS_26040 2939349 2939149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2939597 2939403 gene locus_tag LOCUS_26050 2939597 2939403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2939832 2939590 gene locus_tag LOCUS_26060 2939832 2939590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2940157 2939825 gene locus_tag LOCUS_26070 2940157 2939825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2940489 2940160 gene locus_tag LOCUS_26080 2940489 2940160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2941118 2940486 gene locus_tag LOCUS_26090 2941118 2940486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2941440 2941102 gene locus_tag LOCUS_26100 2941440 2941102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2941675 2941415 gene locus_tag LOCUS_26110 2941675 2941415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2941851 2941621 gene locus_tag LOCUS_26120 2941851 2941621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2942326 2941844 gene locus_tag LOCUS_26130 2942326 2941844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2942736 2942503 gene locus_tag LOCUS_26140 2942736 2942503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2942854 2943696 gene locus_tag LOCUS_26150 2942854 2943696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2943756 2943941 gene locus_tag LOCUS_26160 2943756 2943941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2944155 2943934 gene locus_tag LOCUS_26170 2944155 2943934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2944320 2944670 gene locus_tag LOCUS_26180 2944320 2944670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2945704 2944685 gene locus_tag LOCUS_26190 2945704 2944685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2945919 2945713 gene locus_tag LOCUS_26200 2945919 2945713 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864897.1 protein_id gnl|my_center|LOCUS_26200 2946333 2945944 gene locus_tag LOCUS_26210 2946333 2945944 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 protein_id gnl|my_center|LOCUS_26210 2948188 2946326 gene locus_tag LOCUS_26220 2948188 2946326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2948587 2948249 gene locus_tag LOCUS_26230 2948587 2948249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2949167 2948661 gene locus_tag LOCUS_26240 2949167 2948661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2950365 2949205 gene locus_tag LOCUS_26250 2950365 2949205 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531063.1 protein_id gnl|my_center|LOCUS_26250 2951066 2950470 gene locus_tag LOCUS_26260 2951066 2950470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2952631 2951045 gene locus_tag LOCUS_26270 2952631 2951045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2953680 2952622 gene locus_tag LOCUS_26280 2953680 2952622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2954569 2953673 gene locus_tag LOCUS_26290 2954569 2953673 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039067818.1 protein_id gnl|my_center|LOCUS_26290 2954919 2954566 gene locus_tag LOCUS_26300 2954919 2954566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2955467 2954919 gene locus_tag LOCUS_26310 2955467 2954919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2956011 2955460 gene locus_tag LOCUS_26320 2956011 2955460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2956508 2956008 gene locus_tag LOCUS_26330 2956508 2956008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2957116 2956502 gene locus_tag LOCUS_26340 2957116 2956502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2957342 2957109 gene locus_tag LOCUS_26350 2957342 2957109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2957842 2957342 gene locus_tag LOCUS_26360 2957842 2957342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015973916.1 protein_id gnl|my_center|LOCUS_26360 2958241 2957846 gene locus_tag LOCUS_26370 2958241 2957846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2958707 2958234 gene locus_tag LOCUS_26380 2958707 2958234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 2961423 2958799 gene locus_tag LOCUS_26390 2961423 2958799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2961908 2961594 gene locus_tag LOCUS_26400 2961908 2961594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2962289 2962098 gene locus_tag LOCUS_26410 2962289 2962098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2963350 2962286 gene locus_tag LOCUS_26420 2963350 2962286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2964744 2963347 gene locus_tag LOCUS_26430 2964744 2963347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2966333 2964741 gene locus_tag LOCUS_26440 2966333 2964741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2967003 2966317 gene locus_tag LOCUS_26450 2967003 2966317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2967858 2967349 gene locus_tag LOCUS_26460 2967858 2967349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2968361 2968098 gene locus_tag LOCUS_26470 gene groES 2968361 2968098 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392082.1 protein_id gnl|my_center|LOCUS_26470 2969404 2968358 gene locus_tag LOCUS_26480 gene xerC 2969404 2968358 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 protein_id gnl|my_center|LOCUS_26480 2970006 2970305 gene locus_tag LOCUS_26490 2970006 2970305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2970670 2971755 gene locus_tag LOCUS_26500 2970670 2971755 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_26500 2973607 2971808 gene locus_tag LOCUS_26510 2973607 2971808 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_26510 2974743 2973718 gene locus_tag LOCUS_26520 2974743 2973718 CDS product DUF3150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939321.1 protein_id gnl|my_center|LOCUS_26520 2975812 2974763 gene locus_tag LOCUS_26530 2975812 2974763 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942803.1 protein_id gnl|my_center|LOCUS_26530 2976965 2975916 gene locus_tag LOCUS_26540 2976965 2975916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2977973 2976987 gene locus_tag LOCUS_26550 2977973 2976987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2978911 2978189 gene locus_tag LOCUS_26560 2978911 2978189 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_26560 2980855 2979863 gene locus_tag LOCUS_26570 2980855 2979863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2982726 2981776 gene locus_tag LOCUS_26580 2982726 2981776 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_26580 2983054 2983515 gene locus_tag LOCUS_26590 2983054 2983515 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 protein_id gnl|my_center|LOCUS_26590 2984510 2983518 gene locus_tag LOCUS_26600 2984510 2983518 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_26600 2986125 2984863 gene locus_tag LOCUS_26610 gene ltrA 2986125 2984863 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_26610 2988659 2987397 gene locus_tag LOCUS_26620 gene ltrA 2988659 2987397 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_26620 2991201 2989939 gene locus_tag LOCUS_26630 gene ltrA 2991201 2989939 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_26630 2991912 2992475 gene locus_tag LOCUS_26640 2991912 2992475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2993821 2992559 gene locus_tag LOCUS_26650 gene ltrA 2993821 2992559 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_26650 2994604 2995152 gene locus_tag LOCUS_26660 2994604 2995152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2996254 2995223 gene locus_tag LOCUS_26670 gene ltrA 2996254 2995223 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_26670 2997871 2997440 gene locus_tag LOCUS_26680 gene tnpA 2997871 2997440 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_26680 2998013 2998540 gene locus_tag LOCUS_26690 2998013 2998540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3000473 3000189 gene locus_tag LOCUS_26700 3000473 3000189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3001254 3000847 gene locus_tag LOCUS_26710 3001254 3000847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26710 3001783 3001505 gene locus_tag LOCUS_26720 3001783 3001505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3001951 3004443 gene locus_tag LOCUS_26730 3001951 3004443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3004809 3005555 gene locus_tag LOCUS_26740 3004809 3005555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26740 3007300 3005663 gene locus_tag LOCUS_26750 3007300 3005663 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_26750 3009258 3007807 gene locus_tag LOCUS_26760 gene katB 3009258 3007807 CDS product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071324.1 protein_id gnl|my_center|LOCUS_26760 3010211 3009609 gene locus_tag LOCUS_26770 3010211 3009609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26770 3010459 3010163 gene locus_tag LOCUS_26780 3010459 3010163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26780 3011016 3010459 gene locus_tag LOCUS_26790 3011016 3010459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3011800 3011282 gene locus_tag LOCUS_26800 3011800 3011282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 3012314 3012105 gene locus_tag LOCUS_26810 3012314 3012105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3012320 3012562 gene locus_tag LOCUS_26820 3012320 3012562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3012821 3014326 gene locus_tag LOCUS_26830 3012821 3014326 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551119.1 protein_id gnl|my_center|LOCUS_26830 3014347 3014886 gene locus_tag LOCUS_26840 3014347 3014886 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490844.1 protein_id gnl|my_center|LOCUS_26840 3017966 3014868 gene locus_tag LOCUS_26850 3017966 3014868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3018494 3019183 gene locus_tag LOCUS_26860 3018494 3019183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3019168 3019680 gene locus_tag LOCUS_26870 3019168 3019680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3020261 3019677 gene locus_tag LOCUS_26880 3020261 3019677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3022258 3022818 gene locus_tag LOCUS_26890 3022258 3022818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3022901 3024217 gene locus_tag LOCUS_26900 3022901 3024217 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 protein_id gnl|my_center|LOCUS_26900 3024364 3024603 gene locus_tag LOCUS_26910 3024364 3024603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 3024749 3025402 gene locus_tag LOCUS_26920 3024749 3025402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3025596 3028802 gene locus_tag LOCUS_26930 3025596 3028802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3029119 3028799 gene locus_tag LOCUS_26940 3029119 3028799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3029225 3031651 gene locus_tag LOCUS_26950 gene trhC 3029225 3031651 CDS product IncHI-type conjugal transfer ATPase TrhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255538.1 protein_id gnl|my_center|LOCUS_26950 3031762 3033561 gene locus_tag LOCUS_26960 3031762 3033561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3033558 3036371 gene locus_tag LOCUS_26970 gene trhN 3033558 3036371 CDS product IncHI-type conjugal transfer protein TrhN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682729.1 protein_id gnl|my_center|LOCUS_26970 3036662 3036390 gene locus_tag LOCUS_26980 3036662 3036390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3037261 3036641 gene locus_tag LOCUS_26990 3037261 3036641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26990 3037680 3037225 gene locus_tag LOCUS_27000 3037680 3037225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27000 3038067 3037822 gene locus_tag LOCUS_27010 3038067 3037822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3038131 3038412 gene locus_tag LOCUS_27020 3038131 3038412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3038409 3038963 gene locus_tag LOCUS_27030 3038409 3038963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3038997 3039767 gene locus_tag LOCUS_27040 3038997 3039767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3039781 3040959 gene locus_tag LOCUS_27050 3039781 3040959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3040956 3041405 gene locus_tag LOCUS_27060 3040956 3041405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3041429 3041776 gene locus_tag LOCUS_27070 3041429 3041776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3041819 3043057 gene locus_tag LOCUS_27080 3041819 3043057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3043051 3044910 gene locus_tag LOCUS_27090 gene traD 3043051 3044910 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095172.1 protein_id gnl|my_center|LOCUS_27090 3044937 3045557 gene locus_tag LOCUS_27100 3044937 3045557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3045558 3046223 gene locus_tag LOCUS_27110 3045558 3046223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3046175 3047314 gene locus_tag LOCUS_27120 3046175 3047314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3047416 3048618 gene locus_tag LOCUS_27130 3047416 3048618 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_27130 3048888 3049175 gene locus_tag LOCUS_27140 3048888 3049175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27140 3049192 3049644 gene locus_tag LOCUS_27150 3049192 3049644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27150 3050074 3051156 gene locus_tag LOCUS_27160 3050074 3051156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3051652 3051341 gene locus_tag LOCUS_27170 3051652 3051341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27170 3052043 3051606 gene locus_tag LOCUS_27180 3052043 3051606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 3052100 3053038 gene locus_tag LOCUS_27190 3052100 3053038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3053105 3053329 gene locus_tag LOCUS_27200 3053105 3053329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3054383 3053358 gene locus_tag LOCUS_27210 3054383 3053358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3054788 3054420 gene locus_tag LOCUS_27220 gene tnpB 3054788 3054420 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_27220 3055108 3054785 gene locus_tag LOCUS_27230 3055108 3054785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3056000 3055665 gene locus_tag LOCUS_27240 3056000 3055665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 3057103 3056000 gene locus_tag LOCUS_27250 gene rnlA 3057103 3056000 CDS product type II toxin-antitoxin system toxin mRNA endoribonuclease RnlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155570.1 protein_id gnl|my_center|LOCUS_27250 3057248 3057418 gene locus_tag LOCUS_27260 3057248 3057418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 3058470 3057568 gene locus_tag LOCUS_27270 3058470 3057568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27270 3058991 3058509 gene locus_tag LOCUS_27280 3058991 3058509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3059034 3059204 gene locus_tag LOCUS_27290 3059034 3059204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3059626 3059294 gene locus_tag LOCUS_27300 3059626 3059294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3060037 3060243 gene locus_tag LOCUS_27310 3060037 3060243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3060394 3062097 gene locus_tag LOCUS_27320 3060394 3062097 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_27320 3062995 3062786 gene locus_tag LOCUS_27330 3062995 3062786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3064593 3063193 gene locus_tag LOCUS_27340 3064593 3063193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3066467 3064914 gene locus_tag LOCUS_27350 3066467 3064914 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409202.1 protein_id gnl|my_center|LOCUS_27350 3066883 3066524 gene locus_tag LOCUS_27360 gene tnpB 3066883 3066524 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_27360 3067227 3066880 gene locus_tag LOCUS_27370 3067227 3066880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3067610 3068107 gene locus_tag LOCUS_27380 3067610 3068107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27380 3068242 3069177 gene locus_tag LOCUS_27390 3068242 3069177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27390 3069821 3070780 gene locus_tag LOCUS_27400 3069821 3070780 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_27400 3071418 3070807 gene locus_tag LOCUS_27410 3071418 3070807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3071577 3072059 gene locus_tag LOCUS_27420 3071577 3072059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3072218 3072997 gene locus_tag LOCUS_27430 3072218 3072997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3073714 3073427 gene locus_tag LOCUS_27440 3073714 3073427 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_27440 3074018 3073707 gene locus_tag LOCUS_27450 3074018 3073707 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_27450 3074183 3074506 gene locus_tag LOCUS_27460 3074183 3074506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3075758 3077020 gene locus_tag LOCUS_27470 gene ltrA 3075758 3077020 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_27470 3077122 3077358 gene locus_tag LOCUS_27480 3077122 3077358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3078576 3077965 gene locus_tag LOCUS_27490 3078576 3077965 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_27490 3078899 3079165 gene locus_tag LOCUS_27500 3078899 3079165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3079191 3079859 gene locus_tag LOCUS_27510 3079191 3079859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27510 3080185 3079886 gene locus_tag LOCUS_27520 3080185 3079886 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391907.1 protein_id gnl|my_center|LOCUS_27520 3080505 3080182 gene locus_tag LOCUS_27530 3080505 3080182 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_27530 3080861 3081820 gene locus_tag LOCUS_27540 3080861 3081820 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_27540 3083796 3082243 gene locus_tag LOCUS_27550 3083796 3082243 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409202.1 protein_id gnl|my_center|LOCUS_27550 3084212 3083853 gene locus_tag LOCUS_27560 gene tnpB 3084212 3083853 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_27560 3084556 3084209 gene locus_tag LOCUS_27570 3084556 3084209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3084806 3084597 gene locus_tag LOCUS_27580 3084806 3084597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3086171 3084909 gene locus_tag LOCUS_27590 gene ltrA 3086171 3084909 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_27590 3086751 3088235 gene locus_tag LOCUS_27600 3086751 3088235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3088251 3088502 gene locus_tag LOCUS_27610 3088251 3088502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 3089661 3088426 gene locus_tag LOCUS_27620 3089661 3088426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3089584 3089988 gene locus_tag LOCUS_27630 3089584 3089988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3090310 3091374 gene locus_tag LOCUS_27640 3090310 3091374 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_27640 3093170 3091908 gene locus_tag LOCUS_27650 gene ltrA 3093170 3091908 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_27650 3094492 3093851 gene locus_tag LOCUS_27660 3094492 3093851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3095985 3094723 gene locus_tag LOCUS_27670 gene ltrA 3095985 3094723 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_27670 3096672 3096974 gene locus_tag LOCUS_27680 3096672 3096974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3096971 3097255 gene locus_tag LOCUS_27690 3096971 3097255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3098620 3097514 gene locus_tag LOCUS_27700 3098620 3097514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27700 3101153 3099891 gene locus_tag LOCUS_27710 gene ltrA 3101153 3099891 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_27710 3101916 3102239 gene locus_tag LOCUS_27720 3101916 3102239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3102236 3102604 gene locus_tag LOCUS_27730 gene tnpB 3102236 3102604 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_27730 3102641 3103183 gene locus_tag LOCUS_27740 3102641 3103183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3103217 3104293 gene locus_tag LOCUS_27750 3103217 3104293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27750 3104445 3104714 gene locus_tag LOCUS_27760 3104445 3104714 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179600.1 protein_id gnl|my_center|LOCUS_27760 3104732 3105244 gene locus_tag LOCUS_27770 3104732 3105244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_27770 3105513 3106913 gene locus_tag LOCUS_27780 3105513 3106913 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_27780 3108317 3107115 gene locus_tag LOCUS_27790 gene ltrA 3108317 3107115 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_27790 3109021 3109620 gene locus_tag LOCUS_27800 3109021 3109620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3110723 3109848 gene locus_tag LOCUS_27810 3110723 3109848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27810 3112843 3111779 gene locus_tag LOCUS_27820 3112843 3111779 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_27820 3113053 3113244 gene locus_tag LOCUS_27830 3113053 3113244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3114917 3113214 gene locus_tag LOCUS_27840 3114917 3113214 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_27840 3116042 3115050 gene locus_tag LOCUS_27850 3116042 3115050 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_27850 3116213 3116428 gene locus_tag LOCUS_27860 3116213 3116428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3116852 3116442 gene locus_tag LOCUS_27870 3116852 3116442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 3117867 3116863 gene locus_tag LOCUS_27880 3117867 3116863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_27880 3118401 3117901 gene locus_tag LOCUS_27890 3118401 3117901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 3118947 3118495 gene locus_tag LOCUS_27900 3118947 3118495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27900 3119257 3118964 gene locus_tag LOCUS_27910 3119257 3118964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27910 3119681 3119313 gene locus_tag LOCUS_27920 3119681 3119313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3120628 3119702 gene locus_tag LOCUS_27930 3120628 3119702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_27930 3122268 3120751 gene locus_tag LOCUS_27940 3122268 3120751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_27940 3122436 3123428 gene locus_tag LOCUS_27950 3122436 3123428 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_27950 3124435 3123596 gene locus_tag LOCUS_27960 3124435 3123596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3126035 3125577 gene locus_tag LOCUS_27970 gene argR 3126035 3125577 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257847.1 protein_id gnl|my_center|LOCUS_27970 3126229 3126963 gene locus_tag LOCUS_27980 gene artP 3126229 3126963 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483352.1 protein_id gnl|my_center|LOCUS_27980 3127035 3127796 gene locus_tag LOCUS_27990 gene artJ 3127035 3127796 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162826.1 protein_id gnl|my_center|LOCUS_27990 3127817 3128515 gene locus_tag LOCUS_28000 gene artQ 3127817 3128515 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244571.1 protein_id gnl|my_center|LOCUS_28000 3128512 3129192 gene locus_tag LOCUS_28010 gene artM 3128512 3129192 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455704.1 protein_id gnl|my_center|LOCUS_28010 3129738 3129238 gene locus_tag LOCUS_28020 3129738 3129238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 3130246 3129881 gene locus_tag LOCUS_28030 3130246 3129881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3131979 3130927 gene locus_tag LOCUS_28040 3131979 3130927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3134200 3132239 gene locus_tag LOCUS_28050 3134200 3132239 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 protein_id gnl|my_center|LOCUS_28050 3134579 3134289 gene locus_tag LOCUS_28060 3134579 3134289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3135697 3134918 gene locus_tag LOCUS_28070 3135697 3134918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3136338 3135856 gene locus_tag LOCUS_28080 3136338 3135856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3137703 3137053 gene locus_tag LOCUS_28090 3137703 3137053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 3138828 3138139 gene locus_tag LOCUS_28100 3138828 3138139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3138995 3140443 gene locus_tag LOCUS_28110 gene dgt 3138995 3140443 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209369.1 protein_id gnl|my_center|LOCUS_28110 3140469 3141056 gene locus_tag LOCUS_28120 3140469 3141056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3141139 3141954 gene locus_tag LOCUS_28130 3141139 3141954 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947778.1 protein_id gnl|my_center|LOCUS_28130 3142207 3143079 gene locus_tag LOCUS_28140 3142207 3143079 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_28140 3143079 3143681 gene locus_tag LOCUS_28150 gene coaE 3143079 3143681 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112838.1 protein_id gnl|my_center|LOCUS_28150 3145327 3143687 gene locus_tag LOCUS_28160 3145327 3143687 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_28160 3146037 3147332 gene locus_tag LOCUS_28170 3146037 3147332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 3147856 3149529 gene locus_tag LOCUS_28180 3147856 3149529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3150028 3151659 gene locus_tag LOCUS_28190 3150028 3151659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 3153744 3151660 gene locus_tag LOCUS_28200 gene fimX 3153744 3151660 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_28200 3154020 3154598 gene locus_tag LOCUS_28210 3154020 3154598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3154595 3155086 gene locus_tag LOCUS_28220 3154595 3155086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3155083 3156138 gene locus_tag LOCUS_28230 3155083 3156138 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_28230 3156138 3156695 gene locus_tag LOCUS_28240 3156138 3156695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3156702 3157136 gene locus_tag LOCUS_28250 3156702 3157136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3157345 3162033 gene locus_tag LOCUS_28260 3157345 3162033 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942681.1 protein_id gnl|my_center|LOCUS_28260 3167003 3162237 gene locus_tag LOCUS_28270 3167003 3162237 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942681.1 protein_id gnl|my_center|LOCUS_28270 3167600 3167043 gene locus_tag LOCUS_28280 3167600 3167043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3168634 3167597 gene locus_tag LOCUS_28290 3168634 3167597 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_28290 3169119 3168631 gene locus_tag LOCUS_28300 3169119 3168631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3169676 3169137 gene locus_tag LOCUS_28310 3169676 3169137 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_28310 3170797 3169943 gene locus_tag LOCUS_28320 3170797 3169943 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707359.1 protein_id gnl|my_center|LOCUS_28320 3170991 3172922 gene locus_tag LOCUS_28330 3170991 3172922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3174008 3173061 gene locus_tag LOCUS_28340 gene ispH 3174008 3173061 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_28340 3174457 3174008 gene locus_tag LOCUS_28350 gene fkpB 3174457 3174008 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_28350 3175087 3174548 gene locus_tag LOCUS_28360 gene lspA 3175087 3174548 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_28360 3176754 3176605 gene locus_tag LOCUS_28370 3176754 3176605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3177060 3176785 gene locus_tag LOCUS_28380 3177060 3176785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3177326 3177060 gene locus_tag LOCUS_28390 3177326 3177060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3177789 3177436 gene locus_tag LOCUS_28400 3177789 3177436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3178750 3178349 gene locus_tag LOCUS_28410 3178750 3178349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3178975 3179439 gene locus_tag LOCUS_28420 3178975 3179439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3179429 3179818 gene locus_tag LOCUS_28430 3179429 3179818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3179818 3180273 gene locus_tag LOCUS_28440 3179818 3180273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3180574 3180410 gene locus_tag LOCUS_28450 3180574 3180410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3181594 3180602 gene locus_tag LOCUS_28460 3181594 3180602 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_28460 3182305 3181976 gene locus_tag LOCUS_28470 3182305 3181976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3182833 3182474 gene locus_tag LOCUS_28480 3182833 3182474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3183672 3182926 gene locus_tag LOCUS_28490 3183672 3182926 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185757.1 protein_id gnl|my_center|LOCUS_28490 3183935 3183657 gene locus_tag LOCUS_28500 3183935 3183657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3184399 3184100 gene locus_tag LOCUS_28510 3184399 3184100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28510 3184975 3184634 gene locus_tag LOCUS_28520 3184975 3184634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3186317 3187054 gene locus_tag LOCUS_28530 3186317 3187054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3187683 3187261 gene locus_tag LOCUS_28540 3187683 3187261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3187821 3188432 gene locus_tag LOCUS_28550 3187821 3188432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3188436 3189740 gene locus_tag LOCUS_28560 3188436 3189740 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 protein_id gnl|my_center|LOCUS_28560 3190030 3191610 gene locus_tag LOCUS_28570 3190030 3191610 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_28570 3192080 3193018 gene locus_tag LOCUS_28580 3192080 3193018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3194919 3193684 gene locus_tag LOCUS_28590 3194919 3193684 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_28590 3194988 3196292 gene locus_tag LOCUS_28600 3194988 3196292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3196350 3197834 gene locus_tag LOCUS_28610 3196350 3197834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3198325 3197921 gene locus_tag LOCUS_28620 3198325 3197921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3198248 3199483 gene locus_tag LOCUS_28630 3198248 3199483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3199612 3200895 gene locus_tag LOCUS_28640 3199612 3200895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3201012 3202004 gene locus_tag LOCUS_28650 3201012 3202004 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_28650 3202318 3202473 gene locus_tag LOCUS_28660 3202318 3202473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3203055 3202495 gene locus_tag LOCUS_28670 3203055 3202495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3203091 3204491 gene locus_tag LOCUS_28680 3203091 3204491 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_28680 3205199 3205420 gene locus_tag LOCUS_28690 3205199 3205420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3205760 3205557 gene locus_tag LOCUS_28700 3205760 3205557 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384747.1 protein_id gnl|my_center|LOCUS_28700 3206097 3206420 gene locus_tag LOCUS_28710 3206097 3206420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3207153 3206755 gene locus_tag LOCUS_28720 3207153 3206755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3209057 3207153 gene locus_tag LOCUS_28730 3209057 3207153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3210805 3209060 gene locus_tag LOCUS_28740 3210805 3209060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3212007 3210802 gene locus_tag LOCUS_28750 3212007 3210802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3213446 3212220 gene locus_tag LOCUS_28760 gene ltrA 3213446 3212220 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_28760 3217125 3214279 gene locus_tag LOCUS_28770 gene ileS 3217125 3214279 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417642.1 protein_id gnl|my_center|LOCUS_28770 3218232 3217297 gene locus_tag LOCUS_28780 gene ribF 3218232 3217297 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 protein_id gnl|my_center|LOCUS_28780 3218346 3219011 gene locus_tag LOCUS_28790 3218346 3219011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 3219470 3220429 gene locus_tag LOCUS_28800 3219470 3220429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3220593 3220426 gene locus_tag LOCUS_28810 3220593 3220426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 3220582 3221943 gene locus_tag LOCUS_28820 3220582 3221943 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065621611.1 protein_id gnl|my_center|LOCUS_28820 3222212 3222739 gene locus_tag LOCUS_28830 3222212 3222739 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096716.1 protein_id gnl|my_center|LOCUS_28830 3222736 3223233 gene locus_tag LOCUS_28840 3222736 3223233 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459994.1 protein_id gnl|my_center|LOCUS_28840 3223411 3225885 gene locus_tag LOCUS_28850 3223411 3225885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3226783 3225989 gene locus_tag LOCUS_28860 3226783 3225989 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_28860 3228524 3226974 gene locus_tag LOCUS_28870 3228524 3226974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3229404 3228925 gene locus_tag LOCUS_28880 3229404 3228925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28880 3231334 3229727 gene locus_tag LOCUS_28890 gene murJ 3231334 3229727 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 protein_id gnl|my_center|LOCUS_28890 3231632 3231898 gene locus_tag LOCUS_28900 gene rpsT 3231632 3231898 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_28900 3232557 3231988 gene locus_tag LOCUS_28910 3232557 3231988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3234512 3233385 gene locus_tag LOCUS_28920 gene proB 3234512 3233385 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_28920 3235782 3234568 gene locus_tag LOCUS_28930 gene cgtA 3235782 3234568 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_28930 3236234 3235977 gene locus_tag LOCUS_28940 gene rpmA 3236234 3235977 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940599.1 protein_id gnl|my_center|LOCUS_28940 3236653 3236342 gene locus_tag LOCUS_28950 gene rplU 3236653 3236342 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210178.1 protein_id gnl|my_center|LOCUS_28950 3236962 3237861 gene locus_tag LOCUS_28960 gene puuE 3236962 3237861 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705419.1 protein_id gnl|my_center|LOCUS_28960 3237930 3238781 gene locus_tag LOCUS_28970 3237930 3238781 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 protein_id gnl|my_center|LOCUS_28970 3238863 3239858 gene locus_tag LOCUS_28980 3238863 3239858 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_28980 3239952 3240443 gene locus_tag LOCUS_28990 3239952 3240443 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395858.1 protein_id gnl|my_center|LOCUS_28990 3242989 3240440 gene locus_tag LOCUS_29000 3242989 3240440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3243152 3244732 gene locus_tag LOCUS_29010 3243152 3244732 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093004.1 protein_id gnl|my_center|LOCUS_29010 3244881 3246071 gene locus_tag LOCUS_29020 3244881 3246071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_29020 3246667 3246134 gene locus_tag LOCUS_29030 3246667 3246134 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 protein_id gnl|my_center|LOCUS_29030 3247204 3246668 gene locus_tag LOCUS_29040 3247204 3246668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3247363 3247998 gene locus_tag LOCUS_29050 3247363 3247998 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563007.1 protein_id gnl|my_center|LOCUS_29050 3248507 3247995 gene locus_tag LOCUS_29060 gene def 3248507 3247995 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 protein_id gnl|my_center|LOCUS_29060 3249632 3248595 gene locus_tag LOCUS_29070 3249632 3248595 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073192.1 protein_id gnl|my_center|LOCUS_29070 3249863 3249939 gene locus_tag LOCUS_t00660 3249863 3249939 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3249983 3250059 gene locus_tag LOCUS_t00670 3249983 3250059 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3250103 3250179 gene locus_tag LOCUS_t00680 3250103 3250179 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3250223 3250299 gene locus_tag LOCUS_t00690 3250223 3250299 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3250820 3250458 gene locus_tag LOCUS_29080 3250820 3250458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3251396 3251037 gene locus_tag LOCUS_29090 3251396 3251037 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_29090 3251716 3251414 gene locus_tag LOCUS_29100 3251716 3251414 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 protein_id gnl|my_center|LOCUS_29100 3252255 3252977 gene locus_tag LOCUS_29110 3252255 3252977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 3253618 3253025 gene locus_tag LOCUS_29120 3253618 3253025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071613.1 protein_id gnl|my_center|LOCUS_29120 3254307 3253789 gene locus_tag LOCUS_29130 3254307 3253789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3254680 3254441 gene locus_tag LOCUS_29140 3254680 3254441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 3256129 3254846 gene locus_tag LOCUS_29150 gene umuC 3256129 3254846 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705911.1 protein_id gnl|my_center|LOCUS_29150 3256560 3256129 gene locus_tag LOCUS_29160 gene umuD 3256560 3256129 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_29160 3257353 3256802 gene locus_tag LOCUS_29170 3257353 3256802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3259187 3257634 gene locus_tag LOCUS_29180 3259187 3257634 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072385.1 protein_id gnl|my_center|LOCUS_29180 3259621 3259812 gene locus_tag LOCUS_29190 3259621 3259812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3261224 3259863 gene locus_tag LOCUS_29200 3261224 3259863 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_29200 3262281 3261694 gene locus_tag LOCUS_29210 3262281 3261694 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073335.1 protein_id gnl|my_center|LOCUS_29210 3262493 3263719 gene locus_tag LOCUS_29220 3262493 3263719 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073334.1 protein_id gnl|my_center|LOCUS_29220 3263735 3266905 gene locus_tag LOCUS_29230 3263735 3266905 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073333.1 protein_id gnl|my_center|LOCUS_29230 3267132 3267806 gene locus_tag LOCUS_29240 3267132 3267806 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_29240 3269498 3268086 gene locus_tag LOCUS_29250 3269498 3268086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3269847 3270152 gene locus_tag LOCUS_29260 3269847 3270152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3270371 3270895 gene locus_tag LOCUS_29270 3270371 3270895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3270938 3271291 gene locus_tag LOCUS_29280 3270938 3271291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 3274603 3271181 gene locus_tag LOCUS_29290 3274603 3271181 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930312.1 protein_id gnl|my_center|LOCUS_29290 3276883 3274658 gene locus_tag LOCUS_29300 3276883 3274658 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050513484.1 protein_id gnl|my_center|LOCUS_29300 3277675 3279129 gene locus_tag LOCUS_29310 3277675 3279129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3279129 3280925 gene locus_tag LOCUS_29320 3279129 3280925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 3280922 3283183 gene locus_tag LOCUS_29330 3280922 3283183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3283585 3283352 gene locus_tag LOCUS_29340 3283585 3283352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3284903 3283674 gene locus_tag LOCUS_29350 3284903 3283674 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_29350 3285073 3285546 gene locus_tag LOCUS_29360 3285073 3285546 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169975.1 protein_id gnl|my_center|LOCUS_29360 3286154 3285567 gene locus_tag LOCUS_29370 3286154 3285567 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_29370 3286467 3286862 gene locus_tag LOCUS_29380 3286467 3286862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29380 3287510 3289390 gene locus_tag LOCUS_29390 3287510 3289390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3289402 3291387 gene locus_tag LOCUS_29400 3289402 3291387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3292070 3291654 gene locus_tag LOCUS_29410 3292070 3291654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3292500 3293573 gene locus_tag LOCUS_29420 3292500 3293573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29420 3293681 3294301 gene locus_tag LOCUS_29430 3293681 3294301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 3294298 3294696 gene locus_tag LOCUS_29440 3294298 3294696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3295070 3294789 gene locus_tag LOCUS_29450 3295070 3294789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 3295506 3295054 gene locus_tag LOCUS_29460 3295506 3295054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3295814 3295521 gene locus_tag LOCUS_29470 3295814 3295521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3296248 3297600 gene locus_tag LOCUS_29480 3296248 3297600 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_29480 3297601 3298572 gene locus_tag LOCUS_29490 3297601 3298572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3301358 3300123 gene locus_tag LOCUS_29500 3301358 3300123 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_29500 3301445 3302071 gene locus_tag LOCUS_29510 3301445 3302071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 3302059 3302892 gene locus_tag LOCUS_29520 3302059 3302892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 3302903 3303343 gene locus_tag LOCUS_29530 3302903 3303343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3303364 3305067 gene locus_tag LOCUS_29540 3303364 3305067 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_29540 3305080 3306501 gene locus_tag LOCUS_29550 3305080 3306501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3306999 3306568 gene locus_tag LOCUS_29560 gene tnpA 3306999 3306568 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_29560 3307100 3308389 gene locus_tag LOCUS_29570 3307100 3308389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 3308382 3309617 gene locus_tag LOCUS_29580 3308382 3309617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3310552 3310127 gene locus_tag LOCUS_29590 3310552 3310127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29590 3311174 3310683 gene locus_tag LOCUS_29600 3311174 3310683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3311142 3312008 gene locus_tag LOCUS_29610 3311142 3312008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3312803 3312087 gene locus_tag LOCUS_29620 3312803 3312087 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_29620 3314082 3312796 gene locus_tag LOCUS_29630 3314082 3312796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 3314853 3314098 gene locus_tag LOCUS_29640 gene istB 3314853 3314098 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_29640 3315325 3314864 gene locus_tag LOCUS_29650 3315325 3314864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3316972 3315338 gene locus_tag LOCUS_29660 3316972 3315338 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_29660 3318137 3317019 gene locus_tag LOCUS_29670 3318137 3317019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3320522 3318345 gene locus_tag LOCUS_29680 3320522 3318345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3320947 3322218 gene locus_tag LOCUS_29690 3320947 3322218 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_29690 3322211 3322447 gene locus_tag LOCUS_29700 3322211 3322447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 3323616 3322414 gene locus_tag LOCUS_29710 3323616 3322414 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_29710 3324003 3325043 gene locus_tag LOCUS_29720 3324003 3325043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3325598 3325029 gene locus_tag LOCUS_29730 3325598 3325029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3325694 3327247 gene locus_tag LOCUS_29740 3325694 3327247 CDS product IS66-like element ISBj7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084592.1 protein_id gnl|my_center|LOCUS_29740 3327266 3327412 gene locus_tag LOCUS_29750 3327266 3327412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3331322 3327468 gene locus_tag LOCUS_29760 3331322 3327468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3333100 3332981 gene locus_tag LOCUS_29770 3333100 3332981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3334380 3333949 gene locus_tag LOCUS_29780 gene tnpA 3334380 3333949 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_29780 3336158 3334608 gene locus_tag LOCUS_29790 3336158 3334608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3336553 3337545 gene locus_tag LOCUS_29800 3336553 3337545 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_29800 3338514 3337951 gene locus_tag LOCUS_29810 3338514 3337951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3339058 3338774 gene locus_tag LOCUS_29820 3339058 3338774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29820 3339342 3339130 gene locus_tag LOCUS_29830 3339342 3339130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3339652 3339576 gene locus_tag LOCUS_t00700 3339652 3339576 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3340243 3339713 gene locus_tag LOCUS_29840 3340243 3339713 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092502.1 protein_id gnl|my_center|LOCUS_29840 3341608 3340247 gene locus_tag LOCUS_29850 3341608 3340247 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_29850 3342199 3342435 gene locus_tag LOCUS_29860 3342199 3342435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3343311 3342460 gene locus_tag LOCUS_29870 3343311 3342460 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_29870 3343923 3343393 gene locus_tag LOCUS_29880 3343923 3343393 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 protein_id gnl|my_center|LOCUS_29880 3344464 3344129 gene locus_tag LOCUS_29890 3344464 3344129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3344637 3345587 gene locus_tag LOCUS_29900 3344637 3345587 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071246.1 protein_id gnl|my_center|LOCUS_29900 3345591 3345956 gene locus_tag LOCUS_29910 3345591 3345956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3345965 3346780 gene locus_tag LOCUS_29920 3345965 3346780 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771074.1 protein_id gnl|my_center|LOCUS_29920 3346827 3348380 gene locus_tag LOCUS_29930 3346827 3348380 CDS product UDP-phosphomannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957674.1 protein_id gnl|my_center|LOCUS_29930 3348953 3348483 gene locus_tag LOCUS_29940 3348953 3348483 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_29940 3353051 3349134 gene locus_tag LOCUS_29950 gene purL 3353051 3349134 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_29950 3353702 3353235 gene locus_tag LOCUS_29960 gene tadA 3353702 3353235 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_29960 3354125 3354613 gene locus_tag LOCUS_29970 3354125 3354613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3354705 3356036 gene locus_tag LOCUS_29980 gene bscN 3354705 3356036 CDS product SctN family type III secretion system ATPase BscN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064189.1 protein_id gnl|my_center|LOCUS_29980 3356046 3356507 gene locus_tag LOCUS_29990 gene pscO 3356046 3356507 CDS product type III secretion system central stalk protein PscO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087688.1 protein_id gnl|my_center|LOCUS_29990 3356579 3357316 gene locus_tag LOCUS_30000 3356579 3357316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3357319 3358356 gene locus_tag LOCUS_30010 gene vscQ 3357319 3358356 CDS product SctQ family type III secretion system cytoplasmic ring protein VscQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105899.1 protein_id gnl|my_center|LOCUS_30010 3358401 3359060 gene locus_tag LOCUS_30020 gene vscR 3358401 3359060 CDS product SctR family type III secretion system export apparatus subunit VscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377232.1 protein_id gnl|my_center|LOCUS_30020 3359082 3359345 gene locus_tag LOCUS_30030 gene yscS 3359082 3359345 CDS product SctS family type III secretion system export apparatus subunit YscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212945.1 protein_id gnl|my_center|LOCUS_30030 3359347 3360138 gene locus_tag LOCUS_30040 gene pscT 3359347 3360138 CDS product SctT family type III secretion system export apparatus subunit PscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114621.1 protein_id gnl|my_center|LOCUS_30040 3360135 3361187 gene locus_tag LOCUS_30050 gene yscU 3360135 3361187 CDS product type III secretion system export apparatus switch protein YscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176440.1 protein_id gnl|my_center|LOCUS_30050 3363509 3361182 gene locus_tag LOCUS_30060 3363509 3361182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3363848 3365284 gene locus_tag LOCUS_30070 gene aspA 3363848 3365284 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269395.1 protein_id gnl|my_center|LOCUS_30070 3365957 3366610 gene locus_tag LOCUS_30080 3365957 3366610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_30080 3367038 3367427 gene locus_tag LOCUS_30090 3367038 3367427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3368849 3367416 gene locus_tag LOCUS_30100 gene sbcB 3368849 3367416 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_30100 3369492 3368863 gene locus_tag LOCUS_30110 3369492 3368863 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 protein_id gnl|my_center|LOCUS_30110 3369912 3369553 gene locus_tag LOCUS_30120 3369912 3369553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3381444 3369928 gene locus_tag LOCUS_30130 3381444 3369928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3382606 3381857 gene locus_tag LOCUS_30140 3382606 3381857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3383128 3382697 gene locus_tag LOCUS_30150 gene tnpA 3383128 3382697 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_30150 3385217 3383232 gene locus_tag LOCUS_30160 3385217 3383232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3386323 3385409 gene locus_tag LOCUS_30170 3386323 3385409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3387296 3386478 gene locus_tag LOCUS_30180 3387296 3386478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3387529 3388107 gene locus_tag LOCUS_30190 gene sodB 3387529 3388107 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 protein_id gnl|my_center|LOCUS_30190 3388264 3388746 gene locus_tag LOCUS_30200 3388264 3388746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 3390348 3388948 gene locus_tag LOCUS_30210 3390348 3388948 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_30210 3390567 3391058 gene locus_tag LOCUS_30220 3390567 3391058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3391189 3391614 gene locus_tag LOCUS_30230 3391189 3391614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 3391618 3391977 gene locus_tag LOCUS_30240 3391618 3391977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3392163 3394376 gene locus_tag LOCUS_30250 3392163 3394376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3394369 3396120 gene locus_tag LOCUS_30260 3394369 3396120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3396196 3397899 gene locus_tag LOCUS_30270 3396196 3397899 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_30270 3398058 3398912 gene locus_tag LOCUS_30280 3398058 3398912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3398986 3400482 gene locus_tag LOCUS_30290 3398986 3400482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3400894 3400655 gene locus_tag LOCUS_30300 3400894 3400655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3401012 3401611 gene locus_tag LOCUS_30310 3401012 3401611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3401553 3402386 gene locus_tag LOCUS_30320 3401553 3402386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 3403480 3402566 gene locus_tag LOCUS_30330 3403480 3402566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 3404697 3403594 gene locus_tag LOCUS_30340 3404697 3403594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3406070 3404688 gene locus_tag LOCUS_30350 3406070 3404688 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 protein_id gnl|my_center|LOCUS_30350 3407551 3406190 gene locus_tag LOCUS_30360 3407551 3406190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3407879 3407625 gene locus_tag LOCUS_30370 3407879 3407625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3408295 3407936 gene locus_tag LOCUS_30380 gene tnpB 3408295 3407936 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_30380 3408639 3408292 gene locus_tag LOCUS_30390 3408639 3408292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 3409289 3408672 gene locus_tag LOCUS_30400 3409289 3408672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30400 3410374 3409253 gene locus_tag LOCUS_30410 3410374 3409253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30410 3411191 3410454 gene locus_tag LOCUS_30420 3411191 3410454 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_30420 3412131 3411310 gene locus_tag LOCUS_30430 3412131 3411310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3412981 3412376 gene locus_tag LOCUS_30440 3412981 3412376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30440 3413746 3413192 gene locus_tag LOCUS_30450 3413746 3413192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30450 3413855 3414733 gene locus_tag LOCUS_30460 3413855 3414733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3415936 3414734 gene locus_tag LOCUS_30470 3415936 3414734 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_30470 3416772 3416344 gene locus_tag LOCUS_30480 3416772 3416344 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032472658.1 protein_id gnl|my_center|LOCUS_30480 3418139 3416769 gene locus_tag LOCUS_30490 3418139 3416769 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 protein_id gnl|my_center|LOCUS_30490 3418476 3418967 gene locus_tag LOCUS_30500 3418476 3418967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30500 3418957 3419142 gene locus_tag LOCUS_30510 3418957 3419142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 3419903 3419139 gene locus_tag LOCUS_30520 3419903 3419139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3420160 3419981 gene locus_tag LOCUS_30530 3420160 3419981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3422587 3420467 gene locus_tag LOCUS_30540 3422587 3420467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 3423600 3422605 gene locus_tag LOCUS_30550 3423600 3422605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 3424771 3423830 gene locus_tag LOCUS_30560 3424771 3423830 CDS product DUF1186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882857.1 protein_id gnl|my_center|LOCUS_30560 3425320 3426348 gene locus_tag LOCUS_30570 3425320 3426348 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_30570 3427096 3426410 gene locus_tag LOCUS_30580 3427096 3426410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3428039 3427260 gene locus_tag LOCUS_30590 3428039 3427260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3428680 3428198 gene locus_tag LOCUS_30600 3428680 3428198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3429100 3428774 gene locus_tag LOCUS_30610 3429100 3428774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3429239 3429087 gene locus_tag LOCUS_30620 3429239 3429087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3429470 3429243 gene locus_tag LOCUS_30630 3429470 3429243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3430099 3429425 gene locus_tag LOCUS_30640 3430099 3429425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3430270 3430518 gene locus_tag LOCUS_30650 3430270 3430518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3431258 3430689 gene locus_tag LOCUS_30660 gene azoR3 3431258 3430689 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_30660 3432641 3431406 gene locus_tag LOCUS_30670 3432641 3431406 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_30670 3433556 3432885 gene locus_tag LOCUS_30680 3433556 3432885 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_30680 3434932 3433598 gene locus_tag LOCUS_30690 3434932 3433598 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 protein_id gnl|my_center|LOCUS_30690 3435201 3434956 gene locus_tag LOCUS_30700 3435201 3434956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30700 3435405 3436865 gene locus_tag LOCUS_30710 3435405 3436865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 3437077 3438354 gene locus_tag LOCUS_30720 gene icd 3437077 3438354 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_30720 3440578 3438329 gene locus_tag LOCUS_30730 3440578 3438329 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992369.1 protein_id gnl|my_center|LOCUS_30730 3440844 3441467 gene locus_tag LOCUS_30740 3440844 3441467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 3442440 3441493 gene locus_tag LOCUS_30750 3442440 3441493 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_30750 3442602 3444185 gene locus_tag LOCUS_30760 3442602 3444185 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_30760 3444839 3444249 gene locus_tag LOCUS_30770 3444839 3444249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3444980 3445468 gene locus_tag LOCUS_30780 3444980 3445468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3445449 3447278 gene locus_tag LOCUS_30790 gene aceK 3445449 3447278 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706819.1 protein_id gnl|my_center|LOCUS_30790 3449839 3448388 gene locus_tag LOCUS_30800 3449839 3448388 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946153.1 protein_id gnl|my_center|LOCUS_30800 3450036 3450701 gene locus_tag LOCUS_30810 3450036 3450701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3451372 3450806 gene locus_tag LOCUS_30820 3451372 3450806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3451537 3451785 gene locus_tag LOCUS_30830 3451537 3451785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3452910 3452014 gene locus_tag LOCUS_30840 3452910 3452014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3453726 3453151 gene locus_tag LOCUS_30850 3453726 3453151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3453781 3455484 gene locus_tag LOCUS_30860 3453781 3455484 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_30860 3456218 3456985 gene locus_tag LOCUS_30870 3456218 3456985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3457295 3458269 gene locus_tag LOCUS_30880 3457295 3458269 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_30880 3459536 3458262 gene locus_tag LOCUS_30890 3459536 3458262 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958628.1 protein_id gnl|my_center|LOCUS_30890 3459856 3460848 gene locus_tag LOCUS_30900 3459856 3460848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3462271 3460958 gene locus_tag LOCUS_30910 3462271 3460958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958628.1 protein_id gnl|my_center|LOCUS_30910 3462785 3462393 gene locus_tag LOCUS_30920 3462785 3462393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3462996 3464381 gene locus_tag LOCUS_30930 3462996 3464381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020580469.1 protein_id gnl|my_center|LOCUS_30930 3464443 3465117 gene locus_tag LOCUS_30940 3464443 3465117 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 protein_id gnl|my_center|LOCUS_30940 3465145 3465657 gene locus_tag LOCUS_30950 3465145 3465657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3466551 3465700 gene locus_tag LOCUS_30960 3466551 3465700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3467043 3467504 gene locus_tag LOCUS_30970 3467043 3467504 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261062.1 protein_id gnl|my_center|LOCUS_30970 3468836 3467610 gene locus_tag LOCUS_30980 gene ltrA 3468836 3467610 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_30980 3470632 3469667 gene locus_tag LOCUS_30990 3470632 3469667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3470749 3472257 gene locus_tag LOCUS_31000 3470749 3472257 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050942.1 protein_id gnl|my_center|LOCUS_31000 3472264 3472473 gene locus_tag LOCUS_31010 3472264 3472473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3472625 3473584 gene locus_tag LOCUS_31020 3472625 3473584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3475397 3473616 gene locus_tag LOCUS_31030 3475397 3473616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3477326 3475509 gene locus_tag LOCUS_31040 3477326 3475509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3477525 3478427 gene locus_tag LOCUS_31050 gene rarD 3477525 3478427 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012532645.1 protein_id gnl|my_center|LOCUS_31050 3480127 3478529 gene locus_tag LOCUS_31060 gene fadD1 3480127 3478529 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104873.1 protein_id gnl|my_center|LOCUS_31060 3480906 3480202 gene locus_tag LOCUS_31070 3480906 3480202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3482132 3480993 gene locus_tag LOCUS_31080 gene fabH 3482132 3480993 CDS product 3-oxoacyl-ACP synthase III FabH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722325.1 protein_id gnl|my_center|LOCUS_31080 3483847 3482156 gene locus_tag LOCUS_31090 gene ilvB 3483847 3482156 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815985.1 protein_id gnl|my_center|LOCUS_31090 3485522 3483951 gene locus_tag LOCUS_31100 3485522 3483951 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261520.1 protein_id gnl|my_center|LOCUS_31100 3485884 3485510 gene locus_tag LOCUS_31110 3485884 3485510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3485931 3486299 gene locus_tag LOCUS_31120 3485931 3486299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 3486540 3486695 gene locus_tag LOCUS_31130 3486540 3486695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3486703 3487746 gene locus_tag LOCUS_31140 3486703 3487746 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118268.1 protein_id gnl|my_center|LOCUS_31140 3487750 3488385 gene locus_tag LOCUS_31150 3487750 3488385 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153584.1 protein_id gnl|my_center|LOCUS_31150 3488542 3489222 gene locus_tag LOCUS_31160 3488542 3489222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 3490767 3489328 gene locus_tag LOCUS_31170 gene tldD 3490767 3489328 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_31170 3495951 3492061 gene locus_tag LOCUS_31180 3495951 3492061 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_31180 3497541 3496069 gene locus_tag LOCUS_31190 gene rng 3497541 3496069 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_31190 3498208 3497621 gene locus_tag LOCUS_31200 3498208 3497621 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_31200 3498719 3498231 gene locus_tag LOCUS_31210 gene mreD 3498719 3498231 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_31210 3499549 3498716 gene locus_tag LOCUS_31220 gene mreC 3499549 3498716 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_31220 3500847 3499810 gene locus_tag LOCUS_31230 gene mreB 3500847 3499810 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_31230 3501511 3502503 gene locus_tag LOCUS_31240 3501511 3502503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3502739 3504082 gene locus_tag LOCUS_31250 3502739 3504082 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022227.1 protein_id gnl|my_center|LOCUS_31250 3504707 3504994 gene locus_tag LOCUS_31260 gene gatC 3504707 3504994 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_31260 3505102 3506553 gene locus_tag LOCUS_31270 gene gatA 3505102 3506553 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 protein_id gnl|my_center|LOCUS_31270 3506571 3508016 gene locus_tag LOCUS_31280 gene gatB 3506571 3508016 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_31280 3508130 3508609 gene locus_tag LOCUS_31290 3508130 3508609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 3509415 3508723 gene locus_tag LOCUS_31300 3509415 3508723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3509635 3510627 gene locus_tag LOCUS_31310 3509635 3510627 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_31310 3511226 3510630 gene locus_tag LOCUS_31320 3511226 3510630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3511559 3513028 gene locus_tag LOCUS_31330 3511559 3513028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3515317 3513269 gene locus_tag LOCUS_31340 3515317 3513269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3516795 3515500 gene locus_tag LOCUS_31350 gene eno 3516795 3515500 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095220.1 protein_id gnl|my_center|LOCUS_31350 3517041 3517406 gene locus_tag LOCUS_31360 3517041 3517406 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883149.1 protein_id gnl|my_center|LOCUS_31360 3518833 3517598 gene locus_tag LOCUS_31370 3518833 3517598 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_31370 3519022 3519582 gene locus_tag LOCUS_31380 3519022 3519582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3519597 3520217 gene locus_tag LOCUS_31390 gene dmsB 3519597 3520217 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656008.1 protein_id gnl|my_center|LOCUS_31390 3520220 3521065 gene locus_tag LOCUS_31400 3520220 3521065 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262982.1 protein_id gnl|my_center|LOCUS_31400 3522008 3523000 gene locus_tag LOCUS_31410 3522008 3523000 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_31410 3523397 3522990 gene locus_tag LOCUS_31420 3523397 3522990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3524101 3523607 gene locus_tag LOCUS_31430 3524101 3523607 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 protein_id gnl|my_center|LOCUS_31430 3524625 3524230 gene locus_tag LOCUS_31440 3524625 3524230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3525134 3526711 gene locus_tag LOCUS_31450 3525134 3526711 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_31450 3527444 3526818 gene locus_tag LOCUS_31460 3527444 3526818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3527499 3529133 gene locus_tag LOCUS_31470 3527499 3529133 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_31470 3529838 3529107 gene locus_tag LOCUS_31480 3529838 3529107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3530622 3529996 gene locus_tag LOCUS_31490 gene upp 3530622 3529996 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 protein_id gnl|my_center|LOCUS_31490 3530972 3531529 gene locus_tag LOCUS_31500 3530972 3531529 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_31500 3533013 3531625 gene locus_tag LOCUS_31510 3533013 3531625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3534552 3533269 gene locus_tag LOCUS_31520 3534552 3533269 CDS product serine/threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706270.1 protein_id gnl|my_center|LOCUS_31520 3534787 3535161 gene locus_tag LOCUS_31530 3534787 3535161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 3535272 3535667 gene locus_tag LOCUS_31540 3535272 3535667 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_31540 3535920 3536423 gene locus_tag LOCUS_31550 3535920 3536423 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008989681.1 protein_id gnl|my_center|LOCUS_31550 3536590 3538377 gene locus_tag LOCUS_31560 3536590 3538377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3538552 3538878 gene locus_tag LOCUS_31570 gene sugE 3538552 3538878 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921272.1 protein_id gnl|my_center|LOCUS_31570 3539267 3539118 gene locus_tag LOCUS_31580 3539267 3539118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3539345 3540670 gene locus_tag LOCUS_31590 3539345 3540670 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093087.1 protein_id gnl|my_center|LOCUS_31590 3541755 3540730 gene locus_tag LOCUS_31600 3541755 3540730 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073528.1 protein_id gnl|my_center|LOCUS_31600 3541984 3542703 gene locus_tag LOCUS_31610 gene tsaA 3541984 3542703 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094026.1 protein_id gnl|my_center|LOCUS_31610 3544363 3542669 gene locus_tag LOCUS_31620 3544363 3542669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3544553 3544783 gene locus_tag LOCUS_31630 3544553 3544783 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091959.1 protein_id gnl|my_center|LOCUS_31630 3546292 3544841 gene locus_tag LOCUS_31640 3546292 3544841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3546936 3546307 gene locus_tag LOCUS_31650 3546936 3546307 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 protein_id gnl|my_center|LOCUS_31650 3548987 3546933 gene locus_tag LOCUS_31660 gene ligA 3548987 3546933 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_31660 3550080 3549055 gene locus_tag LOCUS_31670 gene zipA 3550080 3549055 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_31670 3553758 3550249 gene locus_tag LOCUS_31680 gene smc 3553758 3550249 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_31680 3554670 3554041 gene locus_tag LOCUS_31690 3554670 3554041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3556007 3554748 gene locus_tag LOCUS_31700 3556007 3554748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 3557307 3556147 gene locus_tag LOCUS_31710 3557307 3556147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 3557777 3557304 gene locus_tag LOCUS_31720 3557777 3557304 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_31720 3558314 3557778 gene locus_tag LOCUS_31730 3558314 3557778 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 protein_id gnl|my_center|LOCUS_31730 3560299 3558311 gene locus_tag LOCUS_31740 3560299 3558311 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_31740 3560763 3560296 gene locus_tag LOCUS_31750 gene ccmE 3560763 3560296 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_31750 3561881 3561129 gene locus_tag LOCUS_31760 3561881 3561129 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_31760 3562625 3562170 gene locus_tag LOCUS_31770 3562625 3562170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3563624 3562860 gene locus_tag LOCUS_31780 gene fliA 3563624 3562860 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378731.1 protein_id gnl|my_center|LOCUS_31780 3564445 3563627 gene locus_tag LOCUS_31790 gene fleN 3564445 3563627 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_31790 3566491 3565031 gene locus_tag LOCUS_31800 gene fleQ 3566491 3565031 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_31800 3567392 3566766 gene locus_tag LOCUS_31810 3567392 3566766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3567618 3568067 gene locus_tag LOCUS_31820 3567618 3568067 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_31820 3568140 3568922 gene locus_tag LOCUS_31830 gene cpdA 3568140 3568922 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482023.1 protein_id gnl|my_center|LOCUS_31830 3568999 3569307 gene locus_tag LOCUS_31840 3568999 3569307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3571416 3569485 gene locus_tag LOCUS_31850 3571416 3569485 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_31850 3572367 3571468 gene locus_tag LOCUS_31860 3572367 3571468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3573266 3572364 gene locus_tag LOCUS_31870 3573266 3572364 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_31870 3575149 3573263 gene locus_tag LOCUS_31880 3575149 3573263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 3576502 3575231 gene locus_tag LOCUS_31890 3576502 3575231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3578367 3576619 gene locus_tag LOCUS_31900 3578367 3576619 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 protein_id gnl|my_center|LOCUS_31900 3578567 3579463 gene locus_tag LOCUS_31910 3578567 3579463 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099119.1 protein_id gnl|my_center|LOCUS_31910 3580316 3579522 gene locus_tag LOCUS_31920 3580316 3579522 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_31920 3580669 3581862 gene locus_tag LOCUS_31930 3580669 3581862 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263749.1 protein_id gnl|my_center|LOCUS_31930 3583447 3581948 gene locus_tag LOCUS_31940 3583447 3581948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3584738 3583905 gene locus_tag LOCUS_31950 3584738 3583905 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211826335.1 protein_id gnl|my_center|LOCUS_31950 3585595 3584735 gene locus_tag LOCUS_31960 gene lgt 3585595 3584735 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_31960 3586457 3585672 gene locus_tag LOCUS_31970 3586457 3585672 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_31970 3586761 3587570 gene locus_tag LOCUS_31980 3586761 3587570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3590090 3587670 gene locus_tag LOCUS_31990 3590090 3587670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3590485 3591492 gene locus_tag LOCUS_32000 3590485 3591492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3593825 3591627 gene locus_tag LOCUS_32010 gene glgB 3593825 3591627 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707356.1 protein_id gnl|my_center|LOCUS_32010 3595444 3593984 gene locus_tag LOCUS_32020 gene glgA 3595444 3593984 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863328.1 protein_id gnl|my_center|LOCUS_32020 3596657 3595434 gene locus_tag LOCUS_32030 gene glgC 3596657 3595434 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707513.1 protein_id gnl|my_center|LOCUS_32030 3598553 3596865 gene locus_tag LOCUS_32040 gene pgm 3598553 3596865 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_32040 3598640 3600079 gene locus_tag LOCUS_32050 3598640 3600079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3602430 3600358 gene locus_tag LOCUS_32060 gene glgX 3602430 3600358 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707355.1 protein_id gnl|my_center|LOCUS_32060 3604849 3602588 gene locus_tag LOCUS_32070 gene glgB 3604849 3602588 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707356.1 protein_id gnl|my_center|LOCUS_32070 3607394 3604926 gene locus_tag LOCUS_32080 3607394 3604926 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_32080 3609435 3608092 gene locus_tag LOCUS_32090 gene lamB 3609435 3608092 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973673.1 protein_id gnl|my_center|LOCUS_32090 3609755 3610768 gene locus_tag LOCUS_32100 3609755 3610768 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_32100 3611171 3611785 gene locus_tag LOCUS_32110 3611171 3611785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 3612141 3613319 gene locus_tag LOCUS_32120 gene malE 3612141 3613319 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_32120 3613389 3614924 gene locus_tag LOCUS_32130 gene malF 3613389 3614924 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368773.1 protein_id gnl|my_center|LOCUS_32130 3614927 3615817 gene locus_tag LOCUS_32140 gene malG 3614927 3615817 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_32140 3615909 3617042 gene locus_tag LOCUS_32150 gene ugpC 3615909 3617042 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705560.1 protein_id gnl|my_center|LOCUS_32150 3617122 3619302 gene locus_tag LOCUS_32160 gene malQ 3617122 3619302 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070791.1 protein_id gnl|my_center|LOCUS_32160 3621526 3619370 gene locus_tag LOCUS_32170 3621526 3619370 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815963.1 protein_id gnl|my_center|LOCUS_32170 3622231 3623208 gene locus_tag LOCUS_32180 3622231 3623208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 3623677 3623231 gene locus_tag LOCUS_32190 3623677 3623231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3629240 3623670 gene locus_tag LOCUS_32200 3629240 3623670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3630533 3629241 gene locus_tag LOCUS_32210 3630533 3629241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3631038 3630526 gene locus_tag LOCUS_32220 3631038 3630526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 3631412 3631035 gene locus_tag LOCUS_32230 gene pilH 3631412 3631035 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_32230 3631800 3631426 gene locus_tag LOCUS_32240 gene pilG 3631800 3631426 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 protein_id gnl|my_center|LOCUS_32240 3632126 3633841 gene locus_tag LOCUS_32250 gene pilB 3632126 3633841 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_32250 3635799 3633886 gene locus_tag LOCUS_32260 3635799 3633886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 3637011 3635800 gene locus_tag LOCUS_32270 3637011 3635800 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_32270 3637735 3637238 gene locus_tag LOCUS_32280 3637735 3637238 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262622.1 protein_id gnl|my_center|LOCUS_32280 3638049 3639980 gene locus_tag LOCUS_32290 3638049 3639980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3639997 3641043 gene locus_tag LOCUS_32300 3639997 3641043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3641438 3641088 gene locus_tag LOCUS_32310 3641438 3641088 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_32310 3642250 3641546 gene locus_tag LOCUS_32320 3642250 3641546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3642823 3643896 gene locus_tag LOCUS_32330 gene pilM 3642823 3643896 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_32330 3643889 3644491 gene locus_tag LOCUS_32340 3643889 3644491 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 protein_id gnl|my_center|LOCUS_32340 3644475 3645209 gene locus_tag LOCUS_32350 gene pilO 3644475 3645209 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_32350 3645218 3645739 gene locus_tag LOCUS_32360 gene pilP 3645218 3645739 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_32360 3645819 3647906 gene locus_tag LOCUS_32370 3645819 3647906 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093473135.1 protein_id gnl|my_center|LOCUS_32370 3648367 3648026 gene locus_tag LOCUS_32380 3648367 3648026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3648777 3648361 gene locus_tag LOCUS_32390 gene tppA 3648777 3648361 CDS product type IVa pilus pseudopilin TppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 protein_id gnl|my_center|LOCUS_32390 3652089 3648781 gene locus_tag LOCUS_32400 3652089 3648781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3652585 3652112 gene locus_tag LOCUS_32410 3652585 3652112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3653465 3652578 gene locus_tag LOCUS_32420 3653465 3652578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3653989 3653462 gene locus_tag LOCUS_32430 gene pilV 3653989 3653462 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207814.1 protein_id gnl|my_center|LOCUS_32430 3654474 3653980 gene locus_tag LOCUS_32440 3654474 3653980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3654640 3655104 gene locus_tag LOCUS_32450 3654640 3655104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3655427 3655831 gene locus_tag LOCUS_32460 3655427 3655831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3657002 3655959 gene locus_tag LOCUS_32470 gene pilT 3657002 3655959 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_32470 3657580 3658815 gene locus_tag LOCUS_32480 gene malE 3657580 3658815 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_32480 3658917 3660458 gene locus_tag LOCUS_32490 gene malF 3658917 3660458 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705559.1 protein_id gnl|my_center|LOCUS_32490 3660497 3661384 gene locus_tag LOCUS_32500 gene malG 3660497 3661384 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299600.1 protein_id gnl|my_center|LOCUS_32500 3661437 3662570 gene locus_tag LOCUS_32510 gene ugpC 3661437 3662570 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705560.1 protein_id gnl|my_center|LOCUS_32510 3662583 3664784 gene locus_tag LOCUS_32520 gene malQ 3662583 3664784 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070791.1 protein_id gnl|my_center|LOCUS_32520 3665780 3664830 gene locus_tag LOCUS_32530 3665780 3664830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 3666439 3667920 gene locus_tag LOCUS_32540 3666439 3667920 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973678.1 protein_id gnl|my_center|LOCUS_32540 3668185 3668961 gene locus_tag LOCUS_32550 gene tcdA 3668185 3668961 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 protein_id gnl|my_center|LOCUS_32550 3670857 3669037 gene locus_tag LOCUS_32560 3670857 3669037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3672344 3671109 gene locus_tag LOCUS_32570 3672344 3671109 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_32570 3672530 3673459 gene locus_tag LOCUS_32580 3672530 3673459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3675140 3673905 gene locus_tag LOCUS_32590 3675140 3673905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3675063 3675467 gene locus_tag LOCUS_32600 3675063 3675467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3675726 3676481 gene locus_tag LOCUS_32610 3675726 3676481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3676727 3678016 gene locus_tag LOCUS_32620 3676727 3678016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030565.1 protein_id gnl|my_center|LOCUS_32620 3679014 3678067 gene locus_tag LOCUS_32630 3679014 3678067 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818970.1 protein_id gnl|my_center|LOCUS_32630 3679281 3679742 gene locus_tag LOCUS_32640 3679281 3679742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3680172 3679840 gene locus_tag LOCUS_32650 3680172 3679840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3680601 3681587 gene locus_tag LOCUS_32660 3680601 3681587 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706775.1 protein_id gnl|my_center|LOCUS_32660 3682769 3681699 gene locus_tag LOCUS_32670 3682769 3681699 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 protein_id gnl|my_center|LOCUS_32670 3683935 3683156 gene locus_tag LOCUS_32680 3683935 3683156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3684576 3684094 gene locus_tag LOCUS_32690 3684576 3684094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 3685020 3685175 gene locus_tag LOCUS_32700 3685020 3685175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 3686084 3685329 gene locus_tag LOCUS_32710 gene hisA 3686084 3685329 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_32710 3687012 3686173 gene locus_tag LOCUS_32720 gene lipA 3687012 3686173 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_32720 3687120 3687566 gene locus_tag LOCUS_32730 3687120 3687566 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 protein_id gnl|my_center|LOCUS_32730 3688371 3687607 gene locus_tag LOCUS_32740 3688371 3687607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3688618 3689292 gene locus_tag LOCUS_32750 3688618 3689292 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008806429.1 protein_id gnl|my_center|LOCUS_32750 3689440 3689853 gene locus_tag LOCUS_32760 3689440 3689853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3690563 3689913 gene locus_tag LOCUS_32770 3690563 3689913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 3690808 3690701 gene locus_tag LOCUS_r00040 3690808 3690701 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3691011 3690901 gene locus_tag LOCUS_r00050 3691011 3690901 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3694277 3691348 gene locus_tag LOCUS_r00060 3694277 3691348 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3696247 3694683 gene locus_tag LOCUS_r00070 3696247 3694683 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3698440 3697040 gene locus_tag LOCUS_32780 3698440 3697040 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_32780 3698846 3700207 gene locus_tag LOCUS_32790 3698846 3700207 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_32790 3700647 3702008 gene locus_tag LOCUS_32800 3700647 3702008 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_32800 3703949 3702315 gene locus_tag LOCUS_32810 3703949 3702315 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_32810 3705458 3704097 gene locus_tag LOCUS_32820 3705458 3704097 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_32820 3706385 3705981 gene locus_tag LOCUS_32830 3706385 3705981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3706308 3707543 gene locus_tag LOCUS_32840 3706308 3707543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3707791 3709083 gene locus_tag LOCUS_32850 3707791 3709083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3711199 3709214 gene locus_tag LOCUS_32860 3711199 3709214 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_32860 3711944 3711210 gene locus_tag LOCUS_32870 3711944 3711210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_32870 3712885 3711941 gene locus_tag LOCUS_32880 3712885 3711941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_32880 3714698 3713268 gene locus_tag LOCUS_32890 gene dacB 3714698 3713268 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626016.1 protein_id gnl|my_center|LOCUS_32890 3715026 3717404 gene locus_tag LOCUS_32900 3715026 3717404 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_32900 3717836 3718411 gene locus_tag LOCUS_32910 3717836 3718411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3719611 3718487 gene locus_tag LOCUS_32920 3719611 3718487 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682145.1 protein_id gnl|my_center|LOCUS_32920 3721923 3719689 gene locus_tag LOCUS_32930 3721923 3719689 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682151.1 protein_id gnl|my_center|LOCUS_32930 3723592 3722189 gene locus_tag LOCUS_32940 3723592 3722189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3724932 3723838 gene locus_tag LOCUS_32950 gene amrS 3724932 3723838 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_32950 3725203 3725982 gene locus_tag LOCUS_32960 3725203 3725982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32960 3725982 3726569 gene locus_tag LOCUS_32970 3725982 3726569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 3727958 3726651 gene locus_tag LOCUS_32980 gene tyrS 3727958 3726651 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262278.1 protein_id gnl|my_center|LOCUS_32980 3728247 3729719 gene locus_tag LOCUS_32990 3728247 3729719 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_32990 3729751 3730845 gene locus_tag LOCUS_33000 3729751 3730845 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269098.1 protein_id gnl|my_center|LOCUS_33000 3730939 3731739 gene locus_tag LOCUS_33010 3730939 3731739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 3732244 3731888 gene locus_tag LOCUS_33020 gene erpA 3732244 3731888 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_33020 3732557 3732369 gene locus_tag LOCUS_33030 3732557 3732369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 3733275 3732541 gene locus_tag LOCUS_33040 3733275 3732541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3733583 3733756 gene locus_tag LOCUS_33050 3733583 3733756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3734935 3733907 gene locus_tag LOCUS_33060 gene argC 3734935 3733907 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_33060 3735255 3735037 gene locus_tag LOCUS_33070 3735255 3735037 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_33070 3735982 3735266 gene locus_tag LOCUS_33080 3735982 3735266 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_33080 3736347 3735979 gene locus_tag LOCUS_33090 3736347 3735979 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_33090 3736531 3738093 gene locus_tag LOCUS_33100 3736531 3738093 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_33100 3738202 3738624 gene locus_tag LOCUS_33110 gene hemJ 3738202 3738624 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_33110 3738677 3739519 gene locus_tag LOCUS_33120 3738677 3739519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 3739924 3741111 gene locus_tag LOCUS_33130 3739924 3741111 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 protein_id gnl|my_center|LOCUS_33130 3741230 3743326 gene locus_tag LOCUS_33140 gene pta 3741230 3743326 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_33140 3744011 3744361 gene locus_tag LOCUS_33150 3744011 3744361 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_33150 3745781 3744618 gene locus_tag LOCUS_33160 3745781 3744618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 3746599 3748122 gene locus_tag LOCUS_33170 gene istA 3746599 3748122 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_33170 3748142 3748897 gene locus_tag LOCUS_33180 gene istB 3748142 3748897 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_33180 3749872 3749186 gene locus_tag LOCUS_33190 3749872 3749186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 3750350 3749781 gene locus_tag LOCUS_33200 3750350 3749781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3750715 3750527 gene locus_tag LOCUS_33210 3750715 3750527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3751381 3750722 gene locus_tag LOCUS_33220 3751381 3750722 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_33220 3752057 3751416 gene locus_tag LOCUS_33230 3752057 3751416 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_33230 3752211 3753203 gene locus_tag LOCUS_33240 3752211 3753203 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_33240 3753354 3753704 gene locus_tag LOCUS_33250 3753354 3753704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3754408 3753740 gene locus_tag LOCUS_33260 3754408 3753740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3754731 3754423 gene locus_tag LOCUS_33270 3754731 3754423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3755091 3756335 gene locus_tag LOCUS_33280 3755091 3756335 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873658.1 protein_id gnl|my_center|LOCUS_33280 3756797 3756393 gene locus_tag LOCUS_33290 3756797 3756393 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 protein_id gnl|my_center|LOCUS_33290 3758192 3756909 gene locus_tag LOCUS_33300 gene bioA 3758192 3756909 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295303.1 protein_id gnl|my_center|LOCUS_33300 3758409 3759281 gene locus_tag LOCUS_33310 3758409 3759281 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_33310 3759428 3760168 gene locus_tag LOCUS_33320 3759428 3760168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3761469 3760246 gene locus_tag LOCUS_33330 3761469 3760246 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_33330 3761984 3762643 gene locus_tag LOCUS_33340 3761984 3762643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3762665 3763252 gene locus_tag LOCUS_33350 3762665 3763252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3765171 3763297 gene locus_tag LOCUS_33360 3765171 3763297 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 protein_id gnl|my_center|LOCUS_33360 3766152 3765235 gene locus_tag LOCUS_33370 3766152 3765235 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 protein_id gnl|my_center|LOCUS_33370 3766364 3767362 gene locus_tag LOCUS_33380 3766364 3767362 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072814.1 protein_id gnl|my_center|LOCUS_33380 3767620 3768456 gene locus_tag LOCUS_33390 3767620 3768456 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764761.1 protein_id gnl|my_center|LOCUS_33390 3769957 3768527 gene locus_tag LOCUS_33400 3769957 3768527 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_33400 3770258 3770076 gene locus_tag LOCUS_33410 3770258 3770076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 3770375 3771229 gene locus_tag LOCUS_33420 3770375 3771229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 3771235 3774276 gene locus_tag LOCUS_33430 3771235 3774276 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_33430 3775487 3774504 gene locus_tag LOCUS_33440 3775487 3774504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3776726 3775524 gene locus_tag LOCUS_33450 3776726 3775524 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_33450 3777126 3776899 gene locus_tag LOCUS_33460 3777126 3776899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 3778269 3777235 gene locus_tag LOCUS_33470 gene aphB 3778269 3777235 CDS product acetylpolyamine amidohydrolase AphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 protein_id gnl|my_center|LOCUS_33470 3778540 3778710 gene locus_tag LOCUS_33480 3778540 3778710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 3780123 3778759 gene locus_tag LOCUS_33490 3780123 3778759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3781179 3780166 gene locus_tag LOCUS_33500 3781179 3780166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 3782978 3782199 gene locus_tag LOCUS_33510 3782978 3782199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 3783619 3783137 gene locus_tag LOCUS_33520 3783619 3783137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3783872 3783723 gene locus_tag LOCUS_33530 3783872 3783723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3784066 3787086 gene locus_tag LOCUS_33540 3784066 3787086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 3788426 3787191 gene locus_tag LOCUS_33550 3788426 3787191 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_33550 3788601 3789818 gene locus_tag LOCUS_33560 3788601 3789818 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070947.1 protein_id gnl|my_center|LOCUS_33560 3790508 3789891 gene locus_tag LOCUS_33570 3790508 3789891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 3790712 3791959 gene locus_tag LOCUS_33580 3790712 3791959 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_33580 3792089 3792943 gene locus_tag LOCUS_33590 3792089 3792943 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_33590 3792965 3793993 gene locus_tag LOCUS_33600 gene astA 3792965 3793993 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989416.1 protein_id gnl|my_center|LOCUS_33600 3794007 3795470 gene locus_tag LOCUS_33610 gene astD 3794007 3795470 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070949.1 protein_id gnl|my_center|LOCUS_33610 3795551 3796888 gene locus_tag LOCUS_33620 gene astB 3795551 3796888 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268513.1 protein_id gnl|my_center|LOCUS_33620 3798527 3796809 gene locus_tag LOCUS_33630 3798527 3796809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3799626 3798832 gene locus_tag LOCUS_33640 3799626 3798832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3800284 3799610 gene locus_tag LOCUS_33650 3800284 3799610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3802361 3800718 gene locus_tag LOCUS_33660 gene groL 3802361 3800718 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_33660 3802720 3802427 gene locus_tag LOCUS_33670 3802720 3802427 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094064.1 protein_id gnl|my_center|LOCUS_33670 3803343 3802873 gene locus_tag LOCUS_33680 gene fxsA 3803343 3802873 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_33680 3803706 3803470 gene locus_tag LOCUS_33690 3803706 3803470 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771165.1 protein_id gnl|my_center|LOCUS_33690 3805309 3804005 gene locus_tag LOCUS_33700 3805309 3804005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3805542 3805832 gene locus_tag LOCUS_33710 3805542 3805832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3806489 3806307 gene locus_tag LOCUS_33720 3806489 3806307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3806533 3811014 gene locus_tag LOCUS_33730 3806533 3811014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 3811486 3813159 gene locus_tag LOCUS_33740 3811486 3813159 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403891.1 protein_id gnl|my_center|LOCUS_33740 3815565 3813244 gene locus_tag LOCUS_33750 3815565 3813244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3816944 3815697 gene locus_tag LOCUS_33760 3816944 3815697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3817427 3817215 gene locus_tag LOCUS_33770 3817427 3817215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3818573 3817644 gene locus_tag LOCUS_33780 3818573 3817644 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 protein_id gnl|my_center|LOCUS_33780 3818904 3819278 gene locus_tag LOCUS_33790 3818904 3819278 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268830.1 protein_id gnl|my_center|LOCUS_33790 3819297 3819482 gene locus_tag LOCUS_33800 3819297 3819482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 3819495 3820880 gene locus_tag LOCUS_33810 3819495 3820880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_33810 3821286 3822530 gene locus_tag LOCUS_33820 3821286 3822530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_33820 3822546 3823409 gene locus_tag LOCUS_33830 3822546 3823409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3823744 3825480 gene locus_tag LOCUS_33840 3823744 3825480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3826137 3825652 gene locus_tag LOCUS_33850 3826137 3825652 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304827.1 protein_id gnl|my_center|LOCUS_33850 3826480 3826268 gene locus_tag LOCUS_33860 3826480 3826268 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_33860 3826741 3827571 gene locus_tag LOCUS_33870 3826741 3827571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3827641 3829344 gene locus_tag LOCUS_33880 3827641 3829344 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 protein_id gnl|my_center|LOCUS_33880 3829400 3830260 gene locus_tag LOCUS_33890 gene nadC 3829400 3830260 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_33890 3830346 3831362 gene locus_tag LOCUS_33900 gene galE 3830346 3831362 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_33900 3831518 3832171 gene locus_tag LOCUS_33910 3831518 3832171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3832266 3833999 gene locus_tag LOCUS_33920 gene ligB 3832266 3833999 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269232.1 protein_id gnl|my_center|LOCUS_33920 3834808 3834035 gene locus_tag LOCUS_33930 3834808 3834035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3835789 3835670 gene locus_tag LOCUS_33940 3835789 3835670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 3836369 3835905 gene locus_tag LOCUS_33950 3836369 3835905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3836642 3837091 gene locus_tag LOCUS_33960 3836642 3837091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 3837569 3837111 gene locus_tag LOCUS_33970 3837569 3837111 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968986.1 protein_id gnl|my_center|LOCUS_33970 3839245 3837638 gene locus_tag LOCUS_33980 3839245 3837638 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_33980 3839489 3839890 gene locus_tag LOCUS_33990 3839489 3839890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3839996 3840175 gene locus_tag LOCUS_34000 3839996 3840175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 3840214 3840690 gene locus_tag LOCUS_34010 3840214 3840690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3840692 3841423 gene locus_tag LOCUS_34020 3840692 3841423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_34020 3841420 3842682 gene locus_tag LOCUS_34030 3841420 3842682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_34030 3842701 3843261 gene locus_tag LOCUS_34040 3842701 3843261 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_34040 3844054 3843293 gene locus_tag LOCUS_34050 3844054 3843293 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_34050 3844413 3845501 gene locus_tag LOCUS_34060 3844413 3845501 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005392234.1 protein_id gnl|my_center|LOCUS_34060 3845604 3845918 gene locus_tag LOCUS_34070 3845604 3845918 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_34070 3846183 3847247 gene locus_tag LOCUS_34080 3846183 3847247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 3847392 3848408 gene locus_tag LOCUS_34090 3847392 3848408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 3848496 3851099 gene locus_tag LOCUS_34100 gene leuS 3848496 3851099 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 protein_id gnl|my_center|LOCUS_34100 3851577 3851173 gene locus_tag LOCUS_34110 3851577 3851173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3851817 3852782 gene locus_tag LOCUS_34120 3851817 3852782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3852970 3854334 gene locus_tag LOCUS_34130 3852970 3854334 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_34130 3854918 3854406 gene locus_tag LOCUS_34140 3854918 3854406 CDS product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109225.1 protein_id gnl|my_center|LOCUS_34140 3856517 3854961 gene locus_tag LOCUS_34150 3856517 3854961 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479787.1 protein_id gnl|my_center|LOCUS_34150 3856713 3856519 gene locus_tag LOCUS_34160 3856713 3856519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3857492 3856794 gene locus_tag LOCUS_34170 3857492 3856794 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 protein_id gnl|my_center|LOCUS_34170 3857612 3858793 gene locus_tag LOCUS_34180 3857612 3858793 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 protein_id gnl|my_center|LOCUS_34180 3858821 3859030 gene locus_tag LOCUS_34190 3858821 3859030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3860559 3859108 gene locus_tag LOCUS_34200 gene katB 3860559 3859108 CDS product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071324.1 protein_id gnl|my_center|LOCUS_34200 3860700 3861299 gene locus_tag LOCUS_34210 gene lptE 3860700 3861299 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100322.1 protein_id gnl|my_center|LOCUS_34210 3861296 3862333 gene locus_tag LOCUS_34220 gene holA 3861296 3862333 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_34220 3862799 3862356 gene locus_tag LOCUS_34230 3862799 3862356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3863250 3864125 gene locus_tag LOCUS_34240 3863250 3864125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 3864212 3865609 gene locus_tag LOCUS_34250 3864212 3865609 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079390.1 protein_id gnl|my_center|LOCUS_34250 3866536 3865670 gene locus_tag LOCUS_34260 3866536 3865670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3868458 3866617 gene locus_tag LOCUS_34270 gene ilvD 3868458 3866617 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266422.1 protein_id gnl|my_center|LOCUS_34270 3868679 3869323 gene locus_tag LOCUS_34280 3868679 3869323 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480118.1 protein_id gnl|my_center|LOCUS_34280 3870111 3869395 gene locus_tag LOCUS_34290 3870111 3869395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 3871147 3870437 gene locus_tag LOCUS_34300 3871147 3870437 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_34300 3873695 3872670 gene locus_tag LOCUS_34310 gene lipA 3873695 3872670 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018819.1 protein_id gnl|my_center|LOCUS_34310 3874427 3873729 gene locus_tag LOCUS_34320 gene lipB 3874427 3873729 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093177.1 protein_id gnl|my_center|LOCUS_34320 3874699 3874427 gene locus_tag LOCUS_34330 3874699 3874427 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_34330 3875970 3874774 gene locus_tag LOCUS_34340 3875970 3874774 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_34340 3876833 3876039 gene locus_tag LOCUS_34350 3876833 3876039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3877967 3876867 gene locus_tag LOCUS_34360 gene mltB 3877967 3876867 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_34360 3879842 3878742 gene locus_tag LOCUS_34370 gene glpQ 3879842 3878742 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_34370 3880076 3881431 gene locus_tag LOCUS_34380 gene glpT 3880076 3881431 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456512.1 protein_id gnl|my_center|LOCUS_34380 3882958 3881936 gene locus_tag LOCUS_34390 3882958 3881936 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_34390 3884231 3883083 gene locus_tag LOCUS_34400 gene rodA 3884231 3883083 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244673.1 protein_id gnl|my_center|LOCUS_34400 3886105 3884231 gene locus_tag LOCUS_34410 gene mrdA 3886105 3884231 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_34410 3886648 3886181 gene locus_tag LOCUS_34420 gene rlmH 3886648 3886181 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_34420 3887004 3886648 gene locus_tag LOCUS_34430 gene rsfS 3887004 3886648 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_34430 3888381 3887119 gene locus_tag LOCUS_34440 3888381 3887119 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_34440 3890131 3888557 gene locus_tag LOCUS_34450 3890131 3888557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3890359 3891291 gene locus_tag LOCUS_34460 3890359 3891291 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032621927.1 protein_id gnl|my_center|LOCUS_34460 3891883 3892890 gene locus_tag LOCUS_34470 3891883 3892890 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_34470 3893370 3893026 gene locus_tag LOCUS_34480 3893370 3893026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 3894517 3893282 gene locus_tag LOCUS_34490 3894517 3893282 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_34490 3896496 3894565 gene locus_tag LOCUS_34500 3896496 3894565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 3899271 3897229 gene locus_tag LOCUS_34510 3899271 3897229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 3900202 3901899 gene locus_tag LOCUS_34520 3900202 3901899 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365019.1 protein_id gnl|my_center|LOCUS_34520 3901983 3903302 gene locus_tag LOCUS_34530 3901983 3903302 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_34530 3903385 3905535 gene locus_tag LOCUS_34540 gene fadB 3903385 3905535 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704165.1 protein_id gnl|my_center|LOCUS_34540 3905563 3906723 gene locus_tag LOCUS_34550 gene fadA 3905563 3906723 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 protein_id gnl|my_center|LOCUS_34550 3907414 3906860 gene locus_tag LOCUS_34560 3907414 3906860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3907699 3910257 gene locus_tag LOCUS_34570 gene hrpB 3907699 3910257 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_34570 3910497 3911144 gene locus_tag LOCUS_34580 3910497 3911144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3911658 3911134 gene locus_tag LOCUS_34590 3911658 3911134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3913035 3911785 gene locus_tag LOCUS_34600 3913035 3911785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 3914119 3912974 gene locus_tag LOCUS_34610 3914119 3912974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3914240 3914512 gene locus_tag LOCUS_34620 3914240 3914512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3914648 3915073 gene locus_tag LOCUS_34630 3914648 3915073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3915087 3915536 gene locus_tag LOCUS_34640 3915087 3915536 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_34640 3915515 3915991 gene locus_tag LOCUS_34650 3915515 3915991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3915975 3916247 gene locus_tag LOCUS_34660 3915975 3916247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3916217 3916408 gene locus_tag LOCUS_34670 3916217 3916408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3916369 3916548 gene locus_tag LOCUS_34680 3916369 3916548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 3917196 3917819 gene locus_tag LOCUS_34690 3917196 3917819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 3919044 3917809 gene locus_tag LOCUS_34700 3919044 3917809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3919258 3920670 gene locus_tag LOCUS_34710 3919258 3920670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 3921016 3921753 gene locus_tag LOCUS_34720 3921016 3921753 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020049.1 protein_id gnl|my_center|LOCUS_34720 3922414 3921755 gene locus_tag LOCUS_34730 3922414 3921755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 3922481 3923191 gene locus_tag LOCUS_34740 gene trmH 3922481 3923191 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888841.1 protein_id gnl|my_center|LOCUS_34740 3923194 3924051 gene locus_tag LOCUS_34750 gene tesB 3923194 3924051 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262147.1 protein_id gnl|my_center|LOCUS_34750 3924209 3925327 gene locus_tag LOCUS_34760 3924209 3925327 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_34760 3925544 3925798 gene locus_tag LOCUS_34770 3925544 3925798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3925949 3926338 gene locus_tag LOCUS_34780 3925949 3926338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3926507 3926818 gene locus_tag LOCUS_34790 3926507 3926818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3926975 3927871 gene locus_tag LOCUS_34800 3926975 3927871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 3928571 3927930 gene locus_tag LOCUS_34810 gene ubiX 3928571 3927930 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379089.1 protein_id gnl|my_center|LOCUS_34810 3929966 3928596 gene locus_tag LOCUS_34820 gene mpl 3929966 3928596 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770120.1 protein_id gnl|my_center|LOCUS_34820 3930190 3931455 gene locus_tag LOCUS_34830 3930190 3931455 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_34830 3931807 3933321 gene locus_tag LOCUS_34840 3931807 3933321 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_34840 3933871 3933380 gene locus_tag LOCUS_34850 3933871 3933380 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_34850 3934578 3933868 gene locus_tag LOCUS_34860 3934578 3933868 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_34860 3936290 3934869 gene locus_tag LOCUS_34870 gene chiP 3936290 3934869 CDS product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258839.1 protein_id gnl|my_center|LOCUS_34870 3937165 3938661 gene locus_tag LOCUS_34880 3937165 3938661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3938665 3938814 gene locus_tag LOCUS_34890 3938665 3938814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3938853 3940196 gene locus_tag LOCUS_34900 gene celB 3938853 3940196 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890590.1 protein_id gnl|my_center|LOCUS_34900 3940674 3940522 gene locus_tag LOCUS_34910 3940674 3940522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 3942331 3940931 gene locus_tag LOCUS_34920 3942331 3940931 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_34920 3942977 3942414 gene locus_tag LOCUS_34930 3942977 3942414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 3943466 3943741 gene locus_tag LOCUS_34940 3943466 3943741 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722179.1 protein_id gnl|my_center|LOCUS_34940 3943790 3944101 gene locus_tag LOCUS_34950 3943790 3944101 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 protein_id gnl|my_center|LOCUS_34950 3944261 3945265 gene locus_tag LOCUS_34960 3944261 3945265 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101064.1 protein_id gnl|my_center|LOCUS_34960 3945374 3946678 gene locus_tag LOCUS_34970 3945374 3946678 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461090.1 protein_id gnl|my_center|LOCUS_34970 3947115 3946711 gene locus_tag LOCUS_34980 3947115 3946711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 3947038 3948273 gene locus_tag LOCUS_34990 3947038 3948273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3950055 3948727 gene locus_tag LOCUS_35000 3950055 3948727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 3950706 3950128 gene locus_tag LOCUS_35010 3950706 3950128 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_35010 3951539 3950706 gene locus_tag LOCUS_35020 3951539 3950706 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_35020 3955723 3951524 gene locus_tag LOCUS_35030 3955723 3951524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3956882 3956142 gene locus_tag LOCUS_35040 3956882 3956142 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086389.1 protein_id gnl|my_center|LOCUS_35040 3957653 3956886 gene locus_tag LOCUS_35050 gene livG 3957653 3956886 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 protein_id gnl|my_center|LOCUS_35050 3958969 3957650 gene locus_tag LOCUS_35060 3958969 3957650 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410832.1 protein_id gnl|my_center|LOCUS_35060 3959892 3958966 gene locus_tag LOCUS_35070 gene livH 3959892 3958966 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 protein_id gnl|my_center|LOCUS_35070 3959963 3960247 gene locus_tag LOCUS_35080 3959963 3960247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 3960225 3960488 gene locus_tag LOCUS_35090 3960225 3960488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 3960712 3961323 gene locus_tag LOCUS_35100 3960712 3961323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35100 3961478 3962113 gene locus_tag LOCUS_35110 3961478 3962113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3962185 3962478 gene locus_tag LOCUS_35120 3962185 3962478 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_35120 3962490 3962801 gene locus_tag LOCUS_35130 3962490 3962801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 3963271 3962807 gene locus_tag LOCUS_35140 3963271 3962807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 3963790 3963392 gene locus_tag LOCUS_35150 3963790 3963392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3964336 3963938 gene locus_tag LOCUS_35160 3964336 3963938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3964575 3964796 gene locus_tag LOCUS_35170 3964575 3964796 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_35170 3964786 3965016 gene locus_tag LOCUS_35180 3964786 3965016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_35180 3965419 3965054 gene locus_tag LOCUS_35190 3965419 3965054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3966985 3965498 gene locus_tag LOCUS_35200 3966985 3965498 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_35200 3967162 3968346 gene locus_tag LOCUS_35210 3967162 3968346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3970240 3968795 gene locus_tag LOCUS_35220 3970240 3968795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3971790 3970246 gene locus_tag LOCUS_35230 3971790 3970246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3973088 3971793 gene locus_tag LOCUS_35240 3973088 3971793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 3975771 3973075 gene locus_tag LOCUS_35250 3975771 3973075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 3976343 3976029 gene locus_tag LOCUS_35260 3976343 3976029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3977672 3977442 gene locus_tag LOCUS_35270 3977672 3977442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3980233 3977669 gene locus_tag LOCUS_35280 3980233 3977669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3980232 3980531 gene locus_tag LOCUS_35290 3980232 3980531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 3980770 3981381 gene locus_tag LOCUS_35300 3980770 3981381 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113775.1 protein_id gnl|my_center|LOCUS_35300 3981371 3983029 gene locus_tag LOCUS_35310 3981371 3983029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3983019 3983417 gene locus_tag LOCUS_35320 3983019 3983417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 3983883 3983431 gene locus_tag LOCUS_35330 3983883 3983431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35330 3984194 3983910 gene locus_tag LOCUS_35340 3984194 3983910 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246904.1 protein_id gnl|my_center|LOCUS_35340 3984306 3984854 gene locus_tag LOCUS_35350 3984306 3984854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3985208 3984978 gene locus_tag LOCUS_35360 3985208 3984978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 3987466 3985214 gene locus_tag LOCUS_35370 3987466 3985214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 3987812 3989488 gene locus_tag LOCUS_35380 3987812 3989488 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_35380 3989485 3990903 gene locus_tag LOCUS_35390 3989485 3990903 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_35390 3990903 3995042 gene locus_tag LOCUS_35400 3990903 3995042 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071654.1 protein_id gnl|my_center|LOCUS_35400 3995042 3996721 gene locus_tag LOCUS_35410 3995042 3996721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_35410 3996718 3997695 gene locus_tag LOCUS_35420 3996718 3997695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3999297 3997897 gene locus_tag LOCUS_35430 3999297 3997897 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_35430 3999420 4000115 gene locus_tag LOCUS_35440 3999420 4000115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4000453 4001367 gene locus_tag LOCUS_35450 4000453 4001367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 4002119 4001364 gene locus_tag LOCUS_35460 gene istB 4002119 4001364 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_35460 4003662 4002139 gene locus_tag LOCUS_35470 gene istA 4003662 4002139 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_35470 4003769 4005988 gene locus_tag LOCUS_35480 4003769 4005988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 4006242 4007774 gene locus_tag LOCUS_35490 gene istA 4006242 4007774 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_35490 4007785 4008540 gene locus_tag LOCUS_35500 gene istB 4007785 4008540 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_35500 4008645 4009265 gene locus_tag LOCUS_35510 4008645 4009265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 4009930 4009625 gene locus_tag LOCUS_35520 4009930 4009625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 4015719 4009942 gene locus_tag LOCUS_35530 4015719 4009942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 4016897 4015716 gene locus_tag LOCUS_35540 4016897 4015716 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_35540 4018946 4017474 gene locus_tag LOCUS_35550 4018946 4017474 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105148.1 protein_id gnl|my_center|LOCUS_35550 4019441 4018953 gene locus_tag LOCUS_35560 4019441 4018953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 4021627 4019438 gene locus_tag LOCUS_35570 4021627 4019438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 4021848 4021624 gene locus_tag LOCUS_35580 4021848 4021624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 4022112 4023815 gene locus_tag LOCUS_35590 4022112 4023815 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_35590 4025501 4023777 gene locus_tag LOCUS_35600 4025501 4023777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 4025604 4026485 gene locus_tag LOCUS_35610 4025604 4026485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35610 4026489 4027625 gene locus_tag LOCUS_35620 4026489 4027625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35620 4027823 4027629 gene locus_tag LOCUS_35630 4027823 4027629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 4028841 4027849 gene locus_tag LOCUS_35640 4028841 4027849 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_35640 4029166 4028945 gene locus_tag LOCUS_35650 4029166 4028945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 4029842 4029147 gene locus_tag LOCUS_35660 4029842 4029147 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208432.1 protein_id gnl|my_center|LOCUS_35660 4030229 4030047 gene locus_tag LOCUS_35670 4030229 4030047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4032033 4030282 gene locus_tag LOCUS_35680 4032033 4030282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4032198 4032683 gene locus_tag LOCUS_35690 4032198 4032683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 4032680 4032859 gene locus_tag LOCUS_35700 4032680 4032859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 4032856 4034238 gene locus_tag LOCUS_35710 4032856 4034238 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_35710 4034243 4034533 gene locus_tag LOCUS_35720 4034243 4034533 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_35720 4034523 4034912 gene locus_tag LOCUS_35730 4034523 4034912 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_35730 4034968 4035360 gene locus_tag LOCUS_35740 4034968 4035360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 4035528 4035944 gene locus_tag LOCUS_35750 4035528 4035944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 4035949 4036965 gene locus_tag LOCUS_35760 4035949 4036965 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_35760 4038384 4037263 gene locus_tag LOCUS_35770 4038384 4037263 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082136.1 protein_id gnl|my_center|LOCUS_35770 4038843 4039805 gene locus_tag LOCUS_35780 4038843 4039805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4040909 4040238 gene locus_tag LOCUS_35790 gene rpiA 4040909 4040238 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_35790 4041037 4042551 gene locus_tag LOCUS_35800 gene ilvA 4041037 4042551 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_35800 4043200 4042646 gene locus_tag LOCUS_35810 4043200 4042646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4044244 4043552 gene locus_tag LOCUS_35820 4044244 4043552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_35820 4044553 4044443 gene locus_tag LOCUS_r00080 4044553 4044443 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4047675 4044758 gene locus_tag LOCUS_r00090 4047675 4044758 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4048145 4048070 gene locus_tag LOCUS_t00710 4048145 4048070 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4048329 4048253 gene locus_tag LOCUS_t00720 4048329 4048253 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4050109 4048545 gene locus_tag LOCUS_r00100 4050109 4048545 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4052167 4050827 gene locus_tag LOCUS_35830 4052167 4050827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 4053132 4053941 gene locus_tag LOCUS_35840 4053132 4053941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 4054225 4056342 gene locus_tag LOCUS_35850 gene nrdD 4054225 4056342 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_35850 4056411 4056902 gene locus_tag LOCUS_35860 gene nrdG 4056411 4056902 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394529.1 protein_id gnl|my_center|LOCUS_35860 4057301 4056897 gene locus_tag LOCUS_35870 4057301 4056897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 4057994 4057311 gene locus_tag LOCUS_35880 4057994 4057311 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_35880 4058191 4058015 gene locus_tag LOCUS_35890 4058191 4058015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4058371 4059513 gene locus_tag LOCUS_35900 4058371 4059513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4062336 4059514 gene locus_tag LOCUS_35910 4062336 4059514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 4062683 4063375 gene locus_tag LOCUS_35920 4062683 4063375 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 protein_id gnl|my_center|LOCUS_35920 4063372 4063965 gene locus_tag LOCUS_35930 4063372 4063965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35930 4064061 4064345 gene locus_tag LOCUS_35940 4064061 4064345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 4064607 4065677 gene locus_tag LOCUS_35950 4064607 4065677 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_35950 4066285 4067988 gene locus_tag LOCUS_35960 4066285 4067988 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_35960 4068523 4069071 gene locus_tag LOCUS_35970 4068523 4069071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 4069104 4070621 gene locus_tag LOCUS_35980 4069104 4070621 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065935.1 protein_id gnl|my_center|LOCUS_35980 4071341 4070943 gene locus_tag LOCUS_35990 4071341 4070943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4073221 4071647 gene locus_tag LOCUS_36000 gene ahpF 4073221 4071647 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071236.1 protein_id gnl|my_center|LOCUS_36000 4073877 4073308 gene locus_tag LOCUS_36010 gene ahpC 4073877 4073308 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_36010 4075307 4074015 gene locus_tag LOCUS_36020 4075307 4074015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 4076380 4075388 gene locus_tag LOCUS_36030 4076380 4075388 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_36030 4077928 4076441 gene locus_tag LOCUS_36040 4077928 4076441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 4078170 4078730 gene locus_tag LOCUS_36050 gene syd 4078170 4078730 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173239.1 protein_id gnl|my_center|LOCUS_36050 4080153 4078924 gene locus_tag LOCUS_36060 4080153 4078924 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482999.1 protein_id gnl|my_center|LOCUS_36060 4081591 4080308 gene locus_tag LOCUS_36070 4081591 4080308 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482999.1 protein_id gnl|my_center|LOCUS_36070 4083235 4081979 gene locus_tag LOCUS_36080 gene fadL 4083235 4081979 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392784.1 protein_id gnl|my_center|LOCUS_36080 4083485 4084432 gene locus_tag LOCUS_36090 gene glk 4083485 4084432 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705006.1 protein_id gnl|my_center|LOCUS_36090 4085095 4084508 gene locus_tag LOCUS_36100 4085095 4084508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4085999 4085409 gene locus_tag LOCUS_36110 4085999 4085409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 4087547 4086165 gene locus_tag LOCUS_36120 gene nhaC 4087547 4086165 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_36120 4088390 4087662 gene locus_tag LOCUS_36130 4088390 4087662 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_36130 4088549 4090561 gene locus_tag LOCUS_36140 gene rep 4088549 4090561 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102994.1 protein_id gnl|my_center|LOCUS_36140 4091385 4092758 gene locus_tag LOCUS_36150 4091385 4092758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 4094189 4093596 gene locus_tag LOCUS_36160 4094189 4093596 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_36160 4095103 4094225 gene locus_tag LOCUS_36170 4095103 4094225 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_36170 4095240 4096232 gene locus_tag LOCUS_36180 4095240 4096232 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_36180 4097658 4096324 gene locus_tag LOCUS_36190 4097658 4096324 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707738.1 protein_id gnl|my_center|LOCUS_36190 4099158 4097761 gene locus_tag LOCUS_36200 4099158 4097761 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707739.1 protein_id gnl|my_center|LOCUS_36200 4100217 4099621 gene locus_tag LOCUS_36210 4100217 4099621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4101743 4100391 gene locus_tag LOCUS_36220 4101743 4100391 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_36220 4101940 4102899 gene locus_tag LOCUS_36230 4101940 4102899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4103016 4105847 gene locus_tag LOCUS_36240 gene uvrA 4103016 4105847 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_36240 4106140 4106529 gene locus_tag LOCUS_36250 4106140 4106529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 4106884 4107360 gene locus_tag LOCUS_36260 4106884 4107360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 4107381 4109084 gene locus_tag LOCUS_36270 4107381 4109084 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_36270 4109368 4110024 gene locus_tag LOCUS_36280 4109368 4110024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 4110166 4110627 gene locus_tag LOCUS_36290 4110166 4110627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 4111011 4112003 gene locus_tag LOCUS_36300 4111011 4112003 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_36300 4113217 4114587 gene locus_tag LOCUS_36310 4113217 4114587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 4116043 4114757 gene locus_tag LOCUS_36320 4116043 4114757 CDS product serine/threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706270.1 protein_id gnl|my_center|LOCUS_36320 4116094 4116282 gene locus_tag LOCUS_36330 4116094 4116282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 4116482 4118011 gene locus_tag LOCUS_36340 4116482 4118011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 4118619 4118155 gene locus_tag LOCUS_36350 gene trmL 4118619 4118155 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 protein_id gnl|my_center|LOCUS_36350 4120047 4118821 gene locus_tag LOCUS_36360 gene ltrA 4120047 4118821 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_36360 4120668 4120820 gene locus_tag LOCUS_36370 4120668 4120820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 4122127 4120901 gene locus_tag LOCUS_36380 gene ltrA 4122127 4120901 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_36380 4122748 4122951 gene locus_tag LOCUS_36390 4122748 4122951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 4124758 4122944 gene locus_tag LOCUS_36400 gene typA 4124758 4122944 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_36400 4125446 4124772 gene locus_tag LOCUS_36410 4125446 4124772 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419194.1 protein_id gnl|my_center|LOCUS_36410 4125749 4125543 gene locus_tag LOCUS_36420 4125749 4125543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4125727 4127544 gene locus_tag LOCUS_36430 gene msbA 4125727 4127544 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_36430 4127654 4129099 gene locus_tag LOCUS_36440 gene hldE 4127654 4129099 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736892.1 protein_id gnl|my_center|LOCUS_36440 4129550 4129131 gene locus_tag LOCUS_36450 4129550 4129131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4131782 4130967 gene locus_tag LOCUS_36460 4131782 4130967 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_36460 4132986 4131775 gene locus_tag LOCUS_36470 4132986 4131775 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 protein_id gnl|my_center|LOCUS_36470 4133172 4133906 gene locus_tag LOCUS_36480 4133172 4133906 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847791.1 protein_id gnl|my_center|LOCUS_36480 4133909 4134601 gene locus_tag LOCUS_36490 gene rsuA 4133909 4134601 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 protein_id gnl|my_center|LOCUS_36490 4134850 4134638 gene locus_tag LOCUS_36500 4134850 4134638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 4135885 4134929 gene locus_tag LOCUS_36510 4135885 4134929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 4136542 4136006 gene locus_tag LOCUS_36520 4136542 4136006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 4137324 4136629 gene locus_tag LOCUS_36530 4137324 4136629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36530 4137602 4137396 gene locus_tag LOCUS_36540 4137602 4137396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36540 4138067 4139641 gene locus_tag LOCUS_36550 4138067 4139641 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877518.1 protein_id gnl|my_center|LOCUS_36550 4140038 4141030 gene locus_tag LOCUS_36560 4140038 4141030 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_36560 4142759 4141020 gene locus_tag LOCUS_36570 4142759 4141020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 4144286 4143093 gene locus_tag LOCUS_36580 4144286 4143093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 4144356 4145993 gene locus_tag LOCUS_36590 4144356 4145993 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_36590 4146697 4145984 gene locus_tag LOCUS_36600 4146697 4145984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 4147657 4146698 gene locus_tag LOCUS_36610 4147657 4146698 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_36610 4148384 4147797 gene locus_tag LOCUS_36620 4148384 4147797 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 protein_id gnl|my_center|LOCUS_36620 4149822 4148551 gene locus_tag LOCUS_36630 4149822 4148551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 4150430 4150122 gene locus_tag LOCUS_36640 4150430 4150122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 4150794 4151579 gene locus_tag LOCUS_36650 4150794 4151579 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_36650 4152438 4153610 gene locus_tag LOCUS_36660 4152438 4153610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 4153692 4155011 gene locus_tag LOCUS_36670 gene waaA 4153692 4155011 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891562.1 protein_id gnl|my_center|LOCUS_36670 4155011 4155661 gene locus_tag LOCUS_36680 gene nth 4155011 4155661 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 protein_id gnl|my_center|LOCUS_36680 4155896 4157446 gene locus_tag LOCUS_36690 4155896 4157446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 4157608 4158750 gene locus_tag LOCUS_36700 gene dapE 4157608 4158750 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_36700 4158766 4159152 gene locus_tag LOCUS_36710 4158766 4159152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 4159713 4160771 gene locus_tag LOCUS_36720 4159713 4160771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 4160947 4163436 gene locus_tag LOCUS_36730 gene plsB 4160947 4163436 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113856.1 protein_id gnl|my_center|LOCUS_36730 4164310 4163504 gene locus_tag LOCUS_36740 4164310 4163504 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_36740 4165189 4164386 gene locus_tag LOCUS_36750 4165189 4164386 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_36750 4165416 4166561 gene locus_tag LOCUS_36760 4165416 4166561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 4167377 4166766 gene locus_tag LOCUS_36770 4167377 4166766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 4168167 4167529 gene locus_tag LOCUS_36780 4168167 4167529 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707553.1 protein_id gnl|my_center|LOCUS_36780 4169094 4168366 gene locus_tag LOCUS_36790 gene tsaB 4169094 4168366 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 protein_id gnl|my_center|LOCUS_36790 4169807 4169157 gene locus_tag LOCUS_36800 gene adk 4169807 4169157 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_36800 4170182 4171483 gene locus_tag LOCUS_36810 4170182 4171483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 4171692 4172132 gene locus_tag LOCUS_36820 4171692 4172132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 4173810 4172278 gene locus_tag LOCUS_36830 4173810 4172278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 4174020 4174331 gene locus_tag LOCUS_36840 4174020 4174331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 4174945 4174463 gene locus_tag LOCUS_36850 4174945 4174463 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_36850 4177700 4175067 gene locus_tag LOCUS_36860 gene ppc 4177700 4175067 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308531.1 protein_id gnl|my_center|LOCUS_36860 4178350 4179018 gene locus_tag LOCUS_36870 4178350 4179018 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480162.1 protein_id gnl|my_center|LOCUS_36870 4179021 4179485 gene locus_tag LOCUS_36880 4179021 4179485 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423470.1 protein_id gnl|my_center|LOCUS_36880 4181257 4179572 gene locus_tag LOCUS_36890 4181257 4179572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 4181700 4181984 gene locus_tag LOCUS_36900 4181700 4181984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4182073 4182699 gene locus_tag LOCUS_36910 4182073 4182699 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_36910 4182686 4183309 gene locus_tag LOCUS_36920 4182686 4183309 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_36920 4183477 4184943 gene locus_tag LOCUS_36930 4183477 4184943 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 protein_id gnl|my_center|LOCUS_36930 4185012 4185653 gene locus_tag LOCUS_36940 4185012 4185653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073259.1 protein_id gnl|my_center|LOCUS_36940 4185674 4186594 gene locus_tag LOCUS_36950 4185674 4186594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4186664 4187656 gene locus_tag LOCUS_36960 gene yejK 4186664 4187656 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869067.1 protein_id gnl|my_center|LOCUS_36960 4187825 4188610 gene locus_tag LOCUS_36970 4187825 4188610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 4189281 4188595 gene locus_tag LOCUS_36980 4189281 4188595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4189465 4189653 gene locus_tag LOCUS_36990 4189465 4189653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4189691 4191016 gene locus_tag LOCUS_37000 4189691 4191016 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614782.1 protein_id gnl|my_center|LOCUS_37000 4191217 4192734 gene locus_tag LOCUS_37010 4191217 4192734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4192898 4192823 gene locus_tag LOCUS_t00730 4192898 4192823 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4193058 4192983 gene locus_tag LOCUS_t00740 4193058 4192983 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4194376 4193363 gene locus_tag LOCUS_37020 4194376 4193363 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262036.1 protein_id gnl|my_center|LOCUS_37020 4195311 4194394 gene locus_tag LOCUS_37030 gene rbsK 4195311 4194394 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038380.1 protein_id gnl|my_center|LOCUS_37030 4196329 4195394 gene locus_tag LOCUS_37040 gene rbsB 4196329 4195394 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634030.1 protein_id gnl|my_center|LOCUS_37040 4197387 4196401 gene locus_tag LOCUS_37050 gene rbsC 4197387 4196401 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706157.1 protein_id gnl|my_center|LOCUS_37050 4198907 4197399 gene locus_tag LOCUS_37060 gene rbsA 4198907 4197399 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 protein_id gnl|my_center|LOCUS_37060 4199353 4198934 gene locus_tag LOCUS_37070 gene rbsD 4199353 4198934 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911632.1 protein_id gnl|my_center|LOCUS_37070 4200549 4199551 gene locus_tag LOCUS_37080 4200549 4199551 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707764.1 protein_id gnl|my_center|LOCUS_37080 4201133 4204102 gene locus_tag LOCUS_37090 4201133 4204102 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707763.1 protein_id gnl|my_center|LOCUS_37090 4204405 4205385 gene locus_tag LOCUS_37100 gene mglB 4204405 4205385 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707762.1 protein_id gnl|my_center|LOCUS_37100 4205514 4207022 gene locus_tag LOCUS_37110 gene mglA 4205514 4207022 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909557.1 protein_id gnl|my_center|LOCUS_37110 4207039 4208064 gene locus_tag LOCUS_37120 gene mglC 4207039 4208064 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340252.1 protein_id gnl|my_center|LOCUS_37120 4208421 4208346 gene locus_tag LOCUS_t00750 4208421 4208346 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4208504 4208429 gene locus_tag LOCUS_t00760 4208504 4208429 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4208616 4208541 gene locus_tag LOCUS_t00770 4208616 4208541 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4208733 4208658 gene locus_tag LOCUS_t00780 4208733 4208658 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4208882 4208807 gene locus_tag LOCUS_t00790 4208882 4208807 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4209260 4210339 gene locus_tag LOCUS_37130 gene citC 4209260 4210339 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181444.1 protein_id gnl|my_center|LOCUS_37130 4210447 4210824 gene locus_tag LOCUS_37140 gene citD 4210447 4210824 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684015.1 protein_id gnl|my_center|LOCUS_37140 4210824 4211717 gene locus_tag LOCUS_37150 gene citE 4210824 4211717 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164137.1 protein_id gnl|my_center|LOCUS_37150 4211723 4213246 gene locus_tag LOCUS_37160 gene citF 4211723 4213246 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368306.1 protein_id gnl|my_center|LOCUS_37160 4213249 4213791 gene locus_tag LOCUS_37170 gene citX 4213249 4213791 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018088.1 protein_id gnl|my_center|LOCUS_37170 4213851 4214771 gene locus_tag LOCUS_37180 gene citG 4213851 4214771 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704364.1 protein_id gnl|my_center|LOCUS_37180 4214847 4216505 gene locus_tag LOCUS_37190 4214847 4216505 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704359.1 protein_id gnl|my_center|LOCUS_37190 4216515 4217192 gene locus_tag LOCUS_37200 4216515 4217192 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970287.1 protein_id gnl|my_center|LOCUS_37200 4217593 4217267 gene locus_tag LOCUS_37210 4217593 4217267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 4218589 4217726 gene locus_tag LOCUS_37220 4218589 4217726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4220284 4218935 gene locus_tag LOCUS_37230 4220284 4218935 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003394.1 protein_id gnl|my_center|LOCUS_37230 4221103 4220501 gene locus_tag LOCUS_37240 4221103 4220501 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_37240 4221398 4222180 gene locus_tag LOCUS_37250 4221398 4222180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 4223185 4222193 gene locus_tag LOCUS_37260 4223185 4222193 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_37260 4223430 4223912 gene locus_tag LOCUS_37270 4223430 4223912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4224071 4224850 gene locus_tag LOCUS_37280 4224071 4224850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 4225223 4225696 gene locus_tag LOCUS_37290 gene bfr 4225223 4225696 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675497.1 protein_id gnl|my_center|LOCUS_37290 4226094 4225768 gene locus_tag LOCUS_37300 gene grxD 4226094 4225768 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003832760.1 protein_id gnl|my_center|LOCUS_37300 4227023 4226250 gene locus_tag LOCUS_37310 4227023 4226250 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706469.1 protein_id gnl|my_center|LOCUS_37310 4228004 4227195 gene locus_tag LOCUS_37320 4228004 4227195 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 protein_id gnl|my_center|LOCUS_37320 4229290 4228022 gene locus_tag LOCUS_37330 gene aspC 4229290 4228022 CDS product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 protein_id gnl|my_center|LOCUS_37330 4229474 4229872 gene locus_tag LOCUS_37340 4229474 4229872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 4232206 4229915 gene locus_tag LOCUS_37350 gene metE 4232206 4229915 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_37350 4233958 4232369 gene locus_tag LOCUS_37360 4233958 4232369 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268603.1 protein_id gnl|my_center|LOCUS_37360 4234732 4234019 gene locus_tag LOCUS_37370 4234732 4234019 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_37370 4235542 4237812 gene locus_tag LOCUS_37380 gene nrdA 4235542 4237812 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075164.1 protein_id gnl|my_center|LOCUS_37380 4237870 4239000 gene locus_tag LOCUS_37390 gene nrdB 4237870 4239000 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210817.1 protein_id gnl|my_center|LOCUS_37390 4239059 4239343 gene locus_tag LOCUS_37400 gene yfaE 4239059 4239343 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124825.1 protein_id gnl|my_center|LOCUS_37400 4239493 4240497 gene locus_tag LOCUS_37410 4239493 4240497 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_37410 4240829 4241749 gene locus_tag LOCUS_37420 gene pyrB 4240829 4241749 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 protein_id gnl|my_center|LOCUS_37420 4241780 4242235 gene locus_tag LOCUS_37430 gene pyrI 4241780 4242235 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 protein_id gnl|my_center|LOCUS_37430 4242399 4243316 gene locus_tag LOCUS_37440 4242399 4243316 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948814.1 protein_id gnl|my_center|LOCUS_37440 4243408 4243728 gene locus_tag LOCUS_37450 4243408 4243728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 4243961 4245367 gene locus_tag LOCUS_37460 gene rhlB 4243961 4245367 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_37460 4245645 4247048 gene locus_tag LOCUS_37470 4245645 4247048 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_37470 4247334 4251104 gene locus_tag LOCUS_37480 4247334 4251104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 4251166 4252137 gene locus_tag LOCUS_37490 4251166 4252137 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616206.1 protein_id gnl|my_center|LOCUS_37490 4252137 4253087 gene locus_tag LOCUS_37500 4252137 4253087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482690.1 protein_id gnl|my_center|LOCUS_37500 4253096 4254193 gene locus_tag LOCUS_37510 4253096 4254193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086615.1 protein_id gnl|my_center|LOCUS_37510 4255051 4254266 gene locus_tag LOCUS_37520 4255051 4254266 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_37520 4255427 4255113 gene locus_tag LOCUS_37530 4255427 4255113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390145.1 protein_id gnl|my_center|LOCUS_37530 4255620 4255853 gene locus_tag LOCUS_37540 4255620 4255853 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252982.1 protein_id gnl|my_center|LOCUS_37540 4255935 4258436 gene locus_tag LOCUS_37550 gene feoB 4255935 4258436 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_37550 4258449 4258625 gene locus_tag LOCUS_37560 4258449 4258625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 4259304 4258693 gene locus_tag LOCUS_37570 4259304 4258693 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_37570 4259677 4261452 gene locus_tag LOCUS_37580 gene ggt 4259677 4261452 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262987.1 protein_id gnl|my_center|LOCUS_37580 4261566 4262111 gene locus_tag LOCUS_37590 4261566 4262111 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948201.1 protein_id gnl|my_center|LOCUS_37590 4262126 4262743 gene locus_tag LOCUS_37600 gene yqiA 4262126 4262743 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 protein_id gnl|my_center|LOCUS_37600 4263055 4264584 gene locus_tag LOCUS_37610 gene glpT 4263055 4264584 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705541.1 protein_id gnl|my_center|LOCUS_37610 4265991 4264501 gene locus_tag LOCUS_37620 4265991 4264501 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_37620 4266154 4268046 gene locus_tag LOCUS_37630 gene parE 4266154 4268046 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_37630 4268272 4268502 gene locus_tag LOCUS_37640 4268272 4268502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 4268638 4270560 gene locus_tag LOCUS_37650 4268638 4270560 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_37650 4270576 4271859 gene locus_tag LOCUS_37660 4270576 4271859 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244449.1 protein_id gnl|my_center|LOCUS_37660 4271860 4273356 gene locus_tag LOCUS_37670 4271860 4273356 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_37670 4274189 4273338 gene locus_tag LOCUS_37680 4274189 4273338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 4275551 4274454 gene locus_tag LOCUS_37690 4275551 4274454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4276312 4275671 gene locus_tag LOCUS_37700 4276312 4275671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 4276682 4276404 gene locus_tag LOCUS_37710 4276682 4276404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 4276933 4276718 gene locus_tag LOCUS_37720 4276933 4276718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 4278078 4276930 gene locus_tag LOCUS_37730 4278078 4276930 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_37730 4278737 4278075 gene locus_tag LOCUS_37740 gene yedF 4278737 4278075 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_37740 4278966 4279589 gene locus_tag LOCUS_37750 4278966 4279589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 4279891 4282227 gene locus_tag LOCUS_37760 4279891 4282227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 4282720 4286244 gene locus_tag LOCUS_37770 4282720 4286244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 4286693 4290193 gene locus_tag LOCUS_37780 4286693 4290193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 4290761 4291984 gene locus_tag LOCUS_37790 4290761 4291984 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_37790 4292030 4293004 gene locus_tag LOCUS_37800 4292030 4293004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4293261 4293410 gene locus_tag LOCUS_37810 4293261 4293410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 4293565 4294062 gene locus_tag LOCUS_37820 gene eco 4293565 4294062 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420230.1 protein_id gnl|my_center|LOCUS_37820 4296764 4294113 gene locus_tag LOCUS_37830 4296764 4294113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 4297802 4296945 gene locus_tag LOCUS_37840 4297802 4296945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4298184 4299149 gene locus_tag LOCUS_37850 4298184 4299149 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_37850 4299170 4304080 gene locus_tag LOCUS_37860 4299170 4304080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 4304230 4305609 gene locus_tag LOCUS_37870 gene rsxC 4304230 4305609 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_37870 4305622 4306680 gene locus_tag LOCUS_37880 4305622 4306680 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_37880 4306677 4307465 gene locus_tag LOCUS_37890 4306677 4307465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 4307462 4308163 gene locus_tag LOCUS_37900 4307462 4308163 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_37900 4308153 4308734 gene locus_tag LOCUS_37910 gene rsxA 4308153 4308734 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_37910 4310389 4309007 gene locus_tag LOCUS_37920 4310389 4309007 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057867.1 protein_id gnl|my_center|LOCUS_37920 4312403 4310514 gene locus_tag LOCUS_37930 4312403 4310514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 4314320 4312761 gene locus_tag LOCUS_37940 4314320 4312761 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_37940 4314695 4314967 gene locus_tag LOCUS_37950 4314695 4314967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 4315300 4315061 gene locus_tag LOCUS_37960 4315300 4315061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 4315562 4315380 gene locus_tag LOCUS_37970 4315562 4315380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 4316395 4316213 gene locus_tag LOCUS_37980 4316395 4316213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 4319288 4318641 gene locus_tag LOCUS_37990 4319288 4318641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 4319426 4319908 gene locus_tag LOCUS_38000 4319426 4319908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4320067 4320846 gene locus_tag LOCUS_38010 4320067 4320846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4321109 4321648 gene locus_tag LOCUS_38020 4321109 4321648 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_38020 4322529 4321657 gene locus_tag LOCUS_38030 4322529 4321657 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_38030 4323010 4322531 gene locus_tag LOCUS_38040 4323010 4322531 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_38040 4323251 4324759 gene locus_tag LOCUS_38050 4323251 4324759 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_38050 4324759 4325262 gene locus_tag LOCUS_38060 4324759 4325262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 4325259 4326866 gene locus_tag LOCUS_38070 4325259 4326866 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_38070 4326887 4328077 gene locus_tag LOCUS_38080 4326887 4328077 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_38080 4328794 4328144 gene locus_tag LOCUS_38090 4328794 4328144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 4329709 4329059 gene locus_tag LOCUS_38100 4329709 4329059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4329840 4330742 gene locus_tag LOCUS_38110 gene pdxY 4329840 4330742 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_38110 4330761 4331078 gene locus_tag LOCUS_38120 4330761 4331078 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706400.1 protein_id gnl|my_center|LOCUS_38120 4331127 4332440 gene locus_tag LOCUS_38130 4331127 4332440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 4332503 4333252 gene locus_tag LOCUS_38140 gene rluA 4332503 4333252 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704807.1 protein_id gnl|my_center|LOCUS_38140 4333345 4336443 gene locus_tag LOCUS_38150 4333345 4336443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 4336468 4336590 gene locus_tag LOCUS_38160 4336468 4336590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 4336597 4337607 gene locus_tag LOCUS_38170 gene rhuM 4336597 4337607 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_38170 4338133 4337924 gene locus_tag LOCUS_38180 4338133 4337924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 4338577 4338437 gene locus_tag LOCUS_38190 4338577 4338437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4339502 4338639 gene locus_tag LOCUS_38200 4339502 4338639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211260.1 protein_id gnl|my_center|LOCUS_38200 4340344 4339508 gene locus_tag LOCUS_38210 4340344 4339508 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211258.1 protein_id gnl|my_center|LOCUS_38210 4341604 4340729 gene locus_tag LOCUS_38220 4341604 4340729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211259.1 protein_id gnl|my_center|LOCUS_38220 4342803 4341601 gene locus_tag LOCUS_38230 4342803 4341601 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 protein_id gnl|my_center|LOCUS_38230 4343048 4343308 gene locus_tag LOCUS_38240 4343048 4343308 CDS product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_38240 4343381 4344220 gene locus_tag LOCUS_38250 4343381 4344220 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615949.1 protein_id gnl|my_center|LOCUS_38250 4344225 4344641 gene locus_tag LOCUS_38260 4344225 4344641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 4344761 4345198 gene locus_tag LOCUS_38270 4344761 4345198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 4345296 4345799 gene locus_tag LOCUS_38280 4345296 4345799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_38280 4345813 4346160 gene locus_tag LOCUS_38290 4345813 4346160 CDS product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 protein_id gnl|my_center|LOCUS_38290 4347632 4346157 gene locus_tag LOCUS_38300 4347632 4346157 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_38300 4347937 4349316 gene locus_tag LOCUS_38310 gene dbpA 4347937 4349316 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_38310 4350686 4349322 gene locus_tag LOCUS_38320 4350686 4349322 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 protein_id gnl|my_center|LOCUS_38320 4351607 4350873 gene locus_tag LOCUS_38330 4351607 4350873 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_38330 4351796 4352227 gene locus_tag LOCUS_38340 4351796 4352227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 4353832 4352450 gene locus_tag LOCUS_38350 4353832 4352450 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826413.1 protein_id gnl|my_center|LOCUS_38350 4354501 4355385 gene locus_tag LOCUS_38360 4354501 4355385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4355574 4355996 gene locus_tag LOCUS_38370 4355574 4355996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 4356149 4357948 gene locus_tag LOCUS_38380 4356149 4357948 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261610.1 protein_id gnl|my_center|LOCUS_38380 4357948 4359753 gene locus_tag LOCUS_38390 4357948 4359753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261611.1 protein_id gnl|my_center|LOCUS_38390 4359753 4361201 gene locus_tag LOCUS_38400 4359753 4361201 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 protein_id gnl|my_center|LOCUS_38400 4361307 4361891 gene locus_tag LOCUS_38410 4361307 4361891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 4362708 4362277 gene locus_tag LOCUS_38420 gene tnpA 4362708 4362277 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_38420 4362868 4363254 gene locus_tag LOCUS_38430 4362868 4363254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 4363254 4365017 gene locus_tag LOCUS_38440 4363254 4365017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 4365251 4365175 gene locus_tag LOCUS_t00800 4365251 4365175 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4365430 4365341 gene locus_tag LOCUS_t00810 4365430 4365341 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4366376 4365552 gene locus_tag LOCUS_38450 4366376 4365552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_38450 4367732 4366383 gene locus_tag LOCUS_38460 4367732 4366383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 4367829 4368290 gene locus_tag LOCUS_38470 4367829 4368290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 4368683 4368312 gene locus_tag LOCUS_38480 4368683 4368312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 4370471 4369008 gene locus_tag LOCUS_38490 gene gabD 4370471 4369008 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_38490 4370881 4370495 gene locus_tag LOCUS_38500 gene cueR 4370881 4370495 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635698.1 protein_id gnl|my_center|LOCUS_38500 4373228 4371006 gene locus_tag LOCUS_38510 4373228 4371006 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_38510 4373688 4373473 gene locus_tag LOCUS_38520 4373688 4373473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4373884 4375041 gene locus_tag LOCUS_38530 4373884 4375041 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_38530 4377179 4375104 gene locus_tag LOCUS_38540 4377179 4375104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_38540 4377281 4378717 gene locus_tag LOCUS_38550 gene phrB 4377281 4378717 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_38550 4379433 4378714 gene locus_tag LOCUS_38560 4379433 4378714 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027067.1 protein_id gnl|my_center|LOCUS_38560 4379715 4381010 gene locus_tag LOCUS_38570 4379715 4381010 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480671.1 protein_id gnl|my_center|LOCUS_38570 4382434 4381115 gene locus_tag LOCUS_38580 4382434 4381115 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480671.1 protein_id gnl|my_center|LOCUS_38580 4382753 4383424 gene locus_tag LOCUS_38590 4382753 4383424 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968488.1 protein_id gnl|my_center|LOCUS_38590 4384813 4383485 gene locus_tag LOCUS_38600 4384813 4383485 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073558.1 protein_id gnl|my_center|LOCUS_38600 4385015 4384905 gene locus_tag LOCUS_r00110 4385015 4384905 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4388137 4385220 gene locus_tag LOCUS_r00120 4388137 4385220 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4390101 4388537 gene locus_tag LOCUS_r00130 4390101 4388537 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4391070 4390741 gene locus_tag LOCUS_38610 4391070 4390741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 4391363 4392805 gene locus_tag LOCUS_38620 4391363 4392805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4393593 4393012 gene locus_tag LOCUS_38630 4393593 4393012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4395013 4394588 gene locus_tag LOCUS_38640 4395013 4394588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4396251 4395214 gene locus_tag LOCUS_38650 gene msrP 4396251 4395214 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 protein_id gnl|my_center|LOCUS_38650 4397655 4396429 gene locus_tag LOCUS_38660 gene ltrA 4397655 4396429 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_38660 4399978 4399142 gene locus_tag LOCUS_38670 gene pssA 4399978 4399142 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_38670 4401012 4400095 gene locus_tag LOCUS_38680 gene glsB 4401012 4400095 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417557.1 protein_id gnl|my_center|LOCUS_38680 4401132 4401857 gene locus_tag LOCUS_38690 4401132 4401857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 4402620 4401892 gene locus_tag LOCUS_38700 4402620 4401892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4402590 4402736 gene locus_tag LOCUS_38710 4402590 4402736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 4404451 4402748 gene locus_tag LOCUS_38720 4404451 4402748 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_38720 4404914 4406938 gene locus_tag LOCUS_38730 4404914 4406938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4408010 4406994 gene locus_tag LOCUS_38740 gene ilvC 4408010 4406994 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_38740 4408154 4409041 gene locus_tag LOCUS_38750 gene ilvY 4408154 4409041 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_38750 4409108 4409497 gene locus_tag LOCUS_38760 4409108 4409497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4409646 4410848 gene locus_tag LOCUS_38770 4409646 4410848 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_38770 4411243 4411683 gene locus_tag LOCUS_38780 4411243 4411683 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418661.1 protein_id gnl|my_center|LOCUS_38780 4412243 4411752 gene locus_tag LOCUS_38790 gene ilvN 4412243 4411752 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_38790 4413970 4412243 gene locus_tag LOCUS_38800 4413970 4412243 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 protein_id gnl|my_center|LOCUS_38800 4414384 4414869 gene locus_tag LOCUS_38810 4414384 4414869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 4415221 4414910 gene locus_tag LOCUS_38820 4415221 4414910 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650459.1 protein_id gnl|my_center|LOCUS_38820 4415636 4415226 gene locus_tag LOCUS_38830 4415636 4415226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 4417997 4415640 gene locus_tag LOCUS_38840 gene mrcB 4417997 4415640 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_38840 4418142 4418669 gene locus_tag LOCUS_38850 4418142 4418669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 4418823 4419104 gene locus_tag LOCUS_38860 4418823 4419104 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_38860 4419215 4419400 gene locus_tag LOCUS_38870 4419215 4419400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4419606 4419355 gene locus_tag LOCUS_38880 4419606 4419355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 4419658 4421292 gene locus_tag LOCUS_38890 4419658 4421292 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_38890 4421634 4421266 gene locus_tag LOCUS_38900 4421634 4421266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 4421831 4421655 gene locus_tag LOCUS_38910 4421831 4421655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 4422556 4421792 gene locus_tag LOCUS_38920 4422556 4421792 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 protein_id gnl|my_center|LOCUS_38920 4423059 4422667 gene locus_tag LOCUS_38930 gene gcvH 4423059 4422667 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_38930 4423291 4423803 gene locus_tag LOCUS_38940 4423291 4423803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_38940 4425689 4423800 gene locus_tag LOCUS_38950 4425689 4423800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_38950 4426257 4425811 gene locus_tag LOCUS_38960 4426257 4425811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4426715 4426272 gene locus_tag LOCUS_38970 4426715 4426272 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_38970 4427901 4426750 gene locus_tag LOCUS_38980 4427901 4426750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_38980 4428475 4427903 gene locus_tag LOCUS_38990 4428475 4427903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 4428633 4430021 gene locus_tag LOCUS_39000 4428633 4430021 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552132.1 protein_id gnl|my_center|LOCUS_39000 4430124 4432247 gene locus_tag LOCUS_39010 4430124 4432247 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_39010 4432271 4432837 gene locus_tag LOCUS_39020 4432271 4432837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 4432840 4435677 gene locus_tag LOCUS_39030 4432840 4435677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 4437655 4435874 gene locus_tag LOCUS_39040 4437655 4435874 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_39040 4439133 4437802 gene locus_tag LOCUS_39050 4439133 4437802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 4441050 4439347 gene locus_tag LOCUS_39060 4441050 4439347 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_39060 4441250 4442587 gene locus_tag LOCUS_39070 4441250 4442587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 4442652 4443134 gene locus_tag LOCUS_39080 4442652 4443134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 4443293 4444072 gene locus_tag LOCUS_39090 4443293 4444072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 4444565 4446067 gene locus_tag LOCUS_39100 4444565 4446067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 4447775 4446072 gene locus_tag LOCUS_39110 4447775 4446072 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_39110 4448041 4448517 gene locus_tag LOCUS_39120 4448041 4448517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4449141 4448650 gene locus_tag LOCUS_39130 4449141 4448650 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_39130 4449914 4449138 gene locus_tag LOCUS_39140 4449914 4449138 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458569.1 protein_id gnl|my_center|LOCUS_39140 4450794 4449892 gene locus_tag LOCUS_39150 4450794 4449892 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458570.1 protein_id gnl|my_center|LOCUS_39150 4451089 4450820 gene locus_tag LOCUS_39160 4451089 4450820 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 protein_id gnl|my_center|LOCUS_39160 4453182 4452190 gene locus_tag LOCUS_39170 4453182 4452190 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_39170 4453666 4453478 gene locus_tag LOCUS_39180 4453666 4453478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4459339 4457732 gene locus_tag LOCUS_39190 4459339 4457732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4459608 4460210 gene locus_tag LOCUS_39200 4459608 4460210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4461331 4460243 gene locus_tag LOCUS_39210 4461331 4460243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 4461940 4461503 gene locus_tag LOCUS_39220 4461940 4461503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 4462311 4462787 gene locus_tag LOCUS_39230 gene purE 4462311 4462787 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921116.1 protein_id gnl|my_center|LOCUS_39230 4462787 4463959 gene locus_tag LOCUS_39240 4462787 4463959 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_39240 4465522 4465791 gene locus_tag LOCUS_39250 4465522 4465791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4466856 4465840 gene locus_tag LOCUS_39260 gene adhP 4466856 4465840 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_39260 4467770 4466937 gene locus_tag LOCUS_39270 gene fghA 4467770 4466937 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263487.1 protein_id gnl|my_center|LOCUS_39270 4468890 4467784 gene locus_tag LOCUS_39280 4468890 4467784 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815761.1 protein_id gnl|my_center|LOCUS_39280 4469381 4469812 gene locus_tag LOCUS_39290 gene fur 4469381 4469812 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 protein_id gnl|my_center|LOCUS_39290 4471294 4469900 gene locus_tag LOCUS_39300 gene vmrA 4471294 4469900 CDS product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 protein_id gnl|my_center|LOCUS_39300 4471883 4471377 gene locus_tag LOCUS_39310 4471883 4471377 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887845.1 protein_id gnl|my_center|LOCUS_39310 4473347 4471980 gene locus_tag LOCUS_39320 gene shyA 4473347 4471980 CDS product peptidoglycan DD-metalloendopeptidase ShyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227341.1 protein_id gnl|my_center|LOCUS_39320 4476273 4474549 gene locus_tag LOCUS_39330 4476273 4474549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 4480329 4476664 gene locus_tag LOCUS_39340 4480329 4476664 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 protein_id gnl|my_center|LOCUS_39340 4481540 4480326 gene locus_tag LOCUS_39350 gene sbcD 4481540 4480326 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 protein_id gnl|my_center|LOCUS_39350 4481809 4482966 gene locus_tag LOCUS_39360 4481809 4482966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4484916 4483024 gene locus_tag LOCUS_39370 4484916 4483024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 4486303 4485074 gene locus_tag LOCUS_39380 gene serA 4486303 4485074 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382085.1 protein_id gnl|my_center|LOCUS_39380 4486840 4486580 gene locus_tag LOCUS_39390 4486840 4486580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 4486964 4487632 gene locus_tag LOCUS_39400 4486964 4487632 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_39400 4487721 4488122 gene locus_tag LOCUS_39410 4487721 4488122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4488513 4488112 gene locus_tag LOCUS_39420 4488513 4488112 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_39420 4489989 4488595 gene locus_tag LOCUS_39430 4489989 4488595 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_39430 4490518 4489982 gene locus_tag LOCUS_39440 4490518 4489982 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_39440 4490867 4492081 gene locus_tag LOCUS_39450 4490867 4492081 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092848025.1 protein_id gnl|my_center|LOCUS_39450 4492383 4493357 gene locus_tag LOCUS_39460 gene pstS 4492383 4493357 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_39460 4494751 4493429 gene locus_tag LOCUS_39470 4494751 4493429 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706460.1 protein_id gnl|my_center|LOCUS_39470 4495333 4497528 gene locus_tag LOCUS_39480 4495333 4497528 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_39480 4497543 4499222 gene locus_tag LOCUS_39490 gene pstA 4497543 4499222 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_39490 4499271 4500197 gene locus_tag LOCUS_39500 gene pstB 4499271 4500197 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_39500 4500212 4500934 gene locus_tag LOCUS_39510 gene phoU 4500212 4500934 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_39510 4501544 4501059 gene locus_tag LOCUS_39520 4501544 4501059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 4501989 4504157 gene locus_tag LOCUS_39530 4501989 4504157 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_39530 4504172 4505620 gene locus_tag LOCUS_39540 4504172 4505620 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_39540 4505898 4505719 gene locus_tag LOCUS_39550 4505898 4505719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4505932 4532025 gene locus_tag LOCUS_39560 4505932 4532025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 4532547 4532218 gene locus_tag LOCUS_39570 4532547 4532218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 4533328 4534965 gene locus_tag LOCUS_39580 4533328 4534965 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168296.1 protein_id gnl|my_center|LOCUS_39580 4535454 4536821 gene locus_tag LOCUS_39590 gene gorA 4535454 4536821 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704063.1 protein_id gnl|my_center|LOCUS_39590 4536990 4537532 gene locus_tag LOCUS_39600 4536990 4537532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 4538887 4537562 gene locus_tag LOCUS_39610 4538887 4537562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 4541173 4539176 gene locus_tag LOCUS_39620 gene tkt 4541173 4539176 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_39620 4542551 4541403 gene locus_tag LOCUS_39630 4542551 4541403 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164548906.1 protein_id gnl|my_center|LOCUS_39630 4542979 4542770 gene locus_tag LOCUS_39640 4542979 4542770 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 protein_id gnl|my_center|LOCUS_39640 4544752 4543304 gene locus_tag LOCUS_39650 gene npt1 4544752 4543304 CDS product NTP/NDP exchange transporter Npt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882994.1 protein_id gnl|my_center|LOCUS_39650 4544921 4545880 gene locus_tag LOCUS_39660 4544921 4545880 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_39660 4546061 4547224 gene locus_tag LOCUS_39670 gene metK 4546061 4547224 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706910.1 protein_id gnl|my_center|LOCUS_39670 4547446 4547640 gene locus_tag LOCUS_39680 4547446 4547640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 4547756 4549153 gene locus_tag LOCUS_39690 gene ahcY 4547756 4549153 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_39690 4549262 4550104 gene locus_tag LOCUS_39700 gene metF 4549262 4550104 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_39700 4550247 4550906 gene locus_tag LOCUS_39710 4550247 4550906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4551157 4552020 gene locus_tag LOCUS_39720 4551157 4552020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4552025 4553080 gene locus_tag LOCUS_39730 4552025 4553080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 4553229 4553945 gene locus_tag LOCUS_39740 gene rsmE 4553229 4553945 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261219.1 protein_id gnl|my_center|LOCUS_39740 4554384 4553872 gene locus_tag LOCUS_39750 4554384 4553872 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_39750 4559751 4554409 gene locus_tag LOCUS_39760 4559751 4554409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 4561950 4559818 gene locus_tag LOCUS_39770 gene pilJ 4561950 4559818 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_39770 4562582 4561971 gene locus_tag LOCUS_39780 4562582 4561971 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_39780 4562987 4562613 gene locus_tag LOCUS_39790 gene pilH 4562987 4562613 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377196.1 protein_id gnl|my_center|LOCUS_39790 4563226 4564536 gene locus_tag LOCUS_39800 4563226 4564536 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_39800 4564838 4565152 gene locus_tag LOCUS_39810 4564838 4565152 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 protein_id gnl|my_center|LOCUS_39810 4565258 4567771 gene locus_tag LOCUS_39820 gene ptsP 4565258 4567771 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174088.1 protein_id gnl|my_center|LOCUS_39820 4569467 4567785 gene locus_tag LOCUS_39830 4569467 4567785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 4570850 4569474 gene locus_tag LOCUS_39840 4570850 4569474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 4571681 4571295 gene locus_tag LOCUS_39850 4571681 4571295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 4572159 4571728 gene locus_tag LOCUS_39860 4572159 4571728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 4572349 4572152 gene locus_tag LOCUS_39870 4572349 4572152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 4572611 4573243 gene locus_tag LOCUS_39880 4572611 4573243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4574019 4573423 gene locus_tag LOCUS_39890 4574019 4573423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 4574476 4574108 gene locus_tag LOCUS_39900 4574476 4574108 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704672.1 protein_id gnl|my_center|LOCUS_39900 4575465 4574620 gene locus_tag LOCUS_39910 4575465 4574620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 4576169 4575765 gene locus_tag LOCUS_39920 4576169 4575765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4576092 4577327 gene locus_tag LOCUS_39930 4576092 4577327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 4577861 4577589 gene locus_tag LOCUS_39940 4577861 4577589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 4578122 4577868 gene locus_tag LOCUS_39950 4578122 4577868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 4578825 4580087 gene locus_tag LOCUS_39960 gene ltrA 4578825 4580087 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_39960 4580872 4580474 gene locus_tag LOCUS_39970 4580872 4580474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4581101 4581976 gene locus_tag LOCUS_39980 gene hslO 4581101 4581976 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_39980 4582341 4583972 gene locus_tag LOCUS_39990 gene pckA 4582341 4583972 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 protein_id gnl|my_center|LOCUS_39990 4585546 4584053 gene locus_tag LOCUS_40000 4585546 4584053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 4586067 4585576 gene locus_tag LOCUS_40010 4586067 4585576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4586322 4588661 gene locus_tag LOCUS_40020 4586322 4588661 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_40020 4588905 4589240 gene locus_tag LOCUS_40030 4588905 4589240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4589539 4591128 gene locus_tag LOCUS_40040 gene gshA 4589539 4591128 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_40040 4591246 4591752 gene locus_tag LOCUS_40050 4591246 4591752 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_40050 4592091 4592564 gene locus_tag LOCUS_40060 gene rsd 4592091 4592564 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 protein_id gnl|my_center|LOCUS_40060 4593367 4592663 gene locus_tag LOCUS_40070 gene mip 4593367 4592663 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_40070 4593719 4594204 gene locus_tag LOCUS_40080 4593719 4594204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4594471 4596390 gene locus_tag LOCUS_40090 4594471 4596390 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_40090 4596824 4596564 gene locus_tag LOCUS_40100 4596824 4596564 CDS product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349028.1 protein_id gnl|my_center|LOCUS_40100 4597258 4597482 gene locus_tag LOCUS_40110 4597258 4597482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4597670 4598899 gene locus_tag LOCUS_40120 4597670 4598899 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084535.1 protein_id gnl|my_center|LOCUS_40120 4598896 4599492 gene locus_tag LOCUS_40130 gene metW 4598896 4599492 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_40130 4599534 4600037 gene locus_tag LOCUS_40140 4599534 4600037 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_40140 4600066 4600668 gene locus_tag LOCUS_40150 4600066 4600668 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_40150 4600669 4601811 gene locus_tag LOCUS_40160 gene hemW 4600669 4601811 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_40160 4601865 4602194 gene locus_tag LOCUS_40170 4601865 4602194 CDS product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_40170 4602385 4603056 gene locus_tag LOCUS_40180 4602385 4603056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4604414 4603119 gene locus_tag LOCUS_40190 4604414 4603119 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_40190 4605112 4604600 gene locus_tag LOCUS_40200 4605112 4604600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 4605209 4606048 gene locus_tag LOCUS_40210 4605209 4606048 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_40210 4606818 4606072 gene locus_tag LOCUS_40220 gene trmB 4606818 4606072 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369721.1 protein_id gnl|my_center|LOCUS_40220 4607242 4606871 gene locus_tag LOCUS_40230 4607242 4606871 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_40230 4608592 4607336 gene locus_tag LOCUS_40240 4608592 4607336 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_40240 4609863 4608589 gene locus_tag LOCUS_40250 4609863 4608589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4610645 4609860 gene locus_tag LOCUS_40260 4610645 4609860 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 protein_id gnl|my_center|LOCUS_40260 4611561 4610638 gene locus_tag LOCUS_40270 gene hemC 4611561 4610638 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_40270 4612419 4611682 gene locus_tag LOCUS_40280 4612419 4611682 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_40280 4613516 4612416 gene locus_tag LOCUS_40290 gene algZ 4613516 4612416 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_40290 4613693 4615081 gene locus_tag LOCUS_40300 gene argH 4613693 4615081 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_40300 4616963 4615185 gene locus_tag LOCUS_40310 4616963 4615185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4617195 4618772 gene locus_tag LOCUS_40320 4617195 4618772 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_40320 4618769 4619995 gene locus_tag LOCUS_40330 4618769 4619995 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_40330 4619995 4620849 gene locus_tag LOCUS_40340 4619995 4620849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4621116 4620874 gene locus_tag LOCUS_40350 4621116 4620874 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_40350 4621938 4621264 gene locus_tag LOCUS_40360 4621938 4621264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 4623247 4621925 gene locus_tag LOCUS_40370 4623247 4621925 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463793.1 protein_id gnl|my_center|LOCUS_40370 4624030 4623320 gene locus_tag LOCUS_40380 4624030 4623320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 4625100 4624084 gene locus_tag LOCUS_40390 4625100 4624084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4626681 4625440 gene locus_tag LOCUS_40400 4626681 4625440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 4627793 4626672 gene locus_tag LOCUS_40410 4627793 4626672 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109898.1 protein_id gnl|my_center|LOCUS_40410 4628493 4627813 gene locus_tag LOCUS_40420 4628493 4627813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 4628788 4628522 gene locus_tag LOCUS_40430 4628788 4628522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 4629543 4628785 gene locus_tag LOCUS_40440 4629543 4628785 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_40440 4630367 4629558 gene locus_tag LOCUS_40450 gene rfaP 4630367 4629558 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_40450 4631307 4630372 gene locus_tag LOCUS_40460 4631307 4630372 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_40460 4632530 4631496 gene locus_tag LOCUS_40470 gene waaC 4632530 4631496 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_40470 4633525 4632527 gene locus_tag LOCUS_40480 gene waaF 4633525 4632527 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_40480 4634831 4633896 gene locus_tag LOCUS_40490 gene ilvE 4634831 4633896 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_40490 4637969 4635168 gene locus_tag LOCUS_40500 gene glnE 4637969 4635168 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_40500 4638245 4639381 gene locus_tag LOCUS_40510 gene msrB 4638245 4639381 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_40510 4640405 4640737 gene locus_tag LOCUS_40520 4640405 4640737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4640942 4643599 gene locus_tag LOCUS_40530 gene aceE 4640942 4643599 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_40530 4643659 4645341 gene locus_tag LOCUS_40540 gene aceF 4643659 4645341 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_40540 4647780 4645357 gene locus_tag LOCUS_40550 4647780 4645357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4648448 4647897 gene locus_tag LOCUS_40560 4648448 4647897 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_40560 4649364 4648525 gene locus_tag LOCUS_40570 gene proC 4649364 4648525 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_40570 4650086 4649388 gene locus_tag LOCUS_40580 4650086 4649388 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_40580 4650163 4651197 gene locus_tag LOCUS_40590 gene pilT 4650163 4651197 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_40590 4652033 4651194 gene locus_tag LOCUS_40600 4652033 4651194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 4652448 4652008 gene locus_tag LOCUS_40610 gene ruvX 4652448 4652008 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_40610 4652981 4652466 gene locus_tag LOCUS_40620 4652981 4652466 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_40620 4653917 4653096 gene locus_tag LOCUS_40630 4653917 4653096 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_40630 4653904 4654074 gene locus_tag LOCUS_40640 4653904 4654074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 4655577 4654063 gene locus_tag LOCUS_40650 4655577 4654063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 4656886 4655939 gene locus_tag LOCUS_40660 gene gshB 4656886 4655939 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_40660 4657609 4656989 gene locus_tag LOCUS_40670 4657609 4656989 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 protein_id gnl|my_center|LOCUS_40670 4658535 4657675 gene locus_tag LOCUS_40680 4658535 4657675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40680 4659434 4658622 gene locus_tag LOCUS_40690 gene rhdA 4659434 4658622 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_40690 4659553 4660422 gene locus_tag LOCUS_40700 4659553 4660422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4660815 4661714 gene locus_tag LOCUS_40710 4660815 4661714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4662744 4661719 gene locus_tag LOCUS_40720 gene rsgA 4662744 4661719 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_40720 4663051 4663593 gene locus_tag LOCUS_40730 gene orn 4663051 4663593 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694199.1 protein_id gnl|my_center|LOCUS_40730 4664167 4663691 gene locus_tag LOCUS_40740 4664167 4663691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 4665189 4664167 gene locus_tag LOCUS_40750 gene asrC 4665189 4664167 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 protein_id gnl|my_center|LOCUS_40750 4666046 4665201 gene locus_tag LOCUS_40760 gene asrB 4666046 4665201 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706396.1 protein_id gnl|my_center|LOCUS_40760 4667073 4666036 gene locus_tag LOCUS_40770 gene asrA 4667073 4666036 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706395.1 protein_id gnl|my_center|LOCUS_40770 4669160 4667760 gene locus_tag LOCUS_40780 gene cysG 4669160 4667760 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405073.1 protein_id gnl|my_center|LOCUS_40780 4669990 4669451 gene locus_tag LOCUS_40790 4669990 4669451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 4671353 4671009 gene locus_tag LOCUS_40800 4671353 4671009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 4672596 4671484 gene locus_tag LOCUS_40810 gene queG 4672596 4671484 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_40810 4672720 4674255 gene locus_tag LOCUS_40820 4672720 4674255 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 protein_id gnl|my_center|LOCUS_40820 4674287 4674808 gene locus_tag LOCUS_40830 gene tsaE 4674287 4674808 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_40830 4674799 4676226 gene locus_tag LOCUS_40840 gene amiB 4674799 4676226 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_40840 4677095 4677634 gene locus_tag LOCUS_40850 4677095 4677634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 4679108 4681117 gene locus_tag LOCUS_40860 gene mutL 4679108 4681117 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_40860 4681145 4681690 gene locus_tag LOCUS_40870 4681145 4681690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 4682353 4681901 gene locus_tag LOCUS_40880 4682353 4681901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 4684005 4682605 gene locus_tag LOCUS_40890 4684005 4682605 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_40890 4685979 4684276 gene locus_tag LOCUS_40900 4685979 4684276 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_40900 4686071 4686589 gene locus_tag LOCUS_40910 4686071 4686589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4688207 4686666 gene locus_tag LOCUS_40920 4688207 4686666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 4688864 4688217 gene locus_tag LOCUS_40930 4688864 4688217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4689202 4690428 gene locus_tag LOCUS_40940 4689202 4690428 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 protein_id gnl|my_center|LOCUS_40940 4690540 4691154 gene locus_tag LOCUS_40950 4690540 4691154 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420789.1 protein_id gnl|my_center|LOCUS_40950 4691315 4691130 gene locus_tag LOCUS_40960 4691315 4691130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 4691365 4692690 gene locus_tag LOCUS_40970 4691365 4692690 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463934.1 protein_id gnl|my_center|LOCUS_40970 4692723 4693307 gene locus_tag LOCUS_40980 4692723 4693307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4693636 4695033 gene locus_tag LOCUS_40990 4693636 4695033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 4695061 4696617 gene locus_tag LOCUS_41000 gene gcvPB 4695061 4696617 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250330.1 protein_id gnl|my_center|LOCUS_41000 4696705 4697817 gene locus_tag LOCUS_41010 4696705 4697817 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_41010 4697853 4698623 gene locus_tag LOCUS_41020 gene bacC 4697853 4698623 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_41020 4698849 4699535 gene locus_tag LOCUS_41030 4698849 4699535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4700242 4699631 gene locus_tag LOCUS_41040 4700242 4699631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 4701441 4700239 gene locus_tag LOCUS_41050 4701441 4700239 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_41050 4702792 4701512 gene locus_tag LOCUS_41060 4702792 4701512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 4703310 4704053 gene locus_tag LOCUS_41070 4703310 4704053 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_41070 4704152 4705174 gene locus_tag LOCUS_41080 gene epd 4704152 4705174 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 protein_id gnl|my_center|LOCUS_41080 4705434 4706597 gene locus_tag LOCUS_41090 4705434 4706597 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111267.1 protein_id gnl|my_center|LOCUS_41090 4706905 4707543 gene locus_tag LOCUS_41100 4706905 4707543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 4707543 4708505 gene locus_tag LOCUS_41110 4707543 4708505 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_41110 4709174 4708575 gene locus_tag LOCUS_41120 4709174 4708575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 4710316 4709843 gene locus_tag LOCUS_41130 gene dsbB 4710316 4709843 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072798.1 protein_id gnl|my_center|LOCUS_41130 4711040 4710474 gene locus_tag LOCUS_41140 4711040 4710474 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073507.1 protein_id gnl|my_center|LOCUS_41140 4711185 4712027 gene locus_tag LOCUS_41150 gene nfo 4711185 4712027 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873905.1 protein_id gnl|my_center|LOCUS_41150 4712925 4712101 gene locus_tag LOCUS_41160 4712925 4712101 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_41160 4714661 4713267 gene locus_tag LOCUS_41170 gene pntB 4714661 4713267 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272521.1 protein_id gnl|my_center|LOCUS_41170 4716210 4714678 gene locus_tag LOCUS_41180 gene pntA 4716210 4714678 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378711.1 protein_id gnl|my_center|LOCUS_41180 4716622 4717542 gene locus_tag LOCUS_41190 4716622 4717542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 4717694 4718404 gene locus_tag LOCUS_41200 4717694 4718404 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_41200 4718397 4718909 gene locus_tag LOCUS_41210 4718397 4718909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_41210 4719894 4719142 gene locus_tag LOCUS_41220 4719894 4719142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 4720710 4719925 gene locus_tag LOCUS_41230 4720710 4719925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 protein_id gnl|my_center|LOCUS_41230 4720978 4720721 gene locus_tag LOCUS_41240 4720978 4720721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 4722344 4721019 gene locus_tag LOCUS_41250 4722344 4721019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 4723917 4722592 gene locus_tag LOCUS_41260 4723917 4722592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 4724484 4724116 gene locus_tag LOCUS_41270 4724484 4724116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 4724576 4725811 gene locus_tag LOCUS_41280 4724576 4725811 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_41280 4727901 4726009 gene locus_tag LOCUS_41290 4727901 4726009 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_41290 4728938 4727898 gene locus_tag LOCUS_41300 4728938 4727898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 4729250 4728942 gene locus_tag LOCUS_41310 4729250 4728942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41310 4731052 4729316 gene locus_tag LOCUS_41320 4731052 4729316 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787447.1 protein_id gnl|my_center|LOCUS_41320 4733159 4731063 gene locus_tag LOCUS_41330 4733159 4731063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 4733521 4733216 gene locus_tag LOCUS_41340 4733521 4733216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 4734805 4733636 gene locus_tag LOCUS_41350 4734805 4733636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 4736300 4735098 gene locus_tag LOCUS_41360 4736300 4735098 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_41360 4736798 4738000 gene locus_tag LOCUS_41370 4736798 4738000 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281641.1 protein_id gnl|my_center|LOCUS_41370 4738406 4737978 gene locus_tag LOCUS_41380 4738406 4737978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 4738461 4740164 gene locus_tag LOCUS_41390 4738461 4740164 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_41390 4741150 4740134 gene locus_tag LOCUS_41400 4741150 4740134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 4741782 4741210 gene locus_tag LOCUS_41410 4741782 4741210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 4743535 4742135 gene locus_tag LOCUS_41420 4743535 4742135 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_41420 4743917 4743618 gene locus_tag LOCUS_41430 4743917 4743618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 4744015 4744221 gene locus_tag LOCUS_41440 4744015 4744221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 4745295 4744402 gene locus_tag LOCUS_41450 4745295 4744402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 4747084 4746599 gene locus_tag LOCUS_41460 4747084 4746599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 4747266 4748225 gene locus_tag LOCUS_41470 4747266 4748225 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 protein_id gnl|my_center|LOCUS_41470 4748513 4748764 gene locus_tag LOCUS_41480 gene hfq 4748513 4748764 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_41480 4748993 4750282 gene locus_tag LOCUS_41490 gene hflX 4748993 4750282 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_41490 4750638 4751819 gene locus_tag LOCUS_41500 gene hflK 4750638 4751819 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_41500 4751816 4752688 gene locus_tag LOCUS_41510 gene hflC 4751816 4752688 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_41510 4752858 4753049 gene locus_tag LOCUS_41520 4752858 4753049 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_41520 4753136 4754308 gene locus_tag LOCUS_41530 4753136 4754308 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_41530 4754396 4755688 gene locus_tag LOCUS_41540 4754396 4755688 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_41540 4756410 4755838 gene locus_tag LOCUS_41550 4756410 4755838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 4756667 4759192 gene locus_tag LOCUS_41560 gene rnr 4756667 4759192 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_41560 4762915 4759313 gene locus_tag LOCUS_41570 4762915 4759313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 4763207 4763944 gene locus_tag LOCUS_41580 gene rlmB 4763207 4763944 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 protein_id gnl|my_center|LOCUS_41580 4764077 4765480 gene locus_tag LOCUS_41590 4764077 4765480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 4765748 4766206 gene locus_tag LOCUS_41600 4765748 4766206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 4766239 4766463 gene locus_tag LOCUS_41610 gene rpsR 4766239 4766463 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_41610 4766494 4767378 gene locus_tag LOCUS_41620 4766494 4767378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_41620 4767395 4767841 gene locus_tag LOCUS_41630 gene rplI 4767395 4767841 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_41630 4768059 4770083 gene locus_tag LOCUS_41640 4768059 4770083 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_41640 4770360 4771430 gene locus_tag LOCUS_41650 4770360 4771430 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_41650 4772110 4771586 gene locus_tag LOCUS_41660 4772110 4771586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 4773342 4772107 gene locus_tag LOCUS_41670 4773342 4772107 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_41670 4773664 4773335 gene locus_tag LOCUS_41680 4773664 4773335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 4774521 4773763 gene locus_tag LOCUS_41690 4774521 4773763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 4774783 4777554 gene locus_tag LOCUS_41700 4774783 4777554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 4778934 4777570 gene locus_tag LOCUS_41710 4778934 4777570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 4780050 4779112 gene locus_tag LOCUS_41720 4780050 4779112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 4781426 4780437 gene locus_tag LOCUS_41730 4781426 4780437 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_41730 4781608 4782390 gene locus_tag LOCUS_41740 4781608 4782390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 4783812 4782577 gene locus_tag LOCUS_41750 4783812 4782577 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_41750 4785255 4783852 gene locus_tag LOCUS_41760 4785255 4783852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 4786230 4785577 gene locus_tag LOCUS_41770 4786230 4785577 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299461.1 protein_id gnl|my_center|LOCUS_41770 4786136 4786375 gene locus_tag LOCUS_41780 4786136 4786375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 4787693 4786413 gene locus_tag LOCUS_41790 4787693 4786413 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071607.1 protein_id gnl|my_center|LOCUS_41790 4788126 4787713 gene locus_tag LOCUS_41800 4788126 4787713 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071608.1 protein_id gnl|my_center|LOCUS_41800 4788716 4788297 gene locus_tag LOCUS_41810 4788716 4788297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 4788815 4789216 gene locus_tag LOCUS_41820 4788815 4789216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 4790634 4789300 gene locus_tag LOCUS_41830 4790634 4789300 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263062.1 protein_id gnl|my_center|LOCUS_41830 4792434 4790638 gene locus_tag LOCUS_41840 gene iucC 4792434 4790638 CDS product NIS family aerobactin synthetase IucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015710.1 protein_id gnl|my_center|LOCUS_41840 4793450 4792431 gene locus_tag LOCUS_41850 4793450 4792431 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263060.1 protein_id gnl|my_center|LOCUS_41850 4795368 4793482 gene locus_tag LOCUS_41860 4795368 4793482 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263059.1 protein_id gnl|my_center|LOCUS_41860 4795530 4796738 gene locus_tag LOCUS_41870 4795530 4796738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211651.1 protein_id gnl|my_center|LOCUS_41870 4796744 4797136 gene locus_tag LOCUS_41880 4796744 4797136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 4797192 4798046 gene locus_tag LOCUS_41890 gene fhuC 4797192 4798046 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209359.1 protein_id gnl|my_center|LOCUS_41890 4798047 4798970 gene locus_tag LOCUS_41900 4798047 4798970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707922.1 protein_id gnl|my_center|LOCUS_41900 4798988 4800964 gene locus_tag LOCUS_41910 gene fhuB 4798988 4800964 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061689.1 protein_id gnl|my_center|LOCUS_41910 4801080 4803332 gene locus_tag LOCUS_41920 4801080 4803332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 protein_id gnl|my_center|LOCUS_41920 4803569 4805206 gene locus_tag LOCUS_41930 4803569 4805206 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_41930 4806499 4806026 gene locus_tag LOCUS_41940 4806499 4806026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4806872 4808011 gene locus_tag LOCUS_41950 gene bioB 4806872 4808011 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_41950 4808022 4809227 gene locus_tag LOCUS_41960 gene bioF 4808022 4809227 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269172.1 protein_id gnl|my_center|LOCUS_41960 4809224 4809970 gene locus_tag LOCUS_41970 4809224 4809970 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402140.1 protein_id gnl|my_center|LOCUS_41970 4809955 4810779 gene locus_tag LOCUS_41980 gene bioC 4809955 4810779 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103161.1 protein_id gnl|my_center|LOCUS_41980 4810842 4811531 gene locus_tag LOCUS_41990 gene bioD 4810842 4811531 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_41990 4811779 4813569 gene locus_tag LOCUS_42000 4811779 4813569 CDS product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_42000 4813851 4814207 gene locus_tag LOCUS_42010 4813851 4814207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 4814342 4814896 gene locus_tag LOCUS_42020 4814342 4814896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 4814947 4815429 gene locus_tag LOCUS_42030 4814947 4815429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 4815588 4816367 gene locus_tag LOCUS_42040 4815588 4816367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 4816583 4817098 gene locus_tag LOCUS_42050 4816583 4817098 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143257.1 protein_id gnl|my_center|LOCUS_42050 4817129 4817494 gene locus_tag LOCUS_42060 4817129 4817494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 4818351 4817575 gene locus_tag LOCUS_42070 4818351 4817575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 4818880 4818449 gene locus_tag LOCUS_42080 gene tnpA 4818880 4818449 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_42080 4819414 4818944 gene locus_tag LOCUS_42090 4819414 4818944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 4820035 4821471 gene locus_tag LOCUS_42100 4820035 4821471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 4821650 4823782 gene locus_tag LOCUS_42110 4821650 4823782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 4823956 4824576 gene locus_tag LOCUS_42120 4823956 4824576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 4824753 4825631 gene locus_tag LOCUS_42130 4824753 4825631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 4825652 4827355 gene locus_tag LOCUS_42140 4825652 4827355 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_42140 4829915 4827360 gene locus_tag LOCUS_42150 4829915 4827360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 4830163 4830468 gene locus_tag LOCUS_42160 4830163 4830468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 4831618 4831463 gene locus_tag LOCUS_42170 4831618 4831463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 4835786 4836580 gene locus_tag LOCUS_42180 4835786 4836580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 4838573 4836741 gene locus_tag LOCUS_42190 gene glmS 4838573 4836741 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 protein_id gnl|my_center|LOCUS_42190 4840018 4838642 gene locus_tag LOCUS_42200 gene glmU 4840018 4838642 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 protein_id gnl|my_center|LOCUS_42200 4840454 4841194 gene locus_tag LOCUS_42210 4840454 4841194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 4842245 4841223 gene locus_tag LOCUS_42220 4842245 4841223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 4843230 4843454 gene locus_tag LOCUS_42230 4843230 4843454 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_42230 4843552 4844952 gene locus_tag LOCUS_42240 4843552 4844952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 4845635 4844949 gene locus_tag LOCUS_42250 4845635 4844949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 4847300 4845654 gene locus_tag LOCUS_42260 gene ushA 4847300 4845654 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809002.1 protein_id gnl|my_center|LOCUS_42260 4847528 4848541 gene locus_tag LOCUS_42270 4847528 4848541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 4849362 4848658 gene locus_tag LOCUS_42280 gene deoD 4849362 4848658 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707410.1 protein_id gnl|my_center|LOCUS_42280 4850616 4849381 gene locus_tag LOCUS_42290 gene deoB 4850616 4849381 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 protein_id gnl|my_center|LOCUS_42290 4851733 4850762 gene locus_tag LOCUS_42300 4851733 4850762 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027467.1 protein_id gnl|my_center|LOCUS_42300 4854854 4851840 gene locus_tag LOCUS_42310 4854854 4851840 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485697.1 protein_id gnl|my_center|LOCUS_42310 4855139 4856926 gene locus_tag LOCUS_42320 4855139 4856926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42320 4856930 4857298 gene locus_tag LOCUS_42330 4856930 4857298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 4858104 4857331 gene locus_tag LOCUS_42340 gene deoC 4858104 4857331 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456105.1 protein_id gnl|my_center|LOCUS_42340 4858585 4859535 gene locus_tag LOCUS_42350 gene punR 4858585 4859535 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423889.1 protein_id gnl|my_center|LOCUS_42350 4861251 4863545 gene locus_tag LOCUS_42360 4861251 4863545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 4864056 4863697 gene locus_tag LOCUS_42370 4864056 4863697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 4864452 4865675 gene locus_tag LOCUS_42380 4864452 4865675 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_42380 4866220 4865753 gene locus_tag LOCUS_42390 4866220 4865753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 4867377 4866337 gene locus_tag LOCUS_42400 4867377 4866337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 4867661 4867440 gene locus_tag LOCUS_42410 4867661 4867440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 4867990 4867838 gene locus_tag LOCUS_42420 4867990 4867838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 4868559 4868098 gene locus_tag LOCUS_42430 4868559 4868098 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_42430 4869386 4868607 gene locus_tag LOCUS_42440 4869386 4868607 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216609.1 protein_id gnl|my_center|LOCUS_42440 4871164 4870685 gene locus_tag LOCUS_42450 4871164 4870685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 4871288 4872100 gene locus_tag LOCUS_42460 gene pyrF 4871288 4872100 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_42460 4872187 4872867 gene locus_tag LOCUS_42470 gene can 4872187 4872867 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_42470 4873034 4873567 gene locus_tag LOCUS_42480 4873034 4873567 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086339.1 protein_id gnl|my_center|LOCUS_42480 4874685 4873639 gene locus_tag LOCUS_42490 4874685 4873639 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_42490 4875654 4874836 gene locus_tag LOCUS_42500 gene truC 4875654 4874836 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890132.1 protein_id gnl|my_center|LOCUS_42500 4876042 4875704 gene locus_tag LOCUS_42510 4876042 4875704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 4876058 4877293 gene locus_tag LOCUS_42520 4876058 4877293 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_42520 4878705 4877473 gene locus_tag LOCUS_42530 4878705 4877473 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_42530 4879468 4878815 gene locus_tag LOCUS_42540 4879468 4878815 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_42540 4879851 4879741 gene locus_tag LOCUS_r00140 4879851 4879741 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4882988 4880084 gene locus_tag LOCUS_r00150 4882988 4880084 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4884922 4883372 gene locus_tag LOCUS_r00160 4884922 4883372 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4885684 4886151 gene locus_tag LOCUS_42550 4885684 4886151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 4886629 4887162 gene locus_tag LOCUS_42560 4886629 4887162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 4887580 4887176 gene locus_tag LOCUS_42570 4887580 4887176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 4887503 4888738 gene locus_tag LOCUS_42580 4887503 4888738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 4889140 4889454 gene locus_tag LOCUS_42590 4889140 4889454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 4889761 4890498 gene locus_tag LOCUS_42600 4889761 4890498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 4891438 4892115 gene locus_tag LOCUS_42610 4891438 4892115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 4892621 4892163 gene locus_tag LOCUS_42620 4892621 4892163 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_42620 4893161 4892679 gene locus_tag LOCUS_42630 4893161 4892679 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_42630 4895344 4893260 gene locus_tag LOCUS_42640 gene recG 4895344 4893260 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_42640 4896258 4895344 gene locus_tag LOCUS_42650 4896258 4895344 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 protein_id gnl|my_center|LOCUS_42650 4896511 4897356 gene locus_tag LOCUS_42660 4896511 4897356 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266255.1 protein_id gnl|my_center|LOCUS_42660 4897401 4898651 gene locus_tag LOCUS_42670 4897401 4898651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 4900235 4899849 gene locus_tag LOCUS_42680 4900235 4899849 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957491.1 protein_id gnl|my_center|LOCUS_42680 4901111 4900365 gene locus_tag LOCUS_42690 4901111 4900365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 4901533 4901108 gene locus_tag LOCUS_42700 4901533 4901108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 4903744 4901615 gene locus_tag LOCUS_42710 gene spoT 4903744 4901615 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_42710 4904046 4903795 gene locus_tag LOCUS_42720 gene rpoZ 4904046 4903795 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_42720 4904337 4906118 gene locus_tag LOCUS_42730 4904337 4906118 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_42730 4906204 4907007 gene locus_tag LOCUS_42740 4906204 4907007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 4907791 4907174 gene locus_tag LOCUS_42750 gene gmk 4907791 4907174 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_42750 4908687 4907824 gene locus_tag LOCUS_42760 4908687 4907824 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_42760 4909028 4909744 gene locus_tag LOCUS_42770 gene rph 4909028 4909744 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_42770 4910798 4909839 gene locus_tag LOCUS_42780 4910798 4909839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_42780 4911855 4910845 gene locus_tag LOCUS_42790 4911855 4910845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_42790 4913348 4911855 gene locus_tag LOCUS_42800 gene gguA 4913348 4911855 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_42800 4914062 4913412 gene locus_tag LOCUS_42810 gene fucA 4914062 4913412 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440782.1 protein_id gnl|my_center|LOCUS_42810 4914232 4915650 gene locus_tag LOCUS_42820 gene fucK 4914232 4915650 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808360.1 protein_id gnl|my_center|LOCUS_42820 4915895 4916488 gene locus_tag LOCUS_42830 4915895 4916488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 4917283 4916507 gene locus_tag LOCUS_42840 4917283 4916507 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_42840 4917695 4918339 gene locus_tag LOCUS_42850 gene pyrE 4917695 4918339 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246510.1 protein_id gnl|my_center|LOCUS_42850 4920473 4918392 gene locus_tag LOCUS_42860 4920473 4918392 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700219.1 protein_id gnl|my_center|LOCUS_42860 4921252 4920662 gene locus_tag LOCUS_42870 gene slmA 4921252 4920662 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_42870 4922183 4921245 gene locus_tag LOCUS_42880 gene argB 4922183 4921245 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_42880 4922778 4922323 gene locus_tag LOCUS_42890 gene dut 4922778 4922323 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164750.1 protein_id gnl|my_center|LOCUS_42890 4924103 4922775 gene locus_tag LOCUS_42900 gene coaBC 4924103 4922775 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463702.1 protein_id gnl|my_center|LOCUS_42900 4925098 4924124 gene locus_tag LOCUS_42910 4925098 4924124 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 protein_id gnl|my_center|LOCUS_42910 4925379 4925684 gene locus_tag LOCUS_42920 4925379 4925684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 4926181 4925852 gene locus_tag LOCUS_42930 4926181 4925852 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209585.1 protein_id gnl|my_center|LOCUS_42930 4926419 4926165 gene locus_tag LOCUS_42940 4926419 4926165 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_42940 4926591 4927280 gene locus_tag LOCUS_42950 gene radC 4926591 4927280 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 protein_id gnl|my_center|LOCUS_42950 4927618 4927854 gene locus_tag LOCUS_42960 gene rpmB 4927618 4927854 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 protein_id gnl|my_center|LOCUS_42960 4927875 4928042 gene locus_tag LOCUS_42970 gene rpmG 4927875 4928042 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_42970 4928250 4928573 gene locus_tag LOCUS_42980 4928250 4928573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 4928712 4930034 gene locus_tag LOCUS_42990 gene yegQ 4928712 4930034 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 protein_id gnl|my_center|LOCUS_42990 4930138 4930800 gene locus_tag LOCUS_43000 4930138 4930800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 4931297 4930806 gene locus_tag LOCUS_43010 4931297 4930806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 4932804 4932376 gene locus_tag LOCUS_43020 4932804 4932376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 4933564 4933349 gene locus_tag LOCUS_43030 4933564 4933349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 4933769 4935580 gene locus_tag LOCUS_43040 4933769 4935580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 4937120 4935618 gene locus_tag LOCUS_43050 gene ppx 4937120 4935618 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_43050 4937319 4937642 gene locus_tag LOCUS_43060 gene trxA 4937319 4937642 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_43060 4938150 4939409 gene locus_tag LOCUS_43070 gene rho 4938150 4939409 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_43070 4939526 4941001 gene locus_tag LOCUS_43080 gene ubiD 4939526 4941001 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_43080 4941007 4941729 gene locus_tag LOCUS_43090 4941007 4941729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 4941916 4942575 gene locus_tag LOCUS_43100 4941916 4942575 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266559.1 protein_id gnl|my_center|LOCUS_43100 4944873 4942618 gene locus_tag LOCUS_43110 gene parC 4944873 4942618 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_43110 4945634 4944933 gene locus_tag LOCUS_43120 4945634 4944933 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261220.1 protein_id gnl|my_center|LOCUS_43120 4946430 4945786 gene locus_tag LOCUS_43130 4946430 4945786 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080883.1 protein_id gnl|my_center|LOCUS_43130 4946628 4947566 gene locus_tag LOCUS_43140 4946628 4947566 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_43140 4947828 4947601 gene locus_tag LOCUS_43150 4947828 4947601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 4949171 4947918 gene locus_tag LOCUS_43160 gene ubiF 4949171 4947918 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816831.1 protein_id gnl|my_center|LOCUS_43160 4949434 4951041 gene locus_tag LOCUS_43170 4949434 4951041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 4951292 4951038 gene locus_tag LOCUS_43180 4951292 4951038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 4952259 4951348 gene locus_tag LOCUS_43190 gene cdd 4952259 4951348 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816724.1 protein_id gnl|my_center|LOCUS_43190 4954027 4952825 gene locus_tag LOCUS_43200 4954027 4952825 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_43200 4954650 4955486 gene locus_tag LOCUS_43210 gene murI 4954650 4955486 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201820.1 protein_id gnl|my_center|LOCUS_43210 4956610 4955504 gene locus_tag LOCUS_43220 gene dctP 4956610 4955504 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_43220 4958911 4956740 gene locus_tag LOCUS_43230 gene uvrD 4958911 4956740 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_43230 4959119 4959295 gene locus_tag LOCUS_43240 4959119 4959295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 4959532 4960482 gene locus_tag LOCUS_43250 4959532 4960482 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114126.1 protein_id gnl|my_center|LOCUS_43250 4960704 4960483 gene locus_tag LOCUS_43260 4960704 4960483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 4961721 4960867 gene locus_tag LOCUS_43270 gene purU 4961721 4960867 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_43270 4961877 4962485 gene locus_tag LOCUS_43280 gene def 4961877 4962485 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_43280 4962826 4962482 gene locus_tag LOCUS_43290 4962826 4962482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 4963414 4962866 gene locus_tag LOCUS_43300 4963414 4962866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 4964090 4963407 gene locus_tag LOCUS_43310 gene nudF 4964090 4963407 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_43310 4964670 4964101 gene locus_tag LOCUS_43320 4964670 4964101 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422776.1 protein_id gnl|my_center|LOCUS_43320 4965988 4965116 gene locus_tag LOCUS_43330 4965988 4965116 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_43330 4966783 4966064 gene locus_tag LOCUS_43340 gene dsbA 4966783 4966064 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_43340 4967522 4966905 gene locus_tag LOCUS_43350 4967522 4966905 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_43350 4967882 4968556 gene locus_tag LOCUS_43360 gene yihA 4967882 4968556 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 protein_id gnl|my_center|LOCUS_43360 4971951 4969171 gene locus_tag LOCUS_43370 gene polA 4971951 4969171 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_43370 4972052 4972459 gene locus_tag LOCUS_43380 4972052 4972459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 4972538 4973536 gene locus_tag LOCUS_43390 4972538 4973536 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 protein_id gnl|my_center|LOCUS_43390 4973592 4975160 gene locus_tag LOCUS_43400 4973592 4975160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 4975250 4975759 gene locus_tag LOCUS_43410 4975250 4975759 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_43410 4975802 4976560 gene locus_tag LOCUS_43420 gene znuC 4975802 4976560 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768460.1 protein_id gnl|my_center|LOCUS_43420 4976557 4977348 gene locus_tag LOCUS_43430 gene znuB 4976557 4977348 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261503.1 protein_id gnl|my_center|LOCUS_43430 4978813 4977419 gene locus_tag LOCUS_43440 4978813 4977419 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 protein_id gnl|my_center|LOCUS_43440 4979832 4978924 gene locus_tag LOCUS_43450 4979832 4978924 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604834.1 protein_id gnl|my_center|LOCUS_43450 4980710 4980048 gene locus_tag LOCUS_43460 gene senC 4980710 4980048 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_43460 4981699 4980812 gene locus_tag LOCUS_43470 gene cyoE 4981699 4980812 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_43470 4982745 4981711 gene locus_tag LOCUS_43480 4982745 4981711 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_43480 4983466 4982831 gene locus_tag LOCUS_43490 4983466 4982831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_43490 4984163 4983447 gene locus_tag LOCUS_43500 4984163 4983447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_43500 4984276 4984491 gene locus_tag LOCUS_43510 4984276 4984491 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 protein_id gnl|my_center|LOCUS_43510 4985408 4984518 gene locus_tag LOCUS_43520 4985408 4984518 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_43520 4985991 4985419 gene locus_tag LOCUS_43530 4985991 4985419 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_43530 4987590 4986007 gene locus_tag LOCUS_43540 gene ctaD 4987590 4986007 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_43540 4988815 4987601 gene locus_tag LOCUS_43550 gene coxB 4988815 4987601 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_43550 4989836 4990486 gene locus_tag LOCUS_43560 4989836 4990486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115620.1 protein_id gnl|my_center|LOCUS_43560 4990740 4990489 gene locus_tag LOCUS_43570 4990740 4990489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 4990862 4991455 gene locus_tag LOCUS_43580 4990862 4991455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 4993557 4991521 gene locus_tag LOCUS_43590 gene prlC 4993557 4991521 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_43590 4993755 4994297 gene locus_tag LOCUS_43600 4993755 4994297 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_43600 4994357 4994635 gene locus_tag LOCUS_43610 4994357 4994635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 4994858 4995421 gene locus_tag LOCUS_43620 4994858 4995421 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_43620 4995675 4997273 gene locus_tag LOCUS_43630 4995675 4997273 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_43630 4997263 4998225 gene locus_tag LOCUS_43640 4997263 4998225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 4998723 4998292 gene locus_tag LOCUS_43650 gene tnpA 4998723 4998292 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_43650 4998824 4999207 gene locus_tag LOCUS_43660 4998824 4999207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 4999217 5000263 gene locus_tag LOCUS_43670 4999217 5000263 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_43670 5000359 5000667 gene locus_tag LOCUS_43680 5000359 5000667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 5000821 5004156 gene locus_tag LOCUS_43690 5000821 5004156 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_43690 5004543 5005793 gene locus_tag LOCUS_43700 5004543 5005793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 5006191 5007897 gene locus_tag LOCUS_43710 5006191 5007897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 5008165 5009769 gene locus_tag LOCUS_43720 5008165 5009769 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 protein_id gnl|my_center|LOCUS_43720 5009795 5010793 gene locus_tag LOCUS_43730 gene oppB 5009795 5010793 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 protein_id gnl|my_center|LOCUS_43730 5010793 5011782 gene locus_tag LOCUS_43740 gene oppC 5010793 5011782 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 protein_id gnl|my_center|LOCUS_43740 5011797 5012795 gene locus_tag LOCUS_43750 5011797 5012795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706427.1 protein_id gnl|my_center|LOCUS_43750 5012792 5013787 gene locus_tag LOCUS_43760 gene oppF 5012792 5013787 CDS product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 protein_id gnl|my_center|LOCUS_43760 5014598 5013840 gene locus_tag LOCUS_43770 5014598 5013840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 5015588 5016541 gene locus_tag LOCUS_43780 gene speE 5015588 5016541 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371548.1 protein_id gnl|my_center|LOCUS_43780 5016577 5018589 gene locus_tag LOCUS_43790 gene speA 5016577 5018589 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 protein_id gnl|my_center|LOCUS_43790 5018589 5019512 gene locus_tag LOCUS_43800 5018589 5019512 CDS product S-adenosylmethionine decarboxylase SpeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071983.1 protein_id gnl|my_center|LOCUS_43800 5019509 5020423 gene locus_tag LOCUS_43810 gene speB 5019509 5020423 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105562.1 protein_id gnl|my_center|LOCUS_43810 5021111 5020458 gene locus_tag LOCUS_43820 5021111 5020458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 5021962 5021111 gene locus_tag LOCUS_43830 gene aroE 5021962 5021111 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168154.1 protein_id gnl|my_center|LOCUS_43830 5022888 5021962 gene locus_tag LOCUS_43840 gene hemF 5022888 5021962 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_43840 5023550 5022927 gene locus_tag LOCUS_43850 5023550 5022927 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_43850 5024058 5023552 gene locus_tag LOCUS_43860 gene purE 5024058 5023552 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_43860 5024285 5025436 gene locus_tag LOCUS_43870 5024285 5025436 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074450.1 protein_id gnl|my_center|LOCUS_43870 5026760 5025534 gene locus_tag LOCUS_43880 gene ltrA 5026760 5025534 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_43880 5027381 5027533 gene locus_tag LOCUS_43890 5027381 5027533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 5028840 5027614 gene locus_tag LOCUS_43900 gene ltrA 5028840 5027614 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_43900 5029461 5030552 gene locus_tag LOCUS_43910 5029461 5030552 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_43910 5031736 5030573 gene locus_tag LOCUS_43920 5031736 5030573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 5032767 5031733 gene locus_tag LOCUS_43930 5032767 5031733 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_43930 5033034 5033543 gene locus_tag LOCUS_43940 gene def 5033034 5033543 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_43940 5033638 5035290 gene locus_tag LOCUS_43950 5033638 5035290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 5035427 5036383 gene locus_tag LOCUS_43960 gene fmt 5035427 5036383 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070447.1 protein_id gnl|my_center|LOCUS_43960 5036383 5037705 gene locus_tag LOCUS_43970 gene rsmB 5036383 5037705 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266131.1 protein_id gnl|my_center|LOCUS_43970 5037718 5039091 gene locus_tag LOCUS_43980 gene trkA 5037718 5039091 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_43980 5039397 5040656 gene locus_tag LOCUS_43990 5039397 5040656 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 protein_id gnl|my_center|LOCUS_43990 5040998 5040681 gene locus_tag LOCUS_44000 5040998 5040681 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_44000 5041179 5041012 gene locus_tag LOCUS_44010 5041179 5041012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 5041533 5041210 gene locus_tag LOCUS_44020 5041533 5041210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 5042198 5041557 gene locus_tag LOCUS_44030 5042198 5041557 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390751.1 protein_id gnl|my_center|LOCUS_44030 5042399 5043757 gene locus_tag LOCUS_44040 5042399 5043757 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 protein_id gnl|my_center|LOCUS_44040 5043852 5045414 gene locus_tag LOCUS_44050 5043852 5045414 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462305.1 protein_id gnl|my_center|LOCUS_44050 5045507 5046643 gene locus_tag LOCUS_44060 gene araD 5045507 5046643 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_44060 5046939 5048906 gene locus_tag LOCUS_44070 5046939 5048906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 5049108 5050091 gene locus_tag LOCUS_44080 gene glyQ 5049108 5050091 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_44080 5050091 5052181 gene locus_tag LOCUS_44090 gene glyS 5050091 5052181 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_44090 5052239 5052781 gene locus_tag LOCUS_44100 gene gmhB 5052239 5052781 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 protein_id gnl|my_center|LOCUS_44100 5052938 5053582 gene locus_tag LOCUS_44110 5052938 5053582 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_44110 5054292 5053714 gene locus_tag LOCUS_44120 gene lpcA 5054292 5053714 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167499.1 protein_id gnl|my_center|LOCUS_44120 5056722 5054308 gene locus_tag LOCUS_44130 gene gyrB 5056722 5054308 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 protein_id gnl|my_center|LOCUS_44130 5057902 5056715 gene locus_tag LOCUS_44140 gene recF 5057902 5056715 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 protein_id gnl|my_center|LOCUS_44140 5059081 5057978 gene locus_tag LOCUS_44150 gene dnaN 5059081 5057978 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_44150 5060936 5059200 gene locus_tag LOCUS_44160 gene dnaA 5060936 5059200 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 protein_id gnl|my_center|LOCUS_44160 5061813 5061947 gene locus_tag LOCUS_44170 gene rpmH 5061813 5061947 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551315.1 protein_id gnl|my_center|LOCUS_44170 5061969 5062382 gene locus_tag LOCUS_44180 gene rnpA 5061969 5062382 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070422.1 protein_id gnl|my_center|LOCUS_44180 5062859 5064550 gene locus_tag LOCUS_44190 gene yidC 5062859 5064550 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_44190 5064668 5066044 gene locus_tag LOCUS_44200 gene mnmE 5064668 5066044 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416772.1 protein_id gnl|my_center|LOCUS_44200 5066764 5066063 gene locus_tag LOCUS_44210 5066764 5066063 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 protein_id gnl|my_center|LOCUS_44210 5067851 5068372 gene locus_tag LOCUS_44220 5067851 5068372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 5068678 5070558 gene locus_tag LOCUS_44230 gene mnmG 5068678 5070558 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_44230 5070767 5071642 gene locus_tag LOCUS_44240 5070767 5071642 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_44240 5072559 5071639 gene locus_tag LOCUS_44250 5072559 5071639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 5073236 5072775 gene locus_tag LOCUS_44260 5073236 5072775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 5073922 5073341 gene locus_tag LOCUS_44270 5073922 5073341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 5074130 5074768 gene locus_tag LOCUS_44280 gene rsmG 5074130 5074768 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_44280 5074793 5075590 gene locus_tag LOCUS_44290 gene soj 5074793 5075590 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_44290 5075590 5076534 gene locus_tag LOCUS_44300 5075590 5076534 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_44300 5077331 5076582 gene locus_tag LOCUS_44310 5077331 5076582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 5077486 5077836 gene locus_tag LOCUS_44320 5077486 5077836 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091271.1 protein_id gnl|my_center|LOCUS_44320 5077969 5079954 gene locus_tag LOCUS_44330 gene cpdB 5077969 5079954 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178336.1 protein_id gnl|my_center|LOCUS_44330 5080568 5081506 gene locus_tag LOCUS_44340 5080568 5081506 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_44340 5081942 5082358 gene locus_tag LOCUS_44350 5081942 5082358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 5082395 5083261 gene locus_tag LOCUS_44360 gene atpB 5082395 5083261 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 protein_id gnl|my_center|LOCUS_44360 5083354 5083608 gene locus_tag LOCUS_44370 gene atpE 5083354 5083608 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097235.1 protein_id gnl|my_center|LOCUS_44370 5083806 5084276 gene locus_tag LOCUS_44380 gene atpF 5083806 5084276 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099406.1 protein_id gnl|my_center|LOCUS_44380 5084289 5084822 gene locus_tag LOCUS_44390 5084289 5084822 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_44390 5084921 5086477 gene locus_tag LOCUS_44400 gene atpA 5084921 5086477 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_44400 5086531 5087391 gene locus_tag LOCUS_44410 gene atpG 5086531 5087391 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_44410 5087448 5088824 gene locus_tag LOCUS_44420 gene atpD 5087448 5088824 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_44420 5088894 5089319 gene locus_tag LOCUS_44430 5088894 5089319 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_44430 5090662 5090528 gene locus_tag LOCUS_44440 5090662 5090528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 5091057 5092621 gene locus_tag LOCUS_r00170 5091057 5092621 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5093031 5095935 gene locus_tag LOCUS_r00180 5093031 5095935 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5096181 5096291 gene locus_tag LOCUS_r00190 5096181 5096291 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5096746 5096558 gene locus_tag LOCUS_44450 5096746 5096558 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406898.1 protein_id gnl|my_center|LOCUS_44450 5097273 5096938 gene locus_tag LOCUS_44460 5097273 5096938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 5097441 5099005 gene locus_tag LOCUS_r00200 5097441 5099005 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5099168 5099244 gene locus_tag LOCUS_t00820 5099168 5099244 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5099285 5099360 gene locus_tag LOCUS_t00830 5099285 5099360 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5099739 5102643 gene locus_tag LOCUS_r00210 5099739 5102643 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5102885 5102995 gene locus_tag LOCUS_r00220 5102885 5102995 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5103304 5104284 gene locus_tag LOCUS_44470 5103304 5104284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 5104660 5104316 gene locus_tag LOCUS_44480 5104660 5104316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 5105418 5104837 gene locus_tag LOCUS_44490 5105418 5104837 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_44490 5106009 5105458 gene locus_tag LOCUS_44500 5106009 5105458 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172055.1 protein_id gnl|my_center|LOCUS_44500 5106349 5107173 gene locus_tag LOCUS_44510 5106349 5107173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 5107418 5108641 gene locus_tag LOCUS_44520 5107418 5108641 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_44520 5108687 5109250 gene locus_tag LOCUS_44530 5108687 5109250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 5109333 5110247 gene locus_tag LOCUS_44540 5109333 5110247 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_44540 5110240 5111070 gene locus_tag LOCUS_44550 5110240 5111070 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_44550 5111181 5112308 gene locus_tag LOCUS_44560 gene ugpC 5111181 5112308 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 protein_id gnl|my_center|LOCUS_44560 5112331 5113224 gene locus_tag LOCUS_44570 5112331 5113224 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_44570 5114561 5113455 gene locus_tag LOCUS_44580 5114561 5113455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 5114705 5115412 gene locus_tag LOCUS_44590 5114705 5115412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 5117221 5115416 gene locus_tag LOCUS_44600 5117221 5115416 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 protein_id gnl|my_center|LOCUS_44600 5117504 5117232 gene locus_tag LOCUS_44610 5117504 5117232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 5117656 5119056 gene locus_tag LOCUS_44620 5117656 5119056 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_44620 5121421 5119433 gene locus_tag LOCUS_44630 5121421 5119433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 5121420 5122643 gene locus_tag LOCUS_44640 5121420 5122643 CDS product ISL3-like element ISDvu5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939300.1 protein_id gnl|my_center|LOCUS_44640 5126348 5122626 gene locus_tag LOCUS_44650 5126348 5122626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 5127105 5126533 gene locus_tag LOCUS_44660 5127105 5126533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 5127520 5128848 gene locus_tag LOCUS_44670 5127520 5128848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 5130476 5129409 gene locus_tag LOCUS_44680 5130476 5129409 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_44680 5130710 5131363 gene locus_tag LOCUS_44690 5130710 5131363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 5131640 5131565 gene locus_tag LOCUS_t00840 5131640 5131565 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5131764 5131689 gene locus_tag LOCUS_t00850 5131764 5131689 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5132195 5131977 gene locus_tag LOCUS_44700 5132195 5131977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 5132643 5132371 gene locus_tag LOCUS_44710 5132643 5132371 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_44710 5134164 5132704 gene locus_tag LOCUS_44720 5134164 5132704 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118044.1 protein_id gnl|my_center|LOCUS_44720 5135543 5134176 gene locus_tag LOCUS_44730 5135543 5134176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 5136716 5135631 gene locus_tag LOCUS_44740 gene mutY 5136716 5135631 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_44740 5137078 5137932 gene locus_tag LOCUS_44750 5137078 5137932 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479095.1 protein_id gnl|my_center|LOCUS_44750 5138704 5137904 gene locus_tag LOCUS_44760 5138704 5137904 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_44760 5139668 5138697 gene locus_tag LOCUS_44770 5139668 5138697 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_44770 5140938 5139652 gene locus_tag LOCUS_44780 5140938 5139652 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_44780 5141314 5141754 gene locus_tag LOCUS_44790 5141314 5141754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 5142038 5142712 gene locus_tag LOCUS_44800 5142038 5142712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 5143107 5143529 gene locus_tag LOCUS_44810 5143107 5143529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 5143767 5143567 gene locus_tag LOCUS_44820 5143767 5143567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 5143693 5143884 gene locus_tag LOCUS_44830 5143693 5143884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 5144383 5144814 gene locus_tag LOCUS_44840 5144383 5144814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 5146000 5144852 gene locus_tag LOCUS_44850 gene pilU 5146000 5144852 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_44850 5146421 5146212 gene locus_tag LOCUS_44860 5146421 5146212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 5148986 5146926 gene locus_tag LOCUS_44870 5148986 5146926 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_44870 5150932 5149100 gene locus_tag LOCUS_44880 5150932 5149100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 5151167 5151955 gene locus_tag LOCUS_44890 5151167 5151955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020345.1 protein_id gnl|my_center|LOCUS_44890 5152157 5152750 gene locus_tag LOCUS_44900 gene hisB 5152157 5152750 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_44900 5152754 5153398 gene locus_tag LOCUS_44910 gene hisH 5152754 5153398 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318304.1 protein_id gnl|my_center|LOCUS_44910 5153416 5153802 gene locus_tag LOCUS_44920 5153416 5153802 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_44920 5153819 5154592 gene locus_tag LOCUS_44930 gene hisF 5153819 5154592 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_44930 5155387 5154650 gene locus_tag LOCUS_44940 gene nfsA 5155387 5154650 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704853.1 protein_id gnl|my_center|LOCUS_44940 5156679 5155384 gene locus_tag LOCUS_44950 5156679 5155384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 5156868 5158094 gene locus_tag LOCUS_44960 gene serB 5156868 5158094 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_44960 5158447 5159667 gene locus_tag LOCUS_44970 5158447 5159667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 5160183 5161538 gene locus_tag LOCUS_44980 5160183 5161538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 5163556 5161889 gene locus_tag LOCUS_44990 5163556 5161889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105244.1 protein_id gnl|my_center|LOCUS_44990 5164700 5163732 gene locus_tag LOCUS_45000 gene epmB 5164700 5163732 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 protein_id gnl|my_center|LOCUS_45000 5164842 5165366 gene locus_tag LOCUS_45010 gene efp 5164842 5165366 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_45010 5165797 5165600 gene locus_tag LOCUS_45020 5165797 5165600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 5166146 5167135 gene locus_tag LOCUS_45030 gene epmA 5166146 5167135 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770152.1 protein_id gnl|my_center|LOCUS_45030 5167803 5169352 gene locus_tag LOCUS_r00230 5167803 5169352 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5169752 5172656 gene locus_tag LOCUS_r00240 5169752 5172656 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5172910 5173020 gene locus_tag LOCUS_r00250 5172910 5173020 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5173248 5174492 gene locus_tag LOCUS_45040 5173248 5174492 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016940.1 protein_id gnl|my_center|LOCUS_45040 5174650 5175576 gene locus_tag LOCUS_45050 5174650 5175576 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930857.1 protein_id gnl|my_center|LOCUS_45050 5175636 5176553 gene locus_tag LOCUS_45060 gene ylqF 5175636 5176553 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706595.1 protein_id gnl|my_center|LOCUS_45060 5176675 5179113 gene locus_tag LOCUS_45070 5176675 5179113 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_45070 5179319 5179116 gene locus_tag LOCUS_45080 5179319 5179116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 5179420 5180289 gene locus_tag LOCUS_45090 5179420 5180289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 5181706 5180471 gene locus_tag LOCUS_45100 gene ispG 5181706 5180471 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004339423.1 protein_id gnl|my_center|LOCUS_45100 5181885 5182172 gene locus_tag LOCUS_45110 gene trpR 5181885 5182172 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497218.1 protein_id gnl|my_center|LOCUS_45110 5182169 5183428 gene locus_tag LOCUS_45120 gene mtr 5182169 5183428 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815997.1 protein_id gnl|my_center|LOCUS_45120 5183539 5183721 gene locus_tag LOCUS_45130 5183539 5183721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 5183760 5184683 gene locus_tag LOCUS_45140 5183760 5184683 CDS product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566310.1 protein_id gnl|my_center|LOCUS_45140 5184766 5186091 gene locus_tag LOCUS_45150 5184766 5186091 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_45150 5186214 5189036 gene locus_tag LOCUS_45160 gene yejO 5186214 5189036 CDS product autotransporter YejO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554210.1 protein_id gnl|my_center|LOCUS_45160 5189537 5189055 gene locus_tag LOCUS_45170 5189537 5189055 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_45170 5189688 5190002 gene locus_tag LOCUS_45180 5189688 5190002 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237140.1 protein_id gnl|my_center|LOCUS_45180 5190515 5190087 gene locus_tag LOCUS_45190 gene hslR 5190515 5190087 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 protein_id gnl|my_center|LOCUS_45190 5191192 5190512 gene locus_tag LOCUS_45200 gene yrfG 5191192 5190512 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_45200 5191308 5191889 gene locus_tag LOCUS_45210 gene nudE 5191308 5191889 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_45210 5191923 5192765 gene locus_tag LOCUS_45220 gene cysQ 5191923 5192765 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_45220 5192873 5193304 gene locus_tag LOCUS_45230 gene tnpA 5192873 5193304 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_45230 5193849 5193448 gene locus_tag LOCUS_45240 5193849 5193448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 5194097 5194723 gene locus_tag LOCUS_45250 5194097 5194723 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_45250 5194794 5195441 gene locus_tag LOCUS_45260 5194794 5195441 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195399.1 protein_id gnl|my_center|LOCUS_45260 5196594 5195488 gene locus_tag LOCUS_45270 5196594 5195488 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262909.1 protein_id gnl|my_center|LOCUS_45270 5196905 5197510 gene locus_tag LOCUS_45280 gene pagL 5196905 5197510 CDS product lipid A 3-O-deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099307.1 protein_id gnl|my_center|LOCUS_45280 5197613 5198065 gene locus_tag LOCUS_45290 5197613 5198065 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481879.1 protein_id gnl|my_center|LOCUS_45290 5198179 5198721 gene locus_tag LOCUS_45300 5198179 5198721 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191124.1 protein_id gnl|my_center|LOCUS_45300 5198968 5200077 gene locus_tag LOCUS_45310 gene alr 5198968 5200077 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769528.1 protein_id gnl|my_center|LOCUS_45310 5200322 5200840 gene locus_tag LOCUS_45320 gene dadR 5200322 5200840 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_45320 5201260 5200850 gene locus_tag LOCUS_45330 5201260 5200850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 5201536 5202645 gene locus_tag LOCUS_45340 5201536 5202645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 5202842 5203888 gene locus_tag LOCUS_45350 5202842 5203888 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_45350 5203938 5205023 gene locus_tag LOCUS_45360 gene pdhA 5203938 5205023 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_45360 5205016 5205996 gene locus_tag LOCUS_45370 5205016 5205996 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706667.1 protein_id gnl|my_center|LOCUS_45370 5206066 5207124 gene locus_tag LOCUS_45380 5206066 5207124 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 protein_id gnl|my_center|LOCUS_45380 5207640 5209562 gene locus_tag LOCUS_45390 5207640 5209562 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_45390 5209642 5210919 gene locus_tag LOCUS_45400 5209642 5210919 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269137.1 protein_id gnl|my_center|LOCUS_45400 5210916 5212475 gene locus_tag LOCUS_45410 5210916 5212475 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 protein_id gnl|my_center|LOCUS_45410 5212849 5213265 gene locus_tag LOCUS_45420 5212849 5213265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 5214661 5213345 gene locus_tag LOCUS_45430 gene phoR 5214661 5213345 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_45430 5215384 5214695 gene locus_tag LOCUS_45440 gene phoB 5215384 5214695 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_45440 5216429 5215521 gene locus_tag LOCUS_45450 gene ubiA 5216429 5215521 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401244.1 protein_id gnl|my_center|LOCUS_45450 5217056 5216496 gene locus_tag LOCUS_45460 5217056 5216496 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 protein_id gnl|my_center|LOCUS_45460 5218537 5217188 gene locus_tag LOCUS_45470 5218537 5217188 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 protein_id gnl|my_center|LOCUS_45470 5218727 5218894 gene locus_tag LOCUS_45480 5218727 5218894 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098330.1 protein_id gnl|my_center|LOCUS_45480 5219028 5219303 gene locus_tag LOCUS_45490 5219028 5219303 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 protein_id gnl|my_center|LOCUS_45490 5220421 5219375 gene locus_tag LOCUS_45500 5220421 5219375 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704683.1 protein_id gnl|my_center|LOCUS_45500 5220588 5220674 gene locus_tag LOCUS_t00860 5220588 5220674 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5220732 5220818 gene locus_tag LOCUS_t00870 5220732 5220818 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5221196 5221271 gene locus_tag LOCUS_t00880 5221196 5221271 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5221649 5221419 gene locus_tag LOCUS_45510 5221649 5221419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 5221805 5222122 gene locus_tag LOCUS_45520 5221805 5222122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 5222655 5222119 gene locus_tag LOCUS_45530 5222655 5222119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 5223163 5223771 gene locus_tag LOCUS_45540 5223163 5223771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 5223768 5223974 gene locus_tag LOCUS_45550 5223768 5223974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 5224177 5223971 gene locus_tag LOCUS_45560 5224177 5223971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 5231005 5224235 gene locus_tag LOCUS_45570 5231005 5224235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 5232093 5230990 gene locus_tag LOCUS_45580 5232093 5230990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 5232653 5232093 gene locus_tag LOCUS_45590 5232653 5232093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5233077 5232628 gene locus_tag LOCUS_45600 5233077 5232628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5233588 5233079 gene locus_tag LOCUS_45610 5233588 5233079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 5234346 5235707 gene locus_tag LOCUS_45620 5234346 5235707 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_45620 5236147 5235737 gene locus_tag LOCUS_45630 5236147 5235737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 5237529 5236150 gene locus_tag LOCUS_45640 5237529 5236150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 5237900 5237529 gene locus_tag LOCUS_45650 5237900 5237529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 5239348 5237906 gene locus_tag LOCUS_45660 5239348 5237906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 5240359 5239373 gene locus_tag LOCUS_45670 5240359 5239373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 5241198 5240356 gene locus_tag LOCUS_45680 5241198 5240356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 5242283 5241282 gene locus_tag LOCUS_45690 5242283 5241282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5243332 5242289 gene locus_tag LOCUS_45700 5243332 5242289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 5245259 5243421 gene locus_tag LOCUS_45710 5245259 5243421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 5245555 5245256 gene locus_tag LOCUS_45720 5245555 5245256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 5246049 5245570 gene locus_tag LOCUS_45730 5246049 5245570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 5246627 5246046 gene locus_tag LOCUS_45740 5246627 5246046 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792031.1 protein_id gnl|my_center|LOCUS_45740 5248408 5246624 gene locus_tag LOCUS_45750 5248408 5246624 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_45750 5248917 5248408 gene locus_tag LOCUS_45760 5248917 5248408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 5250249 5249692 gene locus_tag LOCUS_45770 5250249 5249692 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262493.1 protein_id gnl|my_center|LOCUS_45770 5250460 5250242 gene locus_tag LOCUS_45780 5250460 5250242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 5251400 5250489 gene locus_tag LOCUS_45790 5251400 5250489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 5254643 5251425 gene locus_tag LOCUS_45800 5254643 5251425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 5254876 5254640 gene locus_tag LOCUS_45810 5254876 5254640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 5254869 5255333 gene locus_tag LOCUS_45820 5254869 5255333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 5255507 5255863 gene locus_tag LOCUS_45830 5255507 5255863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 5255863 5257035 gene locus_tag LOCUS_45840 5255863 5257035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 5256954 5257487 gene locus_tag LOCUS_45850 5256954 5257487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 5257720 5257926 gene locus_tag LOCUS_45860 5257720 5257926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 5257939 5258493 gene locus_tag LOCUS_45870 5257939 5258493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 5258507 5258779 gene locus_tag LOCUS_45880 5258507 5258779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 5258772 5259017 gene locus_tag LOCUS_45890 5258772 5259017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 5259021 5259299 gene locus_tag LOCUS_45900 5259021 5259299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 5259289 5259690 gene locus_tag LOCUS_45910 5259289 5259690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 5259692 5259931 gene locus_tag LOCUS_45920 5259692 5259931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 5260113 5260430 gene locus_tag LOCUS_45930 5260113 5260430 CDS product Gp49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131231.1 protein_id gnl|my_center|LOCUS_45930 5261412 5264423 gene locus_tag LOCUS_45940 5261412 5264423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064932.1 protein_id gnl|my_center|LOCUS_45940 5264668 5265891 gene locus_tag LOCUS_45950 5264668 5265891 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_45950 5265937 5266743 gene locus_tag LOCUS_45960 5265937 5266743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5266807 5269113 gene locus_tag LOCUS_45970 5266807 5269113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 5269130 5269375 gene locus_tag LOCUS_45980 5269130 5269375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 5270555 5269353 gene locus_tag LOCUS_45990 5270555 5269353 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_45990 5270824 5271177 gene locus_tag LOCUS_46000 5270824 5271177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 5271288 5271692 gene locus_tag LOCUS_46010 5271288 5271692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 5272084 5272320 gene locus_tag LOCUS_46020 5272084 5272320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 5273234 5272326 gene locus_tag LOCUS_46030 gene arcC 5273234 5272326 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707754.1 protein_id gnl|my_center|LOCUS_46030 5274375 5273329 gene locus_tag LOCUS_46040 gene ptcA 5274375 5273329 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166873.1 protein_id gnl|my_center|LOCUS_46040 5274918 5276285 gene locus_tag LOCUS_46050 5274918 5276285 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 protein_id gnl|my_center|LOCUS_46050 5276315 5277406 gene locus_tag LOCUS_46060 gene aguA 5276315 5277406 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166871.1 protein_id gnl|my_center|LOCUS_46060 5277479 5278870 gene locus_tag LOCUS_46070 5277479 5278870 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 protein_id gnl|my_center|LOCUS_46070 5278851 5279552 gene locus_tag LOCUS_46080 5278851 5279552 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024642508.1 protein_id gnl|my_center|LOCUS_46080 5279596 5280255 gene locus_tag LOCUS_46090 5279596 5280255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_46090 5280742 5281083 gene locus_tag LOCUS_46100 5280742 5281083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 5281080 5281439 gene locus_tag LOCUS_46110 gene tnpB 5281080 5281439 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_46110 5281496 5283049 gene locus_tag LOCUS_46120 5281496 5283049 CDS product IS66-like element ISPsy5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 protein_id gnl|my_center|LOCUS_46120 5285798 5283186 gene locus_tag LOCUS_46130 gene pglZ 5285798 5283186 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_46130 5286802 5285954 gene locus_tag LOCUS_46140 5286802 5285954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 5287851 5286799 gene locus_tag LOCUS_46150 5287851 5286799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 5289079 5287964 gene locus_tag LOCUS_46160 5289079 5287964 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_46160 5289363 5289184 gene locus_tag LOCUS_46170 5289363 5289184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 5289811 5289569 gene locus_tag LOCUS_46180 5289811 5289569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 5290047 5289814 gene locus_tag LOCUS_46190 5290047 5289814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 5290682 5290206 gene locus_tag LOCUS_46200 5290682 5290206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 5290991 5291389 gene locus_tag LOCUS_46210 5290991 5291389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 5291957 5291358 gene locus_tag LOCUS_46220 5291957 5291358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 5292646 5292933 gene locus_tag LOCUS_46230 5292646 5292933 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_46230 5292930 5293154 gene locus_tag LOCUS_46240 5292930 5293154 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_46240 5293604 5293353 gene locus_tag LOCUS_46250 5293604 5293353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 5295247 5293610 gene locus_tag LOCUS_46260 5295247 5293610 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_46260 5295317 5295730 gene locus_tag LOCUS_46270 5295317 5295730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 5299007 5295744 gene locus_tag LOCUS_46280 5299007 5295744 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_46280 5299165 5300232 gene locus_tag LOCUS_46290 5299165 5300232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 5300309 5302894 gene locus_tag LOCUS_46300 5300309 5302894 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266519.1 protein_id gnl|my_center|LOCUS_46300 5302937 5304574 gene locus_tag LOCUS_46310 5302937 5304574 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_46310 5305647 5304682 gene locus_tag LOCUS_46320 5305647 5304682 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298261.1 protein_id gnl|my_center|LOCUS_46320 5306761 5305760 gene locus_tag LOCUS_46330 gene pdxA 5306761 5305760 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_46330 5306867 5307031 gene locus_tag LOCUS_46340 5306867 5307031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 5307838 5307080 gene locus_tag LOCUS_46350 5307838 5307080 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047750.1 protein_id gnl|my_center|LOCUS_46350 5308360 5308866 gene locus_tag LOCUS_46360 5308360 5308866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 5308847 5309482 gene locus_tag LOCUS_46370 5308847 5309482 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_46370 5309479 5311803 gene locus_tag LOCUS_46380 5309479 5311803 CDS product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 protein_id gnl|my_center|LOCUS_46380 5312199 5311813 gene locus_tag LOCUS_46390 5312199 5311813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 5312565 5312801 gene locus_tag LOCUS_46400 5312565 5312801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 5313558 5314940 gene locus_tag LOCUS_46410 5313558 5314940 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_46410 5315109 5315501 gene locus_tag LOCUS_46420 5315109 5315501 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_46420 5315502 5316560 gene locus_tag LOCUS_46430 5315502 5316560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_46430 5318262 5316649 gene locus_tag LOCUS_46440 5318262 5316649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 5319069 5318302 gene locus_tag LOCUS_46450 5319069 5318302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 5320954 5319176 gene locus_tag LOCUS_46460 5320954 5319176 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262518.1 protein_id gnl|my_center|LOCUS_46460 5321796 5320963 gene locus_tag LOCUS_46470 5321796 5320963 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_46470 5323085 5321799 gene locus_tag LOCUS_46480 5323085 5321799 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804062.1 protein_id gnl|my_center|LOCUS_46480 5324474 5323248 gene locus_tag LOCUS_46490 5324474 5323248 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_46490 5324968 5326122 gene locus_tag LOCUS_46500 5324968 5326122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 5326137 5327162 gene locus_tag LOCUS_46510 gene lpxD 5326137 5327162 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583184.1 protein_id gnl|my_center|LOCUS_46510 5327238 5327723 gene locus_tag LOCUS_46520 5327238 5327723 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458394.1 protein_id gnl|my_center|LOCUS_46520 5327809 5328930 gene locus_tag LOCUS_46530 gene ugpC 5327809 5328930 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 protein_id gnl|my_center|LOCUS_46530 5329117 5329317 gene locus_tag LOCUS_46540 5329117 5329317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 5330446 5329811 gene locus_tag LOCUS_46550 5330446 5329811 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_46550 5330475 5331167 gene locus_tag LOCUS_46560 5330475 5331167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_46560 5331164 5333653 gene locus_tag LOCUS_46570 5331164 5333653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_46570 5333937 5334281 gene locus_tag LOCUS_46580 5333937 5334281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 5334863 5334441 gene locus_tag LOCUS_46590 5334863 5334441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 5335122 5335451 gene locus_tag LOCUS_46600 5335122 5335451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 5338011 5335462 gene locus_tag LOCUS_46610 5338011 5335462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 5338560 5338153 gene locus_tag LOCUS_46620 5338560 5338153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 5338697 5339356 gene locus_tag LOCUS_46630 5338697 5339356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 5339373 5340248 gene locus_tag LOCUS_46640 5339373 5340248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 5341031 5340228 gene locus_tag LOCUS_46650 5341031 5340228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5341395 5341042 gene locus_tag LOCUS_46660 5341395 5341042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 5341604 5342122 gene locus_tag LOCUS_46670 5341604 5342122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 5342175 5343368 gene locus_tag LOCUS_46680 5342175 5343368 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_46680 5345122 5343485 gene locus_tag LOCUS_46690 5345122 5343485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 5345274 5345122 gene locus_tag LOCUS_46700 5345274 5345122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 5345522 5346865 gene locus_tag LOCUS_46710 5345522 5346865 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939479.1 protein_id gnl|my_center|LOCUS_46710 5347508 5346852 gene locus_tag LOCUS_46720 5347508 5346852 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_46720 5347810 5348301 gene locus_tag LOCUS_46730 5347810 5348301 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_46730 5348441 5350717 gene locus_tag LOCUS_46740 gene ptsP 5348441 5350717 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_46740 5351308 5350892 gene locus_tag LOCUS_46750 5351308 5350892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 5351408 5352643 gene locus_tag LOCUS_46760 5351408 5352643 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_46760 5353481 5352717 gene locus_tag LOCUS_46770 5353481 5352717 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_46770 5353564 5354358 gene locus_tag LOCUS_46780 5353564 5354358 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 protein_id gnl|my_center|LOCUS_46780 5356640 5354430 gene locus_tag LOCUS_46790 gene ppk1 5356640 5354430 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_46790 5357770 5356772 gene locus_tag LOCUS_46800 gene hemB 5357770 5356772 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_46800 5357897 5360017 gene locus_tag LOCUS_46810 5357897 5360017 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_46810 5360144 5361202 gene locus_tag LOCUS_46820 5360144 5361202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 5361277 5361630 gene locus_tag LOCUS_46830 5361277 5361630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 5363018 5361645 gene locus_tag LOCUS_46840 gene cbrB 5363018 5361645 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_46840 5366128 5363015 gene locus_tag LOCUS_46850 gene cbrA 5366128 5363015 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_46850 5367065 5366403 gene locus_tag LOCUS_46860 5367065 5366403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 5368894 5368127 gene locus_tag LOCUS_46870 gene gluQRS 5368894 5368127 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_46870 5369096 5368929 gene locus_tag LOCUS_46880 5369096 5368929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 5369601 5369158 gene locus_tag LOCUS_46890 gene dksA 5369601 5369158 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_46890 5369990 5370688 gene locus_tag LOCUS_46900 gene sfsA 5369990 5370688 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113458.1 protein_id gnl|my_center|LOCUS_46900 5371580 5370705 gene locus_tag LOCUS_46910 5371580 5370705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 5372269 5373984 gene locus_tag LOCUS_46920 5372269 5373984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 5375170 5374397 gene locus_tag LOCUS_46930 5375170 5374397 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 protein_id gnl|my_center|LOCUS_46930 5376216 5375170 gene locus_tag LOCUS_46940 5376216 5375170 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261837.1 protein_id gnl|my_center|LOCUS_46940 5377113 5376256 gene locus_tag LOCUS_46950 5377113 5376256 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479207.1 protein_id gnl|my_center|LOCUS_46950 5377538 5377116 gene locus_tag LOCUS_46960 5377538 5377116 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 protein_id gnl|my_center|LOCUS_46960 5378221 5377535 gene locus_tag LOCUS_46970 5378221 5377535 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445085.1 protein_id gnl|my_center|LOCUS_46970 5378964 5378236 gene locus_tag LOCUS_46980 5378964 5378236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 5379390 5380937 gene locus_tag LOCUS_46990 gene hutW 5379390 5380937 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261842.1 protein_id gnl|my_center|LOCUS_46990 5380955 5381452 gene locus_tag LOCUS_47000 gene hutX 5380955 5381452 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 protein_id gnl|my_center|LOCUS_47000 5381521 5382336 gene locus_tag LOCUS_47010 5381521 5382336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926809.1 protein_id gnl|my_center|LOCUS_47010 5382353 5382730 gene locus_tag LOCUS_47020 5382353 5382730 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072095.1 protein_id gnl|my_center|LOCUS_47020 5382860 5383987 gene locus_tag LOCUS_47030 5382860 5383987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185264.1 protein_id gnl|my_center|LOCUS_47030 5385325 5384135 gene locus_tag LOCUS_47040 5385325 5384135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 5386944 5385322 gene locus_tag LOCUS_47050 5386944 5385322 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_47050 5387374 5387907 gene locus_tag LOCUS_47060 5387374 5387907 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_47060 5388004 5389239 gene locus_tag LOCUS_47070 5388004 5389239 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_47070 5392804 5389397 gene locus_tag LOCUS_47080 5392804 5389397 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_47080 5393301 5394371 gene locus_tag LOCUS_47090 5393301 5394371 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_47090 5394611 5394438 gene locus_tag LOCUS_47100 5394611 5394438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 5394719 5395027 gene locus_tag LOCUS_47110 5394719 5395027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 5396372 5395110 gene locus_tag LOCUS_47120 gene ltrA 5396372 5395110 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_47120 5397521 5397069 gene locus_tag LOCUS_47130 5397521 5397069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47130 5397856 5397548 gene locus_tag LOCUS_47140 5397856 5397548 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246904.1 protein_id gnl|my_center|LOCUS_47140 5398311 5398030 gene locus_tag LOCUS_47150 5398311 5398030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 5398859 5398233 gene locus_tag LOCUS_47160 5398859 5398233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 5399515 5400777 gene locus_tag LOCUS_47170 gene ltrA 5399515 5400777 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_47170 5401203 5400871 gene locus_tag LOCUS_47180 5401203 5400871 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_47180 5401484 5401200 gene locus_tag LOCUS_47190 5401484 5401200 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_47190 5401846 5403207 gene locus_tag LOCUS_47200 5401846 5403207 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480579.1 protein_id gnl|my_center|LOCUS_47200 5403780 5404391 gene locus_tag LOCUS_47210 5403780 5404391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 5405154 5404489 gene locus_tag LOCUS_47220 5405154 5404489 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_47220 5405657 5405241 gene locus_tag LOCUS_47230 5405657 5405241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 5406039 5405650 gene locus_tag LOCUS_47240 5406039 5405650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5407625 5406036 gene locus_tag LOCUS_47250 5407625 5406036 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922361.1 protein_id gnl|my_center|LOCUS_47250 5408490 5407618 gene locus_tag LOCUS_47260 5408490 5407618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 5408713 5408477 gene locus_tag LOCUS_47270 5408713 5408477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 5408997 5408710 gene locus_tag LOCUS_47280 5408997 5408710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5410015 5409137 gene locus_tag LOCUS_47290 5410015 5409137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 5413565 5410296 gene locus_tag LOCUS_47300 5413565 5410296 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_47300 5414785 5413562 gene locus_tag LOCUS_47310 5414785 5413562 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123229.1 protein_id gnl|my_center|LOCUS_47310 5417007 5414782 gene locus_tag LOCUS_47320 5417007 5414782 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_47320 5417360 5417524 gene locus_tag LOCUS_47330 5417360 5417524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 5417511 5418275 gene locus_tag LOCUS_47340 5417511 5418275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 5418452 5418913 gene locus_tag LOCUS_47350 5418452 5418913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 5419111 5420148 gene locus_tag LOCUS_47360 5419111 5420148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 5420319 5420167 gene locus_tag LOCUS_47370 5420319 5420167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202284.1 protein_id gnl|my_center|LOCUS_47370 5420516 5420361 gene locus_tag LOCUS_47380 5420516 5420361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 5421000 5420924 gene locus_tag LOCUS_t00890 5421000 5420924 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5421163 5421831 gene locus_tag LOCUS_47390 5421163 5421831 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_47390 5421828 5423777 gene locus_tag LOCUS_47400 5421828 5423777 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946565.1 protein_id gnl|my_center|LOCUS_47400 5423845 5424942 gene locus_tag LOCUS_47410 5423845 5424942 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_47410 5424959 5425552 gene locus_tag LOCUS_47420 5424959 5425552 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_47420 5425563 5425880 gene locus_tag LOCUS_47430 5425563 5425880 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_47430 5426198 5426007 gene locus_tag LOCUS_47440 5426198 5426007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 5426159 5426929 gene locus_tag LOCUS_47450 5426159 5426929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 5427451 5429334 gene locus_tag LOCUS_47460 5427451 5429334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 5429604 5429434 gene locus_tag LOCUS_47470 5429604 5429434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 5429646 5430389 gene locus_tag LOCUS_47480 5429646 5430389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 5430572 5431615 gene locus_tag LOCUS_47490 5430572 5431615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 5431885 5431715 gene locus_tag LOCUS_47500 5431885 5431715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 5431927 5432757 gene locus_tag LOCUS_47510 5431927 5432757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 5433453 5432746 gene locus_tag LOCUS_47520 5433453 5432746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 protein_id gnl|my_center|LOCUS_47520 5435419 5433476 gene locus_tag LOCUS_47530 gene acs 5435419 5433476 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_47530 5436480 5435500 gene locus_tag LOCUS_47540 5436480 5435500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 5437684 5436692 gene locus_tag LOCUS_47550 gene add 5437684 5436692 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704281.1 protein_id gnl|my_center|LOCUS_47550 5437828 5440662 gene locus_tag LOCUS_47560 5437828 5440662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 5442395 5440752 gene locus_tag LOCUS_47570 gene pgi 5442395 5440752 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100194.1 protein_id gnl|my_center|LOCUS_47570 5443355 5442504 gene locus_tag LOCUS_47580 gene panC 5443355 5442504 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246105.1 protein_id gnl|my_center|LOCUS_47580 5444206 5443412 gene locus_tag LOCUS_47590 gene panB 5444206 5443412 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113913.1 protein_id gnl|my_center|LOCUS_47590 5444956 5444372 gene locus_tag LOCUS_47600 gene folK 5444956 5444372 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 protein_id gnl|my_center|LOCUS_47600 5446524 5444953 gene locus_tag LOCUS_47610 5446524 5444953 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_47610 5448361 5447165 gene locus_tag LOCUS_47620 5448361 5447165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 5448493 5449161 gene locus_tag LOCUS_47630 gene elbB 5448493 5449161 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099212.1 protein_id gnl|my_center|LOCUS_47630 5449717 5449217 gene locus_tag LOCUS_47640 gene ftnA 5449717 5449217 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348910.1 protein_id gnl|my_center|LOCUS_47640 5449886 5450581 gene locus_tag LOCUS_47650 5449886 5450581 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 protein_id gnl|my_center|LOCUS_47650 5451049 5452158 gene locus_tag LOCUS_47660 5451049 5452158 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070680.1 protein_id gnl|my_center|LOCUS_47660 5452532 5452248 gene locus_tag LOCUS_47670 5452532 5452248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 5452929 5452606 gene locus_tag LOCUS_47680 gene cyaY 5452929 5452606 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 protein_id gnl|my_center|LOCUS_47680 5453243 5454496 gene locus_tag LOCUS_47690 gene lysA 5453243 5454496 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_47690 5454526 5454918 gene locus_tag LOCUS_47700 5454526 5454918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 5454948 5455778 gene locus_tag LOCUS_47710 gene dapF 5454948 5455778 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 protein_id gnl|my_center|LOCUS_47710 5455775 5456506 gene locus_tag LOCUS_47720 5455775 5456506 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_47720 5456506 5457426 gene locus_tag LOCUS_47730 gene xerC 5456506 5457426 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266244.1 protein_id gnl|my_center|LOCUS_47730 5457587 5458357 gene locus_tag LOCUS_47740 gene udp 5457587 5458357 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163896.1 protein_id gnl|my_center|LOCUS_47740 5459751 5458429 gene locus_tag LOCUS_47750 5459751 5458429 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_47750 5460094 5460486 gene locus_tag LOCUS_47760 5460094 5460486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533080.1 protein_id gnl|my_center|LOCUS_47760 5461503 5460556 gene locus_tag LOCUS_47770 5461503 5460556 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063775.1 protein_id gnl|my_center|LOCUS_47770 5462383 5461643 gene locus_tag LOCUS_47780 5462383 5461643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263203.1 protein_id gnl|my_center|LOCUS_47780 5463147 5462383 gene locus_tag LOCUS_47790 5463147 5462383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482853.1 protein_id gnl|my_center|LOCUS_47790 5463980 5463147 gene locus_tag LOCUS_47800 gene thiD 5463980 5463147 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 protein_id gnl|my_center|LOCUS_47800 5464321 5466444 gene locus_tag LOCUS_47810 5464321 5466444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 5467044 5466451 gene locus_tag LOCUS_47820 5467044 5466451 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_47820 5467902 5467087 gene locus_tag LOCUS_47830 gene mutM 5467902 5467087 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_47830 5468035 5469426 gene locus_tag LOCUS_47840 gene pmpM 5468035 5469426 CDS product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 protein_id gnl|my_center|LOCUS_47840 5478392 5469543 gene locus_tag LOCUS_47850 5478392 5469543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 5478978 5479181 gene locus_tag LOCUS_47860 5478978 5479181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 5479159 5479449 gene locus_tag LOCUS_47870 5479159 5479449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 5480209 5479496 gene locus_tag LOCUS_47880 5480209 5479496 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086532.1 protein_id gnl|my_center|LOCUS_47880 5480396 5481208 gene locus_tag LOCUS_47890 5480396 5481208 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889086.1 protein_id gnl|my_center|LOCUS_47890 5481365 5482039 gene locus_tag LOCUS_47900 gene phoP 5481365 5482039 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082436.1 protein_id gnl|my_center|LOCUS_47900 5482063 5483412 gene locus_tag LOCUS_47910 gene phoQ 5482063 5483412 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082438.1 protein_id gnl|my_center|LOCUS_47910 5483532 5484542 gene locus_tag LOCUS_47920 gene trpS 5483532 5484542 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225097.1 protein_id gnl|my_center|LOCUS_47920 5486229 5484688 gene locus_tag LOCUS_47930 5486229 5484688 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476914.1 protein_id gnl|my_center|LOCUS_47930 5486436 5486735 gene locus_tag LOCUS_47940 5486436 5486735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 5486979 5487338 gene locus_tag LOCUS_47950 5486979 5487338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 5487474 5488040 gene locus_tag LOCUS_47960 5487474 5488040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 5488616 5489218 gene locus_tag LOCUS_47970 5488616 5489218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 5489276 5490229 gene locus_tag LOCUS_47980 gene tal 5489276 5490229 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 protein_id gnl|my_center|LOCUS_47980 5490710 5490285 gene locus_tag LOCUS_47990 5490710 5490285 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626096.1 protein_id gnl|my_center|LOCUS_47990 5492122 5490785 gene locus_tag LOCUS_48000 5492122 5490785 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551161.1 protein_id gnl|my_center|LOCUS_48000 5492430 5492927 gene locus_tag LOCUS_48010 5492430 5492927 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_48010 5492937 5493785 gene locus_tag LOCUS_48020 5492937 5493785 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 protein_id gnl|my_center|LOCUS_48020 5493807 5494472 gene locus_tag LOCUS_48030 5493807 5494472 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365556.1 protein_id gnl|my_center|LOCUS_48030 5495560 5494502 gene locus_tag LOCUS_48040 5495560 5494502 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124366.1 protein_id gnl|my_center|LOCUS_48040 5497219 5495636 gene locus_tag LOCUS_48050 5497219 5495636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 5497490 5498638 gene locus_tag LOCUS_48060 5497490 5498638 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704057.1 protein_id gnl|my_center|LOCUS_48060 5498679 5499668 gene locus_tag LOCUS_48070 gene birA 5498679 5499668 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_48070 5499665 5500429 gene locus_tag LOCUS_48080 5499665 5500429 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_48080 5500417 5501136 gene locus_tag LOCUS_48090 5500417 5501136 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_48090 5501281 5501364 gene locus_tag LOCUS_t00900 5501281 5501364 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5501451 5501524 gene locus_tag LOCUS_t00910 5501451 5501524 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5501569 5501644 gene locus_tag LOCUS_t00920 5501569 5501644 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5501795 5501870 gene locus_tag LOCUS_t00930 5501795 5501870 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5501949 5502320 gene locus_tag LOCUS_48100 gene secE 5501949 5502320 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768918.1 protein_id gnl|my_center|LOCUS_48100 5502331 5502864 gene locus_tag LOCUS_48110 gene nusG 5502331 5502864 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_48110 5503042 5503476 gene locus_tag LOCUS_48120 gene rplK 5503042 5503476 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_48120 5503476 5504171 gene locus_tag LOCUS_48130 gene rplA 5503476 5504171 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 protein_id gnl|my_center|LOCUS_48130 5504506 5505036 gene locus_tag LOCUS_48140 gene rplJ 5504506 5505036 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 protein_id gnl|my_center|LOCUS_48140 5505130 5505504 gene locus_tag LOCUS_48150 gene rplL 5505130 5505504 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 protein_id gnl|my_center|LOCUS_48150 5506071 5510150 gene locus_tag LOCUS_48160 gene rpoB 5506071 5510150 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_48160 5510208 5514419 gene locus_tag LOCUS_48170 gene rpoC 5510208 5514419 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_48170 5516319 5514601 gene locus_tag LOCUS_48180 5516319 5514601 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106299.1 protein_id gnl|my_center|LOCUS_48180 5517132 5516446 gene locus_tag LOCUS_48190 5517132 5516446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 5517280 5518647 gene locus_tag LOCUS_48200 5517280 5518647 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_48200 5519051 5518686 gene locus_tag LOCUS_48210 5519051 5518686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 5520181 5519171 gene locus_tag LOCUS_48220 gene glpX 5520181 5519171 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703815.1 protein_id gnl|my_center|LOCUS_48220 5520433 5523741 gene locus_tag LOCUS_48230 5520433 5523741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 5524079 5524453 gene locus_tag LOCUS_48240 gene rpsL 5524079 5524453 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_48240 5524617 5525087 gene locus_tag LOCUS_48250 gene rpsG 5524617 5525087 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400433.1 protein_id gnl|my_center|LOCUS_48250 5525106 5527208 gene locus_tag LOCUS_48260 gene fusA 5525106 5527208 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 protein_id gnl|my_center|LOCUS_48260 5527298 5528521 gene locus_tag LOCUS_48270 gene tuf 5527298 5528521 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_48270 5528923 5529237 gene locus_tag LOCUS_48280 gene rpsJ 5528923 5529237 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555491.1 protein_id gnl|my_center|LOCUS_48280 5529339 5529977 gene locus_tag LOCUS_48290 gene rplC 5529339 5529977 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 protein_id gnl|my_center|LOCUS_48290 5529989 5530591 gene locus_tag LOCUS_48300 gene rplD 5529989 5530591 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 protein_id gnl|my_center|LOCUS_48300 5530588 5530884 gene locus_tag LOCUS_48310 gene rplW 5530588 5530884 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_48310 5530896 5531723 gene locus_tag LOCUS_48320 gene rplB 5530896 5531723 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 protein_id gnl|my_center|LOCUS_48320 5531745 5532023 gene locus_tag LOCUS_48330 gene rpsS 5531745 5532023 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417232.1 protein_id gnl|my_center|LOCUS_48330 5532034 5532369 gene locus_tag LOCUS_48340 gene rplV 5532034 5532369 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103908.1 protein_id gnl|my_center|LOCUS_48340 5532381 5533079 gene locus_tag LOCUS_48350 gene rpsC 5532381 5533079 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_48350 5533091 5533504 gene locus_tag LOCUS_48360 gene rplP 5533091 5533504 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_48360 5533504 5533695 gene locus_tag LOCUS_48370 gene rpmC 5533504 5533695 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093720.1 protein_id gnl|my_center|LOCUS_48370 5533698 5533961 gene locus_tag LOCUS_48380 gene rpsQ 5533698 5533961 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_48380 5534120 5534488 gene locus_tag LOCUS_48390 gene rplN 5534120 5534488 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093714.1 protein_id gnl|my_center|LOCUS_48390 5534500 5534817 gene locus_tag LOCUS_48400 gene rplX 5534500 5534817 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 protein_id gnl|my_center|LOCUS_48400 5534831 5535370 gene locus_tag LOCUS_48410 gene rplE 5534831 5535370 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555477.1 protein_id gnl|my_center|LOCUS_48410 5535386 5535691 gene locus_tag LOCUS_48420 gene rpsN 5535386 5535691 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_48420 5535721 5536113 gene locus_tag LOCUS_48430 gene rpsH 5535721 5536113 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_48430 5536126 5536659 gene locus_tag LOCUS_48440 gene rplF 5536126 5536659 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768939.1 protein_id gnl|my_center|LOCUS_48440 5536674 5537024 gene locus_tag LOCUS_48450 gene rplR 5536674 5537024 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093698.1 protein_id gnl|my_center|LOCUS_48450 5537036 5537551 gene locus_tag LOCUS_48460 gene rpsE 5537036 5537551 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_48460 5537555 5537740 gene locus_tag LOCUS_48470 gene rpmD 5537555 5537740 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_48470 5537742 5538176 gene locus_tag LOCUS_48480 gene rplO 5537742 5538176 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_48480 5538177 5539502 gene locus_tag LOCUS_48490 gene secY 5538177 5539502 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093694.1 protein_id gnl|my_center|LOCUS_48490 5540045 5540401 gene locus_tag LOCUS_48500 gene rpsM 5540045 5540401 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_48500 5540454 5540843 gene locus_tag LOCUS_48510 gene rpsK 5540454 5540843 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_48510 5540860 5541480 gene locus_tag LOCUS_48520 gene rpsD 5540860 5541480 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_48520 5541512 5542513 gene locus_tag LOCUS_48530 gene rpoA 5541512 5542513 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_48530 5542626 5543015 gene locus_tag LOCUS_48540 gene rplQ 5542626 5543015 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_48540 5543387 5543145 gene locus_tag LOCUS_48550 5543387 5543145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 5543972 5544265 gene locus_tag LOCUS_48560 5543972 5544265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 5544719 5545288 gene locus_tag LOCUS_48570 5544719 5545288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 5545348 5545947 gene locus_tag LOCUS_48580 5545348 5545947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 5546127 5547128 gene locus_tag LOCUS_48590 5546127 5547128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 5547176 5549668 gene locus_tag LOCUS_48600 5547176 5549668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5549699 5550430 gene locus_tag LOCUS_48610 5549699 5550430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 5550470 5550748 gene locus_tag LOCUS_48620 5550470 5550748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 5550834 5551841 gene locus_tag LOCUS_48630 5550834 5551841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 5552145 5551897 gene locus_tag LOCUS_48640 5552145 5551897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 5553858 5552368 gene locus_tag LOCUS_48650 gene ntrC 5553858 5552368 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_48650 5554916 5553870 gene locus_tag LOCUS_48660 gene ntrB 5554916 5553870 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_48660 5555206 5555391 gene locus_tag LOCUS_48670 5555206 5555391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 5557231 5555828 gene locus_tag LOCUS_48680 gene glnA 5557231 5555828 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 protein_id gnl|my_center|LOCUS_48680 5557877 5559358 gene locus_tag LOCUS_48690 gene thiI 5557877 5559358 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071709.1 protein_id gnl|my_center|LOCUS_48690 5559488 5559997 gene locus_tag LOCUS_48700 5559488 5559997 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244533.1 protein_id gnl|my_center|LOCUS_48700 5560229 5562574 gene locus_tag LOCUS_48710 5560229 5562574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 5562854 5562558 gene locus_tag LOCUS_48720 5562854 5562558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 5562916 5564166 gene locus_tag LOCUS_48730 5562916 5564166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 5565524 5564202 gene locus_tag LOCUS_48740 gene argA 5565524 5564202 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237951.1 protein_id gnl|my_center|LOCUS_48740 5566735 5565572 gene locus_tag LOCUS_48750 gene argE 5566735 5565572 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763453.1 protein_id gnl|my_center|LOCUS_48750 5568195 5566894 gene locus_tag LOCUS_48760 5568195 5566894 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269316.1 protein_id gnl|my_center|LOCUS_48760 5569791 5568520 gene locus_tag LOCUS_48770 5569791 5568520 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_48770 5570495 5569818 gene locus_tag LOCUS_48780 5570495 5569818 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_48780 5570649 5571260 gene locus_tag LOCUS_48790 5570649 5571260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 5571871 5571257 gene locus_tag LOCUS_48800 5571871 5571257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 5572709 5572095 gene locus_tag LOCUS_48810 5572709 5572095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 5573766 5573149 gene locus_tag LOCUS_48820 5573766 5573149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 5573897 5575720 gene locus_tag LOCUS_48830 5573897 5575720 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_48830 5575730 5576266 gene locus_tag LOCUS_48840 5575730 5576266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 5576882 5576391 gene locus_tag LOCUS_48850 5576882 5576391 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_48850 5578230 5577925 gene locus_tag LOCUS_48860 5578230 5577925 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_48860 5578437 5578234 gene locus_tag LOCUS_48870 5578437 5578234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 5579223 5579831 gene locus_tag LOCUS_48880 5579223 5579831 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_48880 5579930 5580517 gene locus_tag LOCUS_48890 5579930 5580517 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621372.1 protein_id gnl|my_center|LOCUS_48890 5580595 5581908 gene locus_tag LOCUS_48900 gene ubiH 5580595 5581908 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 protein_id gnl|my_center|LOCUS_48900 5581935 5583137 gene locus_tag LOCUS_48910 5581935 5583137 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_48910 5583203 5584390 gene locus_tag LOCUS_48920 5583203 5584390 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946853.1 protein_id gnl|my_center|LOCUS_48920 5584541 5585359 gene locus_tag LOCUS_48930 5584541 5585359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 5585432 5586337 gene locus_tag LOCUS_48940 5585432 5586337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 5586503 5586724 gene locus_tag LOCUS_48950 5586503 5586724 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_48950 5587088 5586837 gene locus_tag LOCUS_48960 5587088 5586837 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_48960 5587607 5587122 gene locus_tag LOCUS_48970 gene coaD 5587607 5587122 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 protein_id gnl|my_center|LOCUS_48970 5589246 5587777 gene locus_tag LOCUS_48980 5589246 5587777 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 protein_id gnl|my_center|LOCUS_48980 5591059 5589323 gene locus_tag LOCUS_48990 5591059 5589323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 5592297 5591206 gene locus_tag LOCUS_49000 5592297 5591206 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_49000 5592530 5593264 gene locus_tag LOCUS_49010 5592530 5593264 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261968.1 protein_id gnl|my_center|LOCUS_49010 5593261 5594019 gene locus_tag LOCUS_49020 gene pxpB 5593261 5594019 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065610322.1 protein_id gnl|my_center|LOCUS_49020 5594016 5594945 gene locus_tag LOCUS_49030 5594016 5594945 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 protein_id gnl|my_center|LOCUS_49030 5598259 5594990 gene locus_tag LOCUS_49040 5598259 5594990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 5598441 5598872 gene locus_tag LOCUS_49050 gene tnpA 5598441 5598872 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_49050 5599548 5598958 gene locus_tag LOCUS_49060 gene rsmD 5599548 5598958 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 protein_id gnl|my_center|LOCUS_49060 5599744 5601213 gene locus_tag LOCUS_49070 5599744 5601213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 5601231 5601899 gene locus_tag LOCUS_49080 gene ftsE 5601231 5601899 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_49080 5601902 5602996 gene locus_tag LOCUS_49090 gene ftsX 5601902 5602996 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_49090 5603343 5604104 gene locus_tag LOCUS_49100 5603343 5604104 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048211.1 protein_id gnl|my_center|LOCUS_49100 5604098 5605267 gene locus_tag LOCUS_49110 5604098 5605267 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359361.1 protein_id gnl|my_center|LOCUS_49110 5605796 5605344 gene locus_tag LOCUS_49120 5605796 5605344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 5606615 5605974 gene locus_tag LOCUS_49130 5606615 5605974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 5606702 5606929 gene locus_tag LOCUS_49140 5606702 5606929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 5607010 5607228 gene locus_tag LOCUS_49150 5607010 5607228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 5607243 5607734 gene locus_tag LOCUS_49160 5607243 5607734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 5607721 5608092 gene locus_tag LOCUS_49170 5607721 5608092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 5608092 5608415 gene locus_tag LOCUS_49180 5608092 5608415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 5608412 5609419 gene locus_tag LOCUS_49190 5608412 5609419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 5609406 5611166 gene locus_tag LOCUS_49200 5609406 5611166 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992438.1 protein_id gnl|my_center|LOCUS_49200 5611138 5612118 gene locus_tag LOCUS_49210 5611138 5612118 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052072670.1 protein_id gnl|my_center|LOCUS_49210 5612123 5612383 gene locus_tag LOCUS_49220 5612123 5612383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 5612436 5612684 gene locus_tag LOCUS_49230 5612436 5612684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 5613110 5613775 gene locus_tag LOCUS_49240 5613110 5613775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 5613778 5614656 gene locus_tag LOCUS_49250 5613778 5614656 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142982.1 protein_id gnl|my_center|LOCUS_49250 5614898 5615308 gene locus_tag LOCUS_49260 5614898 5615308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 5615728 5616048 gene locus_tag LOCUS_49270 5615728 5616048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 5616269 5616841 gene locus_tag LOCUS_49280 5616269 5616841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 5617411 5618238 gene locus_tag LOCUS_49290 gene rpoH 5617411 5618238 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_49290 5620552 5618306 gene locus_tag LOCUS_49300 5620552 5618306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 5622172 5620652 gene locus_tag LOCUS_49310 5622172 5620652 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_49310 5622536 5622276 gene locus_tag LOCUS_49320 5622536 5622276 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401798.1 protein_id gnl|my_center|LOCUS_49320 5622977 5623315 gene locus_tag LOCUS_49330 gene glnK 5622977 5623315 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_49330 5623452 5624702 gene locus_tag LOCUS_49340 5623452 5624702 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_49340 5625482 5626144 gene locus_tag LOCUS_49350 5625482 5626144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 5627499 5626174 gene locus_tag LOCUS_49360 5627499 5626174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 5627728 5628720 gene locus_tag LOCUS_49370 5627728 5628720 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_49370 5628871 5630166 gene locus_tag LOCUS_49380 5628871 5630166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 5630166 5631176 gene locus_tag LOCUS_49390 5630166 5631176 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_49390 5631302 5631502 gene locus_tag LOCUS_49400 5631302 5631502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 5631767 5634010 gene locus_tag LOCUS_49410 5631767 5634010 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263389.1 protein_id gnl|my_center|LOCUS_49410 5634982 5634023 gene locus_tag LOCUS_49420 5634982 5634023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 5638099 5635043 gene locus_tag LOCUS_49430 5638099 5635043 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_49430 5638161 5638346 gene locus_tag LOCUS_49440 5638161 5638346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 5639823 5638492 gene locus_tag LOCUS_49450 5639823 5638492 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124859.1 protein_id gnl|my_center|LOCUS_49450 5641982 5639823 gene locus_tag LOCUS_49460 5641982 5639823 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_49460 5642404 5642090 gene locus_tag LOCUS_49470 5642404 5642090 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009890.1 protein_id gnl|my_center|LOCUS_49470 5642492 5642782 gene locus_tag LOCUS_49480 5642492 5642782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 5644105 5645352 gene locus_tag LOCUS_49490 5644105 5645352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 5645812 5646147 gene locus_tag LOCUS_49500 5645812 5646147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 5646134 5647156 gene locus_tag LOCUS_49510 gene csy3 5646134 5647156 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478111.1 protein_id gnl|my_center|LOCUS_49510 5648319 5648972 gene locus_tag LOCUS_49520 5648319 5648972 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478373.1 protein_id gnl|my_center|LOCUS_49520 5648956 5650953 gene locus_tag LOCUS_49530 5648956 5650953 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478346.1 protein_id gnl|my_center|LOCUS_49530 5650953 5652047 gene locus_tag LOCUS_49540 5650953 5652047 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_49540 5652161 5653810 gene locus_tag LOCUS_49550 5652161 5653810 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_49550 5653807 5655009 gene locus_tag LOCUS_49560 5653807 5655009 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_49560 5655019 5657118 gene locus_tag LOCUS_49570 5655019 5657118 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 protein_id gnl|my_center|LOCUS_49570 5657126 5658958 gene locus_tag LOCUS_49580 5657126 5658958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 5658955 5660856 gene locus_tag LOCUS_49590 5658955 5660856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 5660930 5664100 gene locus_tag LOCUS_49600 5660930 5664100 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_49600 5665022 5664138 gene locus_tag LOCUS_49610 5665022 5664138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 5665366 5665151 gene locus_tag LOCUS_49620 5665366 5665151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 5665495 5665755 gene locus_tag LOCUS_49630 5665495 5665755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 5667108 5665873 gene locus_tag LOCUS_49640 5667108 5665873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 5667031 5667435 gene locus_tag LOCUS_49650 5667031 5667435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 5669006 5667522 gene locus_tag LOCUS_49660 5669006 5667522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 5669192 5670427 gene locus_tag LOCUS_49670 5669192 5670427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 5670429 5671127 gene locus_tag LOCUS_49680 5670429 5671127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 5671160 5672677 gene locus_tag LOCUS_49690 5671160 5672677 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065935.1 protein_id gnl|my_center|LOCUS_49690 5672898 5674178 gene locus_tag LOCUS_49700 5672898 5674178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 5674171 5675208 gene locus_tag LOCUS_49710 gene csy3 5674171 5675208 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478111.1 protein_id gnl|my_center|LOCUS_49710 5675210 5675761 gene locus_tag LOCUS_49720 gene cas6f 5675210 5675761 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478386.1 protein_id gnl|my_center|LOCUS_49720 5675880 5677115 gene locus_tag LOCUS_49730 5675880 5677115 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_49730 5677259 5677586 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttctgccgggtaggcagctgagcat 5679201 5677921 gene locus_tag LOCUS_49740 5679201 5677921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 5680430 5679795 gene locus_tag LOCUS_49750 5680430 5679795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 5681737 5680637 gene locus_tag LOCUS_49760 gene phnA 5681737 5680637 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 protein_id gnl|my_center|LOCUS_49760 5682736 5681945 gene locus_tag LOCUS_49770 5682736 5681945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 5683568 5682723 gene locus_tag LOCUS_49780 gene phnC 5683568 5682723 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267538.1 protein_id gnl|my_center|LOCUS_49780 5684428 5683568 gene locus_tag LOCUS_49790 5684428 5683568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 5686175 5684613 gene locus_tag LOCUS_49800 5686175 5684613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 5686388 5687590 gene locus_tag LOCUS_49810 5686388 5687590 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262998.1 protein_id gnl|my_center|LOCUS_49810 5687650 5689299 gene locus_tag LOCUS_49820 5687650 5689299 CDS product thiamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262997.1 protein_id gnl|my_center|LOCUS_49820 5689306 5689932 gene locus_tag LOCUS_49830 5689306 5689932 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462377.1 protein_id gnl|my_center|LOCUS_49830 5689964 5690590 gene locus_tag LOCUS_49840 5689964 5690590 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462324.1 protein_id gnl|my_center|LOCUS_49840 5690658 5691257 gene locus_tag LOCUS_49850 5690658 5691257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 5691292 5691702 gene locus_tag LOCUS_49860 5691292 5691702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 5693253 5691823 gene locus_tag LOCUS_49870 5693253 5691823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 5693300 5693557 gene locus_tag LOCUS_49880 5693300 5693557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 5693621 5694445 gene locus_tag LOCUS_49890 5693621 5694445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705899.1 protein_id gnl|my_center|LOCUS_49890 5694442 5695245 gene locus_tag LOCUS_49900 5694442 5695245 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 protein_id gnl|my_center|LOCUS_49900 5696588 5695785 gene locus_tag LOCUS_49910 5696588 5695785 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 protein_id gnl|my_center|LOCUS_49910 5697922 5696726 gene locus_tag LOCUS_49920 gene glpC 5697922 5696726 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706293.1 protein_id gnl|my_center|LOCUS_49920 5699245 5697932 gene locus_tag LOCUS_49930 gene glpB 5699245 5697932 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263143.1 protein_id gnl|my_center|LOCUS_49930 5700900 5699242 gene locus_tag LOCUS_49940 gene glpA 5700900 5699242 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128118.1 protein_id gnl|my_center|LOCUS_49940 5701340 5702158 gene locus_tag LOCUS_49950 5701340 5702158 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705540.1 protein_id gnl|my_center|LOCUS_49950 5702281 5703789 gene locus_tag LOCUS_49960 gene glpK 5702281 5703789 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705539.1 protein_id gnl|my_center|LOCUS_49960 5704458 5704048 gene locus_tag LOCUS_49970 gene fur 5704458 5704048 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_49970 5704553 5704918 gene locus_tag LOCUS_49980 5704553 5704918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 5705301 5704975 gene locus_tag LOCUS_49990 5705301 5704975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 5705750 5705301 gene locus_tag LOCUS_50000 5705750 5705301 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100497.1 protein_id gnl|my_center|LOCUS_50000 5707228 5705870 gene locus_tag LOCUS_50010 5707228 5705870 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_50010 5707544 5708023 gene locus_tag LOCUS_50020 gene smpB 5707544 5708023 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_50020 5708926 5708156 gene locus_tag LOCUS_50030 5708926 5708156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 5709088 5709453 gene locus_tag LOCUS_tm00010 5709088 5709453 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5710359 5709523 gene locus_tag LOCUS_50040 5710359 5709523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 5711165 5710737 gene locus_tag LOCUS_50050 5711165 5710737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 5711452 5712366 gene locus_tag LOCUS_50060 gene exeC 5711452 5712366 CDS product GspC family type II secretion system variant ExeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704539.1 protein_id gnl|my_center|LOCUS_50060 5712363 5714537 gene locus_tag LOCUS_50070 gene gspD 5712363 5714537 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 protein_id gnl|my_center|LOCUS_50070 5714515 5716035 gene locus_tag LOCUS_50080 gene exeE 5714515 5716035 CDS product GspE family T2SS ATPase variant ExeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704541.1 protein_id gnl|my_center|LOCUS_50080 5716039 5717265 gene locus_tag LOCUS_50090 gene gspF 5716039 5717265 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_50090 5717319 5717771 gene locus_tag LOCUS_50100 gene exeG 5717319 5717771 CDS product GspG family T2SS major pseudopilin variant ExeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_50100 5717780 5718421 gene locus_tag LOCUS_50110 5717780 5718421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 5718418 5718786 gene locus_tag LOCUS_50120 gene gspI 5718418 5718786 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070568.1 protein_id gnl|my_center|LOCUS_50120 5718783 5719439 gene locus_tag LOCUS_50130 gene exeJ 5718783 5719439 CDS product GspJ family T2SS minor pseudopilin variant ExeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704545.1 protein_id gnl|my_center|LOCUS_50130 5719439 5720422 gene locus_tag LOCUS_50140 gene exeK 5719439 5720422 CDS product GspK family T2SS minor pseudopilin variant ExeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704546.1 protein_id gnl|my_center|LOCUS_50140 5720419 5721651 gene locus_tag LOCUS_50150 gene exeL 5720419 5721651 CDS product GspL family type II secretion system protein ExeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704547.1 protein_id gnl|my_center|LOCUS_50150 5721648 5722169 gene locus_tag LOCUS_50160 5721648 5722169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 5722166 5722933 gene locus_tag LOCUS_50170 gene exeN 5722166 5722933 CDS product GspN family type II secretion system protein ExeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704549.1 protein_id gnl|my_center|LOCUS_50170 5722971 5723375 gene locus_tag LOCUS_tm00020 5722971 5723375 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5723692 5725020 gene locus_tag LOCUS_50180 5723692 5725020 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_50180 5726301 5725393 gene locus_tag LOCUS_50190 5726301 5725393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 5727855 5726425 gene locus_tag LOCUS_50200 5727855 5726425 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_50200 5728205 5729740 gene locus_tag LOCUS_50210 5728205 5729740 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_50210 5730172 5731638 gene locus_tag LOCUS_50220 5730172 5731638 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882045.1 protein_id gnl|my_center|LOCUS_50220 5732289 5731717 gene locus_tag LOCUS_50230 5732289 5731717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 5732398 5732661 gene locus_tag LOCUS_50240 5732398 5732661 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 protein_id gnl|my_center|LOCUS_50240 5732665 5733564 gene locus_tag LOCUS_50250 5732665 5733564 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_50250 5733803 5735800 gene locus_tag LOCUS_50260 gene dxs 5733803 5735800 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 protein_id gnl|my_center|LOCUS_50260 5736052 5737068 gene locus_tag LOCUS_50270 gene galE 5736052 5737068 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 protein_id gnl|my_center|LOCUS_50270 5737141 5738175 gene locus_tag LOCUS_50280 gene galT 5737141 5738175 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191531.1 protein_id gnl|my_center|LOCUS_50280 5738216 5739364 gene locus_tag LOCUS_50290 gene galK 5738216 5739364 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292299.1 protein_id gnl|my_center|LOCUS_50290 5739456 5740508 gene locus_tag LOCUS_50300 5739456 5740508 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_50300 5740620 5741288 gene locus_tag LOCUS_50310 5740620 5741288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 5741971 5741378 gene locus_tag LOCUS_50320 gene ribA 5741971 5741378 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379129.1 protein_id gnl|my_center|LOCUS_50320 5742291 5746088 gene locus_tag LOCUS_50330 5742291 5746088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 5746570 5746097 gene locus_tag LOCUS_50340 5746570 5746097 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_50340 5747568 5746600 gene locus_tag LOCUS_50350 gene thiL 5747568 5746600 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269044.1 protein_id gnl|my_center|LOCUS_50350 5748067 5747585 gene locus_tag LOCUS_50360 gene nusB 5748067 5747585 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_50360 5748542 5748069 gene locus_tag LOCUS_50370 gene ribE 5748542 5748069 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 protein_id gnl|my_center|LOCUS_50370 5749713 5748574 gene locus_tag LOCUS_50380 gene ribBA 5749713 5748574 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_50380 5750533 5749868 gene locus_tag LOCUS_50390 5750533 5749868 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_50390 5751830 5750709 gene locus_tag LOCUS_50400 gene ribD 5751830 5750709 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_50400 5752239 5752430 gene locus_tag LOCUS_50410 5752239 5752430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 5752423 5752602 gene locus_tag LOCUS_50420 5752423 5752602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 5754124 5753657 gene locus_tag LOCUS_50430 gene nrdR 5754124 5753657 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_50430 5755514 5754261 gene locus_tag LOCUS_50440 5755514 5754261 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_50440 5757111 5755597 gene locus_tag LOCUS_50450 5757111 5755597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 5758935 5757301 gene locus_tag LOCUS_50460 5758935 5757301 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_50460 5758995 5759567 gene locus_tag LOCUS_50470 5758995 5759567 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_50470 5759902 5761137 gene locus_tag LOCUS_50480 gene gmtY 5759902 5761137 CDS product gamma-mobile-trio recombinase GmtY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477115.1 protein_id gnl|my_center|LOCUS_50480 5761167 5763812 gene locus_tag LOCUS_50490 5761167 5763812 CDS product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 protein_id gnl|my_center|LOCUS_50490 5763799 5764485 gene locus_tag LOCUS_50500 gene gmtX 5763799 5764485 CDS product gamma-mobile-trio protein GmtX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477284.1 protein_id gnl|my_center|LOCUS_50500 5764552 5765040 gene locus_tag LOCUS_50510 5764552 5765040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 5765182 5765424 gene locus_tag LOCUS_50520 5765182 5765424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 5765991 5766620 gene locus_tag LOCUS_50530 5765991 5766620 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142596.1 protein_id gnl|my_center|LOCUS_50530 5766623 5767744 gene locus_tag LOCUS_50540 5766623 5767744 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 protein_id gnl|my_center|LOCUS_50540 5768686 5767694 gene locus_tag LOCUS_50550 5768686 5767694 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_50550 5768901 5769602 gene locus_tag LOCUS_50560 5768901 5769602 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_50560 5769595 5769930 gene locus_tag LOCUS_50570 5769595 5769930 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 protein_id gnl|my_center|LOCUS_50570 5770728 5770027 gene locus_tag LOCUS_50580 5770728 5770027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 5770929 5772452 gene locus_tag LOCUS_50590 gene istA 5770929 5772452 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_50590 5772472 5772786 gene locus_tag LOCUS_50600 5772472 5772786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 5772903 5773895 gene locus_tag LOCUS_50610 5772903 5773895 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_50610 5773950 5774351 gene locus_tag LOCUS_50620 5773950 5774351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 5775498 5774371 gene locus_tag LOCUS_50630 5775498 5774371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 5776095 5775520 gene locus_tag LOCUS_50640 5776095 5775520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 5776094 5776267 gene locus_tag LOCUS_50650 5776094 5776267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 5776476 5778179 gene locus_tag LOCUS_50660 5776476 5778179 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_50660 5779328 5778141 gene locus_tag LOCUS_50670 5779328 5778141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 5781350 5779404 gene locus_tag LOCUS_50680 5781350 5779404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50680 5782258 5781350 gene locus_tag LOCUS_50690 5782258 5781350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50690 5782482 5782288 gene locus_tag LOCUS_50700 5782482 5782288 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_50700 5783172 5784947 gene locus_tag LOCUS_50710 5783172 5784947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 5784950 5785402 gene locus_tag LOCUS_50720 5784950 5785402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 5785445 5786941 gene locus_tag LOCUS_50730 5785445 5786941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 5786965 5787318 gene locus_tag LOCUS_50740 5786965 5787318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 5787308 5788426 gene locus_tag LOCUS_50750 5787308 5788426 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777275.1 protein_id gnl|my_center|LOCUS_50750 5789449 5790441 gene locus_tag LOCUS_50760 5789449 5790441 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_50760 5791308 5790391 gene locus_tag LOCUS_50770 5791308 5790391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 5791414 5793060 gene locus_tag LOCUS_50780 5791414 5793060 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_50780 5793982 5793278 gene locus_tag LOCUS_50790 5793982 5793278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 5793998 5795233 gene locus_tag LOCUS_50800 5793998 5795233 CDS product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 protein_id gnl|my_center|LOCUS_50800 5795524 5795237 gene locus_tag LOCUS_50810 5795524 5795237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 5797014 5795587 gene locus_tag LOCUS_50820 5797014 5795587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 5797653 5799053 gene locus_tag LOCUS_50830 5797653 5799053 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_50830 5799599 5800627 gene locus_tag LOCUS_50840 5799599 5800627 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_50840 5800683 5802377 gene locus_tag LOCUS_50850 gene ettA 5800683 5802377 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105075.1 protein_id gnl|my_center|LOCUS_50850 5803309 5802431 gene locus_tag LOCUS_50860 5803309 5802431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 5803412 5803621 gene locus_tag LOCUS_50870 5803412 5803621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 5804815 5803880 gene locus_tag LOCUS_50880 5804815 5803880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 5804951 5807986 gene locus_tag LOCUS_50890 5804951 5807986 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267753.1 protein_id gnl|my_center|LOCUS_50890 5808526 5808077 gene locus_tag LOCUS_50900 5808526 5808077 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070460.1 protein_id gnl|my_center|LOCUS_50900 5808879 5808712 gene locus_tag LOCUS_50910 5808879 5808712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 5809637 5812051 gene locus_tag LOCUS_50920 5809637 5812051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 5812159 5813532 gene locus_tag LOCUS_50930 gene radA 5812159 5813532 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 protein_id gnl|my_center|LOCUS_50930 5816673 5813548 gene locus_tag LOCUS_50940 5816673 5813548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 5818199 5818816 gene locus_tag LOCUS_50950 gene thiE 5818199 5818816 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_50950 5818828 5820129 gene locus_tag LOCUS_50960 gene hemL 5818828 5820129 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_50960 5820214 5820840 gene locus_tag LOCUS_50970 5820214 5820840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 5821208 5820888 gene locus_tag LOCUS_50980 5821208 5820888 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_50980 5821544 5822596 gene locus_tag LOCUS_50990 5821544 5822596 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_50990 5822593 5825685 gene locus_tag LOCUS_51000 gene vmeF 5822593 5825685 CDS product multidrug efflux RND transporter permease subunit VmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481813.1 protein_id gnl|my_center|LOCUS_51000 5826020 5826679 gene locus_tag LOCUS_51010 5826020 5826679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 5827483 5826887 gene locus_tag LOCUS_51020 5827483 5826887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 5827802 5829163 gene locus_tag LOCUS_51030 gene miaB 5827802 5829163 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 protein_id gnl|my_center|LOCUS_51030 5829385 5830491 gene locus_tag LOCUS_51040 5829385 5830491 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_51040 5830488 5830952 gene locus_tag LOCUS_51050 gene ybeY 5830488 5830952 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158419.1 protein_id gnl|my_center|LOCUS_51050 5831110 5831955 gene locus_tag LOCUS_51060 5831110 5831955 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_51060 5831989 5833503 gene locus_tag LOCUS_51070 gene lnt 5831989 5833503 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_51070 5835731 5835922 gene locus_tag LOCUS_51080 5835731 5835922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 5836045 5836677 gene locus_tag LOCUS_51090 5836045 5836677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 5836670 5838109 gene locus_tag LOCUS_51100 5836670 5838109 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_51100 5839128 5838430 gene locus_tag LOCUS_51110 5839128 5838430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 5839281 5840456 gene locus_tag LOCUS_51120 gene chrA 5839281 5840456 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 protein_id gnl|my_center|LOCUS_51120 5840933 5840520 gene locus_tag LOCUS_51130 5840933 5840520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 5841231 5841746 gene locus_tag LOCUS_51140 5841231 5841746 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131618.1 protein_id gnl|my_center|LOCUS_51140 5842326 5842805 gene locus_tag LOCUS_51150 5842326 5842805 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_51150 5843680 5842922 gene locus_tag LOCUS_51160 gene tatC 5843680 5842922 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_51160 5844096 5843677 gene locus_tag LOCUS_51170 5844096 5843677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 5844302 5844108 gene locus_tag LOCUS_51180 5844302 5844108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 5844659 5845681 gene locus_tag LOCUS_51190 5844659 5845681 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705456.1 protein_id gnl|my_center|LOCUS_51190 5845869 5846939 gene locus_tag LOCUS_51200 5845869 5846939 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_51200 5847784 5847038 gene locus_tag LOCUS_51210 5847784 5847038 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 protein_id gnl|my_center|LOCUS_51210 5848864 5847947 gene locus_tag LOCUS_51220 5848864 5847947 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764417.1 protein_id gnl|my_center|LOCUS_51220 5849071 5849739 gene locus_tag LOCUS_51230 5849071 5849739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 5850471 5849779 gene locus_tag LOCUS_51240 5850471 5849779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 5850514 5850669 gene locus_tag LOCUS_51250 5850514 5850669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 5851651 5850659 gene locus_tag LOCUS_51260 5851651 5850659 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_51260 5854142 5851755 gene locus_tag LOCUS_51270 5854142 5851755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 5854861 5854241 gene locus_tag LOCUS_51280 5854861 5854241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 5855978 5854986 gene locus_tag LOCUS_51290 5855978 5854986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 5856173 5857165 gene locus_tag LOCUS_51300 5856173 5857165 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_51300 5857294 5858322 gene locus_tag LOCUS_51310 5857294 5858322 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926103.1 protein_id gnl|my_center|LOCUS_51310 5858604 5858323 gene locus_tag LOCUS_51320 5858604 5858323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 5858945 5858604 gene locus_tag LOCUS_51330 5858945 5858604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 5859997 5858945 gene locus_tag LOCUS_51340 5859997 5858945 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_51340 5862276 5859994 gene locus_tag LOCUS_51350 5862276 5859994 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 protein_id gnl|my_center|LOCUS_51350 5862544 5862864 gene locus_tag LOCUS_51360 5862544 5862864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 5862861 5863547 gene locus_tag LOCUS_51370 5862861 5863547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 5863744 5863668 gene locus_tag LOCUS_t00940 5863744 5863668 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5864137 5864529 gene locus_tag LOCUS_51380 5864137 5864529 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 protein_id gnl|my_center|LOCUS_51380 5865515 5864577 gene locus_tag LOCUS_51390 5865515 5864577 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_51390 5865869 5867335 gene locus_tag LOCUS_51400 5865869 5867335 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 protein_id gnl|my_center|LOCUS_51400 5867982 5868470 gene locus_tag LOCUS_51410 5867982 5868470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 5868534 5869583 gene locus_tag LOCUS_51420 gene selD 5868534 5869583 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 protein_id gnl|my_center|LOCUS_51420 5869864 5869619 gene locus_tag LOCUS_51430 5869864 5869619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 5870167 5870646 gene locus_tag LOCUS_51440 5870167 5870646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 5872352 5870682 gene locus_tag LOCUS_51450 gene recN 5872352 5870682 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_51450 5872577 5873176 gene locus_tag LOCUS_51460 gene grpE 5872577 5873176 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 protein_id gnl|my_center|LOCUS_51460 5873411 5875339 gene locus_tag LOCUS_51470 gene dnaK 5873411 5875339 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 protein_id gnl|my_center|LOCUS_51470 5875513 5876655 gene locus_tag LOCUS_51480 gene dnaJ 5875513 5876655 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_51480 5877727 5876750 gene locus_tag LOCUS_51490 5877727 5876750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 5877883 5878692 gene locus_tag LOCUS_51500 gene dapB 5877883 5878692 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_51500 5879111 5880253 gene locus_tag LOCUS_51510 gene carA 5879111 5880253 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243710.1 protein_id gnl|my_center|LOCUS_51510 5880442 5883663 gene locus_tag LOCUS_51520 gene carB 5880442 5883663 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_51520 5883660 5884136 gene locus_tag LOCUS_51530 gene greA 5883660 5884136 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095206.1 protein_id gnl|my_center|LOCUS_51530 5884293 5885114 gene locus_tag LOCUS_51540 5884293 5885114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 5885313 5887355 gene locus_tag LOCUS_51550 5885313 5887355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 5888319 5889089 gene locus_tag LOCUS_51560 5888319 5889089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 5889523 5889164 gene locus_tag LOCUS_51570 gene yhbY 5889523 5889164 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_51570 5889767 5890420 gene locus_tag LOCUS_51580 gene rlmE 5889767 5890420 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313635.1 protein_id gnl|my_center|LOCUS_51580 5890615 5892615 gene locus_tag LOCUS_51590 gene ftsH 5890615 5892615 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_51590 5892708 5893556 gene locus_tag LOCUS_51600 gene folP 5892708 5893556 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268884.1 protein_id gnl|my_center|LOCUS_51600 5893622 5894959 gene locus_tag LOCUS_51610 gene glmM 5893622 5894959 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_51610 5896095 5895037 gene locus_tag LOCUS_51620 5896095 5895037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 5896439 5897185 gene locus_tag LOCUS_51630 gene tpiA 5896439 5897185 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 protein_id gnl|my_center|LOCUS_51630 5897188 5897616 gene locus_tag LOCUS_51640 gene secG 5897188 5897616 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766452.1 protein_id gnl|my_center|LOCUS_51640 5897660 5897746 gene locus_tag LOCUS_t00950 5897660 5897746 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5897847 5897923 gene locus_tag LOCUS_t00960 5897847 5897923 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5898237 5898686 gene locus_tag LOCUS_51650 gene rimP 5898237 5898686 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_51650 5898880 5900373 gene locus_tag LOCUS_51660 gene nusA 5898880 5900373 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_51660 5900400 5903066 gene locus_tag LOCUS_51670 5900400 5903066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 5903266 5903721 gene locus_tag LOCUS_51680 gene rbfA 5903266 5903721 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_51680 5903728 5904675 gene locus_tag LOCUS_51690 gene truB 5903728 5904675 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766456.1 protein_id gnl|my_center|LOCUS_51690 5908657 5904737 gene locus_tag LOCUS_51700 5908657 5904737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 5909904 5908879 gene locus_tag LOCUS_51710 5909904 5908879 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 protein_id gnl|my_center|LOCUS_51710 5910671 5910000 gene locus_tag LOCUS_51720 5910671 5910000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 5910907 5910668 gene locus_tag LOCUS_51730 5910907 5910668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 5912151 5910964 gene locus_tag LOCUS_51740 5912151 5910964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 5913567 5912380 gene locus_tag LOCUS_51750 5913567 5912380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 5916335 5913849 gene locus_tag LOCUS_51760 5916335 5913849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 5916765 5917034 gene locus_tag LOCUS_51770 gene rpsO 5916765 5917034 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_51770 5917397 5919547 gene locus_tag LOCUS_51780 gene pnp 5917397 5919547 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_51780 5921064 5919637 gene locus_tag LOCUS_51790 5921064 5919637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 5921440 5922261 gene locus_tag LOCUS_51800 gene nagB 5921440 5922261 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 protein_id gnl|my_center|LOCUS_51800 5922245 5923420 gene locus_tag LOCUS_51810 gene nagA 5922245 5923420 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418266.1 protein_id gnl|my_center|LOCUS_51810 5923452 5924660 gene locus_tag LOCUS_51820 5923452 5924660 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 protein_id gnl|my_center|LOCUS_51820 5925055 5924774 gene locus_tag LOCUS_51830 5925055 5924774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 5926711 5925290 gene locus_tag LOCUS_51840 gene pykF 5926711 5925290 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210936.1 protein_id gnl|my_center|LOCUS_51840 5929254 5927419 gene locus_tag LOCUS_51850 gene rpoD 5929254 5927419 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_51850 5931635 5929572 gene locus_tag LOCUS_51860 gene dnaG 5931635 5929572 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 protein_id gnl|my_center|LOCUS_51860 5932113 5931664 gene locus_tag LOCUS_51870 5932113 5931664 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_51870 5932473 5932258 gene locus_tag LOCUS_51880 5932473 5932258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 5933029 5934057 gene locus_tag LOCUS_51890 gene tsaD 5933029 5934057 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 protein_id gnl|my_center|LOCUS_51890 5934096 5934479 gene locus_tag LOCUS_51900 5934096 5934479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51900 5934476 5934928 gene locus_tag LOCUS_51910 5934476 5934928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 5935219 5935734 gene locus_tag LOCUS_51920 5935219 5935734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 5936876 5935731 gene locus_tag LOCUS_51930 5936876 5935731 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_51930 5937101 5938312 gene locus_tag LOCUS_51940 5937101 5938312 CDS product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194442.1 protein_id gnl|my_center|LOCUS_51940 5938388 5938714 gene locus_tag LOCUS_51950 gene yhbQ 5938388 5938714 CDS product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189317.1 protein_id gnl|my_center|LOCUS_51950 5938910 5940613 gene locus_tag LOCUS_51960 gene fadD2 5938910 5940613 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_51960 5940930 5942312 gene locus_tag LOCUS_51970 5940930 5942312 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_51970 5942845 5942639 gene locus_tag LOCUS_51980 5942845 5942639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 5943550 5943125 gene locus_tag LOCUS_51990 5943550 5943125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 5943840 5943589 gene locus_tag LOCUS_52000 5943840 5943589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 5943995 5943819 gene locus_tag LOCUS_52010 5943995 5943819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 5945206 5944043 gene locus_tag LOCUS_52020 5945206 5944043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 5945613 5946524 gene locus_tag LOCUS_52030 5945613 5946524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 5946804 5947286 gene locus_tag LOCUS_52040 5946804 5947286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 5947974 5947480 gene locus_tag LOCUS_52050 5947974 5947480 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 protein_id gnl|my_center|LOCUS_52050 5948797 5948045 gene locus_tag LOCUS_52060 5948797 5948045 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705041.1 protein_id gnl|my_center|LOCUS_52060 5950873 5948804 gene locus_tag LOCUS_52070 5950873 5948804 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262850.1 protein_id gnl|my_center|LOCUS_52070 5951725 5951171 gene locus_tag LOCUS_52080 5951725 5951171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 5952231 5952097 gene locus_tag LOCUS_52090 5952231 5952097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 5953108 5952338 gene locus_tag LOCUS_52100 5953108 5952338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763057.1 protein_id gnl|my_center|LOCUS_52100 5953852 5953208 gene locus_tag LOCUS_52110 5953852 5953208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 5955822 5954020 gene locus_tag LOCUS_52120 5955822 5954020 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_52120 5956091 5955819 gene locus_tag LOCUS_52130 5956091 5955819 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_52130 5956347 5959517 gene locus_tag LOCUS_52140 gene putA 5956347 5959517 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114187.1 protein_id gnl|my_center|LOCUS_52140 5959662 5959587 gene locus_tag LOCUS_t00970 5959662 5959587 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5961406 5959700 gene locus_tag LOCUS_52150 gene pilB 5961406 5959700 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_52150 5962956 5961562 gene locus_tag LOCUS_52160 5962956 5961562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 5964060 5963368 gene locus_tag LOCUS_52170 5964060 5963368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 5964265 5964954 gene locus_tag LOCUS_52180 5964265 5964954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 5966066 5967556 gene locus_tag LOCUS_52190 5966066 5967556 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 protein_id gnl|my_center|LOCUS_52190 5967913 5968644 gene locus_tag LOCUS_52200 5967913 5968644 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_52200 5968647 5971286 gene locus_tag LOCUS_52210 5968647 5971286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 5971286 5971963 gene locus_tag LOCUS_52220 5971286 5971963 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_52220 5972093 5972668 gene locus_tag LOCUS_52230 5972093 5972668 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919766.1 protein_id gnl|my_center|LOCUS_52230 5973220 5975040 gene locus_tag LOCUS_52240 5973220 5975040 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_52240 5975198 5975824 gene locus_tag LOCUS_52250 5975198 5975824 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_52250 5978542 5975849 gene locus_tag LOCUS_52260 5978542 5975849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 5980154 5978628 gene locus_tag LOCUS_52270 5980154 5978628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 5981121 5980141 gene locus_tag LOCUS_52280 5981121 5980141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 5982595 5981603 gene locus_tag LOCUS_52290 5982595 5981603 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216744.1 protein_id gnl|my_center|LOCUS_52290 5982801 5983799 gene locus_tag LOCUS_52300 5982801 5983799 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263749.1 protein_id gnl|my_center|LOCUS_52300 5984399 5983827 gene locus_tag LOCUS_52310 5984399 5983827 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_52310 5984564 5984950 gene locus_tag LOCUS_52320 5984564 5984950 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_52320 5985097 5985172 gene locus_tag LOCUS_t00980 5985097 5985172 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5986813 5985233 gene locus_tag LOCUS_52330 5986813 5985233 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_52330 5987058 5987741 gene locus_tag LOCUS_52340 5987058 5987741 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948378.1 protein_id gnl|my_center|LOCUS_52340 5987778 5988497 gene locus_tag LOCUS_52350 5987778 5988497 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957710.1 protein_id gnl|my_center|LOCUS_52350 5989025 5988501 gene locus_tag LOCUS_52360 gene yjgA 5989025 5988501 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 protein_id gnl|my_center|LOCUS_52360 5989262 5990617 gene locus_tag LOCUS_52370 gene pmbA 5989262 5990617 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_52370 5990646 5991038 gene locus_tag LOCUS_52380 5990646 5991038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 5992430 5991072 gene locus_tag LOCUS_52390 gene mgtE 5992430 5991072 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_52390 5992738 5992469 gene locus_tag LOCUS_52400 5992738 5992469 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_52400 5993595 5992738 gene locus_tag LOCUS_52410 gene rapZ 5993595 5992738 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_52410 5994215 5993763 gene locus_tag LOCUS_52420 gene ptsN 5994215 5993763 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_52420 5994620 5994315 gene locus_tag LOCUS_52430 gene raiA 5994620 5994315 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_52430 5996279 5994840 gene locus_tag LOCUS_52440 5996279 5994840 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_52440 5997365 5996640 gene locus_tag LOCUS_52450 gene lptB 5997365 5996640 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_52450 5997990 5997370 gene locus_tag LOCUS_52460 5997990 5997370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 5998558 5997971 gene locus_tag LOCUS_52470 5998558 5997971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 5999158 5998631 gene locus_tag LOCUS_52480 5999158 5998631 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_52480 6000132 5999155 gene locus_tag LOCUS_52490 gene kdsD 6000132 5999155 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_52490 6001206 6000250 gene locus_tag LOCUS_52500 6001206 6000250 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_52500 6001575 6002387 gene locus_tag LOCUS_52510 6001575 6002387 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_52510 6002384 6003178 gene locus_tag LOCUS_52520 gene mlaE 6002384 6003178 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 protein_id gnl|my_center|LOCUS_52520 6003178 6003645 gene locus_tag LOCUS_52530 gene mlaD 6003178 6003645 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_52530 6003660 6004331 gene locus_tag LOCUS_52540 6003660 6004331 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_52540 6004335 6004664 gene locus_tag LOCUS_52550 6004335 6004664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 6004858 6005100 gene locus_tag LOCUS_52560 6004858 6005100 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094334.1 protein_id gnl|my_center|LOCUS_52560 6005079 6006386 gene locus_tag LOCUS_52570 gene murA 6005079 6006386 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_52570 6006534 6007172 gene locus_tag LOCUS_52580 gene hisG 6006534 6007172 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_52580 6007166 6008488 gene locus_tag LOCUS_52590 gene hisD 6007166 6008488 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_52590 6009261 6008512 gene locus_tag LOCUS_52600 6009261 6008512 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463954.1 protein_id gnl|my_center|LOCUS_52600 6011782 6009359 gene locus_tag LOCUS_52610 6011782 6009359 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462748.1 protein_id gnl|my_center|LOCUS_52610 6012552 6011785 gene locus_tag LOCUS_52620 6012552 6011785 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462746.1 protein_id gnl|my_center|LOCUS_52620 6012896 6013570 gene locus_tag LOCUS_52630 6012896 6013570 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462744.1 protein_id gnl|my_center|LOCUS_52630 6014761 6013643 gene locus_tag LOCUS_52640 gene algW 6014761 6013643 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_52640 6014859 6015617 gene locus_tag LOCUS_52650 6014859 6015617 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268856.1 protein_id gnl|my_center|LOCUS_52650 6016943 6015624 gene locus_tag LOCUS_52660 gene dcm 6016943 6015624 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_52660 6017119 6017541 gene locus_tag LOCUS_52670 6017119 6017541 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946967.1 protein_id gnl|my_center|LOCUS_52670 6017656 6019002 gene locus_tag LOCUS_52680 6017656 6019002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 6019086 6019505 gene locus_tag LOCUS_52690 6019086 6019505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 6019492 6020241 gene locus_tag LOCUS_52700 6019492 6020241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 6020380 6021300 gene locus_tag LOCUS_52710 gene cysD 6020380 6021300 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 protein_id gnl|my_center|LOCUS_52710 6021300 6022943 gene locus_tag LOCUS_52720 gene cysN 6021300 6022943 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_52720 6024386 6023001 gene locus_tag LOCUS_52730 6024386 6023001 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 protein_id gnl|my_center|LOCUS_52730 6024676 6024891 gene locus_tag LOCUS_52740 6024676 6024891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 6024938 6026572 gene locus_tag LOCUS_52750 6024938 6026572 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_52750 6026659 6028425 gene locus_tag LOCUS_52760 6026659 6028425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 6028658 6029857 gene locus_tag LOCUS_52770 gene kbl 6028658 6029857 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 protein_id gnl|my_center|LOCUS_52770 6029872 6030897 gene locus_tag LOCUS_52780 gene tdh 6029872 6030897 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_52780 6031851 6030979 gene locus_tag LOCUS_52790 6031851 6030979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 6032619 6032050 gene locus_tag LOCUS_52800 gene folE 6032619 6032050 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 protein_id gnl|my_center|LOCUS_52800 6040287 6032695 gene locus_tag LOCUS_52810 6040287 6032695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 6041310 6042344 gene locus_tag LOCUS_52820 6041310 6042344 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 protein_id gnl|my_center|LOCUS_52820 6042362 6043546 gene locus_tag LOCUS_52830 6042362 6043546 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_52830 6043548 6044612 gene locus_tag LOCUS_52840 6043548 6044612 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388757.1 protein_id gnl|my_center|LOCUS_52840 6044631 6045434 gene locus_tag LOCUS_52850 6044631 6045434 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_52850 6046787 6045489 gene locus_tag LOCUS_52860 6046787 6045489 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 protein_id gnl|my_center|LOCUS_52860 6047045 6047572 gene locus_tag LOCUS_52870 6047045 6047572 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073724.1 protein_id gnl|my_center|LOCUS_52870 6048423 6047650 gene locus_tag LOCUS_52880 gene yaaA 6048423 6047650 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906188.1 protein_id gnl|my_center|LOCUS_52880 6049965 6048616 gene locus_tag LOCUS_52890 gene gdhA 6049965 6048616 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_52890 6050558 6050133 gene locus_tag LOCUS_52900 6050558 6050133 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097659.1 protein_id gnl|my_center|LOCUS_52900 6051037 6051177 gene locus_tag LOCUS_52910 6051037 6051177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 6052100 6051249 gene locus_tag LOCUS_52920 gene focA 6052100 6051249 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642539.1 protein_id gnl|my_center|LOCUS_52920 6052455 6052985 gene locus_tag LOCUS_52930 6052455 6052985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 6054486 6053047 gene locus_tag LOCUS_52940 gene cptA 6054486 6053047 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_52940 6055798 6054635 gene locus_tag LOCUS_52950 6055798 6054635 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_52950 6056361 6056741 gene locus_tag LOCUS_52960 6056361 6056741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 6058852 6056816 gene locus_tag LOCUS_52970 gene fusA 6058852 6056816 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_52970 6059010 6059987 gene locus_tag LOCUS_52980 6059010 6059987 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_52980 6061331 6060042 gene locus_tag LOCUS_52990 6061331 6060042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 6061513 6062133 gene locus_tag LOCUS_53000 6061513 6062133 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071372.1 protein_id gnl|my_center|LOCUS_53000 6063754 6062225 gene locus_tag LOCUS_53010 gene gpmM 6063754 6062225 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261056.1 protein_id gnl|my_center|LOCUS_53010 6064118 6064528 gene locus_tag LOCUS_53020 6064118 6064528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 6064624 6065040 gene locus_tag LOCUS_53030 6064624 6065040 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001368341.1 protein_id gnl|my_center|LOCUS_53030 6065119 6065316 gene locus_tag LOCUS_53040 gene grxC 6065119 6065316 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 protein_id gnl|my_center|LOCUS_53040 6065437 6065913 gene locus_tag LOCUS_53050 gene secB 6065437 6065913 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096050.1 protein_id gnl|my_center|LOCUS_53050 6066772 6067998 gene locus_tag LOCUS_53060 gene ltrA 6066772 6067998 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_53060 6068231 6068079 gene locus_tag LOCUS_53070 6068231 6068079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 6068852 6070078 gene locus_tag LOCUS_53080 gene ltrA 6068852 6070078 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808874.1 protein_id gnl|my_center|LOCUS_53080 6071136 6070183 gene locus_tag LOCUS_53090 6071136 6070183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 6071391 6071182 gene locus_tag LOCUS_53100 6071391 6071182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 6071350 6072312 gene locus_tag LOCUS_53110 gene pip 6071350 6072312 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765551.1 protein_id gnl|my_center|LOCUS_53110 6072834 6073532 gene locus_tag LOCUS_53120 6072834 6073532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 6073562 6073999 gene locus_tag LOCUS_53130 gene dtd 6073562 6073999 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 protein_id gnl|my_center|LOCUS_53130 6075823 6074078 gene locus_tag LOCUS_53140 gene argS 6075823 6074078 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025289.1 protein_id gnl|my_center|LOCUS_53140 6076118 6076714 gene locus_tag LOCUS_53150 6076118 6076714 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_53150 6076794 6077339 gene locus_tag LOCUS_53160 gene hslV 6076794 6077339 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_53160 6077430 6078767 gene locus_tag LOCUS_53170 gene hslU 6077430 6078767 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 protein_id gnl|my_center|LOCUS_53170 6080049 6078862 gene locus_tag LOCUS_53180 6080049 6078862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 6080692 6080033 gene locus_tag LOCUS_53190 6080692 6080033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 6081068 6080661 gene locus_tag LOCUS_53200 6081068 6080661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 6081585 6081052 gene locus_tag LOCUS_53210 6081585 6081052 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707898.1 protein_id gnl|my_center|LOCUS_53210 6082898 6081582 gene locus_tag LOCUS_53220 6082898 6081582 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263604.1 protein_id gnl|my_center|LOCUS_53220 6083644 6082901 gene locus_tag LOCUS_53230 6083644 6082901 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_53230 6083971 6086439 gene locus_tag LOCUS_53240 6083971 6086439 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 protein_id gnl|my_center|LOCUS_53240 6086497 6088215 gene locus_tag LOCUS_53250 6086497 6088215 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 protein_id gnl|my_center|LOCUS_53250 6088217 6091066 gene locus_tag LOCUS_53260 6088217 6091066 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815400.1 protein_id gnl|my_center|LOCUS_53260 6091425 6091730 gene locus_tag LOCUS_53270 6091425 6091730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 6091858 6092367 gene locus_tag LOCUS_53280 6091858 6092367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 6092528 6093598 gene locus_tag LOCUS_53290 6092528 6093598 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_53290 6093892 6094269 gene locus_tag LOCUS_53300 6093892 6094269 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_53300 6094419 6095258 gene locus_tag LOCUS_53310 gene ubiE 6094419 6095258 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_53310 6095258 6095920 gene locus_tag LOCUS_53320 6095258 6095920 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115043.1 protein_id gnl|my_center|LOCUS_53320 6095976 6097577 gene locus_tag LOCUS_53330 gene ubiB 6095976 6097577 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_53330 6097559 6097996 gene locus_tag LOCUS_53340 gene hisI 6097559 6097996 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_53340 6097989 6098318 gene locus_tag LOCUS_53350 6097989 6098318 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_53350 6098353 6098598 gene locus_tag LOCUS_53360 gene tatA 6098353 6098598 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 protein_id gnl|my_center|LOCUS_53360 6098634 6099002 gene locus_tag LOCUS_53370 6098634 6099002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 6098999 6099742 gene locus_tag LOCUS_53380 gene tatC 6098999 6099742 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_53380 6099891 6100187 gene locus_tag LOCUS_53390 6099891 6100187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 6101416 6100220 gene locus_tag LOCUS_53400 6101416 6100220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 6101607 6102317 gene locus_tag LOCUS_53410 6101607 6102317 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_53410 6102386 6103153 gene locus_tag LOCUS_53420 6102386 6103153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 6105430 6103166 gene locus_tag LOCUS_53430 6105430 6103166 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_53430 6105702 6105917 gene locus_tag LOCUS_53440 gene rpmE 6105702 6105917 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_53440 6105926 6106807 gene locus_tag LOCUS_53450 6105926 6106807 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_53450 6107745 6106804 gene locus_tag LOCUS_53460 6107745 6106804 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047887521.1 protein_id gnl|my_center|LOCUS_53460 6108033 6109043 gene locus_tag LOCUS_53470 6108033 6109043 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_53470 6109054 6110208 gene locus_tag LOCUS_53480 gene yqhD 6109054 6110208 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_53480 6110230 6110835 gene locus_tag LOCUS_53490 6110230 6110835 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_53490 6111141 6112391 gene locus_tag LOCUS_53500 6111141 6112391 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378855.1 protein_id gnl|my_center|LOCUS_53500 6112738 6113166 gene locus_tag LOCUS_53510 6112738 6113166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 6115801 6113273 gene locus_tag LOCUS_53520 6115801 6113273 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_53520 6116094 6117158 gene locus_tag LOCUS_53530 gene pilM 6116094 6117158 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_53530 6117158 6117724 gene locus_tag LOCUS_53540 6117158 6117724 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765503.1 protein_id gnl|my_center|LOCUS_53540 6117721 6118335 gene locus_tag LOCUS_53550 gene pilO 6117721 6118335 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_53550 6118332 6118856 gene locus_tag LOCUS_53560 gene pilP 6118332 6118856 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 protein_id gnl|my_center|LOCUS_53560 6118980 6121079 gene locus_tag LOCUS_53570 gene pilQ 6118980 6121079 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_53570 6121205 6121720 gene locus_tag LOCUS_53580 gene aroK 6121205 6121720 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818616.1 protein_id gnl|my_center|LOCUS_53580 6121729 6122811 gene locus_tag LOCUS_53590 gene aroB 6121729 6122811 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_53590 6123241 6127698 gene locus_tag LOCUS_53600 gene gltB 6123241 6127698 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_53600 6127758 6129188 gene locus_tag LOCUS_53610 6127758 6129188 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_53610 6129234 6130295 gene locus_tag LOCUS_53620 gene hemE 6129234 6130295 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_53620 6131810 6130524 gene locus_tag LOCUS_53630 gene purD 6131810 6130524 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197681.1 protein_id gnl|my_center|LOCUS_53630 6133500 6131899 gene locus_tag LOCUS_53640 gene purH 6133500 6131899 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 protein_id gnl|my_center|LOCUS_53640 6133983 6133681 gene locus_tag LOCUS_53650 6133983 6133681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 6135029 6133980 gene locus_tag LOCUS_53660 gene dusB 6135029 6133980 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 protein_id gnl|my_center|LOCUS_53660 6136237 6135383 gene locus_tag LOCUS_53670 6136237 6135383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 6137226 6136342 gene locus_tag LOCUS_53680 gene prmA 6137226 6136342 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070755.1 protein_id gnl|my_center|LOCUS_53680 6138736 6137393 gene locus_tag LOCUS_53690 gene accC 6138736 6137393 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 protein_id gnl|my_center|LOCUS_53690 6139211 6138747 gene locus_tag LOCUS_53700 gene accB 6139211 6138747 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269006.1 protein_id gnl|my_center|LOCUS_53700 6139762 6139319 gene locus_tag LOCUS_53710 gene aroQ 6139762 6139319 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_53710 6141736 6139907 gene locus_tag LOCUS_53720 gene dsbD 6141736 6139907 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958394.1 protein_id gnl|my_center|LOCUS_53720 6142428 6141901 gene locus_tag LOCUS_53730 gene ppa 6142428 6141901 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317259.1 protein_id gnl|my_center|LOCUS_53730 6143273 6142506 gene locus_tag LOCUS_53740 6143273 6142506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 protein_id gnl|my_center|LOCUS_53740 6143998 6143270 gene locus_tag LOCUS_53750 6143998 6143270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_53750 6145007 6143982 gene locus_tag LOCUS_53760 6145007 6143982 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082945.1 protein_id gnl|my_center|LOCUS_53760 6145259 6146896 gene locus_tag LOCUS_53770 6145259 6146896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 6147041 6147922 gene locus_tag LOCUS_53780 6147041 6147922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 6147946 6148440 gene locus_tag LOCUS_53790 gene pcrH 6147946 6148440 CDS product SycD/LcrH family type III secretion system chaperone PcrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113548.1 protein_id gnl|my_center|LOCUS_53790 6148460 6149986 gene locus_tag LOCUS_53800 6148460 6149986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 6150014 6151549 gene locus_tag LOCUS_53810 6150014 6151549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 6151608 6152807 gene locus_tag LOCUS_53820 6151608 6152807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 6152911 6153285 gene locus_tag LOCUS_53830 6152911 6153285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 6153362 6153802 gene locus_tag LOCUS_53840 6153362 6153802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 6153905 6154660 gene locus_tag LOCUS_53850 gene pscJ 6153905 6154660 CDS product SctJ family type III secretion inner membrane ring lipoprotein Psc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120329.1 protein_id gnl|my_center|LOCUS_53850 6154657 6155352 gene locus_tag LOCUS_53860 6154657 6155352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 6155331 6155993 gene locus_tag LOCUS_53870 gene bscL 6155331 6155993 CDS product SctL family type III secretion system stator protein BscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076879814.1 protein_id gnl|my_center|LOCUS_53870 6156544 6158340 gene locus_tag LOCUS_53880 gene frdA 6156544 6158340 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706984.1 protein_id gnl|my_center|LOCUS_53880 6158354 6159103 gene locus_tag LOCUS_53890 6158354 6159103 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 protein_id gnl|my_center|LOCUS_53890 6159103 6159489 gene locus_tag LOCUS_53900 gene frdC 6159103 6159489 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071094.1 protein_id gnl|my_center|LOCUS_53900 6159503 6159853 gene locus_tag LOCUS_53910 gene frdD 6159503 6159853 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884009.1 protein_id gnl|my_center|LOCUS_53910 6160648 6159935 gene locus_tag LOCUS_53920 6160648 6159935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 6160741 6161748 gene locus_tag LOCUS_53930 6160741 6161748 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_53930 6161741 6162430 gene locus_tag LOCUS_53940 6161741 6162430 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_53940 6162630 6163403 gene locus_tag LOCUS_53950 6162630 6163403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 6163591 6164979 gene locus_tag LOCUS_53960 6163591 6164979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 6165117 6166406 gene locus_tag LOCUS_53970 6165117 6166406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 6166482 6167684 gene locus_tag LOCUS_53980 6166482 6167684 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_53980 6169076 6167751 gene locus_tag LOCUS_53990 6169076 6167751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 6169251 6170123 gene locus_tag LOCUS_54000 6169251 6170123 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263936.1 protein_id gnl|my_center|LOCUS_54000 6170136 6170336 gene locus_tag LOCUS_54010 6170136 6170336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 6170317 6170586 gene locus_tag LOCUS_54020 6170317 6170586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 6170680 6171630 gene locus_tag LOCUS_54030 6170680 6171630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083176.1 protein_id gnl|my_center|LOCUS_54030 6171765 6172385 gene locus_tag LOCUS_54040 6171765 6172385 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 protein_id gnl|my_center|LOCUS_54040 6172702 6172376 gene locus_tag LOCUS_54050 6172702 6172376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 6175011 6172735 gene locus_tag LOCUS_54060 6175011 6172735 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_54060 6175488 6175204 gene locus_tag LOCUS_54070 6175488 6175204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 6175707 6176012 gene locus_tag LOCUS_54080 6175707 6176012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 6176185 6177102 gene locus_tag LOCUS_54090 6176185 6177102 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071535.1 protein_id gnl|my_center|LOCUS_54090 6177222 6178097 gene locus_tag LOCUS_54100 6177222 6178097 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 protein_id gnl|my_center|LOCUS_54100 6178109 6180385 gene locus_tag LOCUS_54110 6178109 6180385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 6180378 6182093 gene locus_tag LOCUS_54120 6180378 6182093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 6182139 6184010 gene locus_tag LOCUS_54130 6182139 6184010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 6183970 6184803 gene locus_tag LOCUS_54140 6183970 6184803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 6185235 6184834 gene locus_tag LOCUS_54150 6185235 6184834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 6186465 6185284 gene locus_tag LOCUS_54160 6186465 6185284 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 protein_id gnl|my_center|LOCUS_54160 6188069 6186462 gene locus_tag LOCUS_54170 6188069 6186462 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_54170 6188265 6189641 gene locus_tag LOCUS_54180 6188265 6189641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 6193143 6189706 gene locus_tag LOCUS_54190 6193143 6189706 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123348.1 protein_id gnl|my_center|LOCUS_54190 6193330 6194688 gene locus_tag LOCUS_54200 6193330 6194688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 6194768 6195496 gene locus_tag LOCUS_54210 6194768 6195496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 6195539 6196588 gene locus_tag LOCUS_54220 6195539 6196588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 6197415 6197676 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgaaccgctgtgaatgcggctga 6197986 6198204 gene locus_tag LOCUS_54230 6197986 6198204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 6198493 6198260 gene locus_tag LOCUS_54240 6198493 6198260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 6198691 6198503 gene locus_tag LOCUS_54250 6198691 6198503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 6199001 6199372 gene locus_tag LOCUS_54260 6199001 6199372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 6199672 6199878 gene locus_tag LOCUS_54270 6199672 6199878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54270 6199950 6200645 gene locus_tag LOCUS_54280 6199950 6200645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54280 6201995 6201249 gene locus_tag LOCUS_54290 6201995 6201249 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_54290 6204494 6202857 gene locus_tag LOCUS_54300 6204494 6202857 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_54300 6207028 6204548 gene locus_tag LOCUS_54310 6207028 6204548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 6208641 6207421 gene locus_tag LOCUS_54320 6208641 6207421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 6208917 6209336 gene locus_tag LOCUS_54330 6208917 6209336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 6209382 6209555 gene locus_tag LOCUS_54340 6209382 6209555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 6209605 6211395 gene locus_tag LOCUS_54350 6209605 6211395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54350 6211587 6211426 gene locus_tag LOCUS_54360 6211587 6211426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 6211995 6213629 gene locus_tag LOCUS_54370 6211995 6213629 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199691.1 protein_id gnl|my_center|LOCUS_54370 6213696 6215057 gene locus_tag LOCUS_54380 6213696 6215057 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228115.1 protein_id gnl|my_center|LOCUS_54380 6215108 6216235 gene locus_tag LOCUS_54390 6215108 6216235 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_54390 6216307 6216840 gene locus_tag LOCUS_54400 6216307 6216840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_54400 6218922 6216835 gene locus_tag LOCUS_54410 gene vcrD 6218922 6216835 CDS product SctV family type III secretion system export apparatus subunit VcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105897.1 protein_id gnl|my_center|LOCUS_54410 6219283 6218984 gene locus_tag LOCUS_54420 6219283 6218984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 6219692 6219321 gene locus_tag LOCUS_54430 6219692 6219321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 6219986 6222169 gene locus_tag LOCUS_54440 6219986 6222169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 6222320 6223933 gene locus_tag LOCUS_54450 gene glpD 6222320 6223933 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 protein_id gnl|my_center|LOCUS_54450 6223971 6224891 gene locus_tag LOCUS_54460 gene yvcK 6223971 6224891 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705472.1 protein_id gnl|my_center|LOCUS_54460 6225553 6224912 gene locus_tag LOCUS_54470 6225553 6224912 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263846.1 protein_id gnl|my_center|LOCUS_54470 6226787 6225558 gene locus_tag LOCUS_54480 6226787 6225558 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 protein_id gnl|my_center|LOCUS_54480 6227904 6226780 gene locus_tag LOCUS_54490 6227904 6226780 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 protein_id gnl|my_center|LOCUS_54490 6229409 6227901 gene locus_tag LOCUS_54500 6229409 6227901 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_54500 6229824 6229402 gene locus_tag LOCUS_54510 6229824 6229402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 6231274 6230144 gene locus_tag LOCUS_54520 6231274 6230144 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483463.1 protein_id gnl|my_center|LOCUS_54520 6232849 6231302 gene locus_tag LOCUS_54530 6232849 6231302 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_54530 6234289 6232859 gene locus_tag LOCUS_54540 6234289 6232859 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_54540 6235406 6234330 gene locus_tag LOCUS_54550 6235406 6234330 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_54550 6237483 6235432 gene locus_tag LOCUS_54560 gene bifA 6237483 6235432 CDS product cyclic-di-GMP phosphodiesterase BifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_54560 6237985 6238317 gene locus_tag LOCUS_54570 6237985 6238317 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263829.1 protein_id gnl|my_center|LOCUS_54570 6238427 6239137 gene locus_tag LOCUS_54580 6238427 6239137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 6239115 6241907 gene locus_tag LOCUS_54590 6239115 6241907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 6241921 6242628 gene locus_tag LOCUS_54600 6241921 6242628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 6243404 6242649 gene locus_tag LOCUS_54610 6243404 6242649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 6244097 6243429 gene locus_tag LOCUS_54620 6244097 6243429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 6245364 6244243 gene locus_tag LOCUS_54630 gene trmA 6245364 6244243 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 protein_id gnl|my_center|LOCUS_54630 6247007 6245976 gene locus_tag LOCUS_54640 6247007 6245976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 6247259 6248515 gene locus_tag LOCUS_54650 6247259 6248515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 6248992 6248525 gene locus_tag LOCUS_54660 gene rimI 6248992 6248525 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095025.1 protein_id gnl|my_center|LOCUS_54660 6249834 6248989 gene locus_tag LOCUS_54670 6249834 6248989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 6251388 6249841 gene locus_tag LOCUS_54680 6251388 6249841 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_54680 6251908 6252504 gene locus_tag LOCUS_54690 6251908 6252504 CDS product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406899.1 protein_id gnl|my_center|LOCUS_54690 6253696 6252674 gene locus_tag LOCUS_54700 gene hemH 6253696 6252674 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 protein_id gnl|my_center|LOCUS_54700 6254936 6253758 gene locus_tag LOCUS_54710 gene nhaA 6254936 6253758 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_54710 6256168 6255290 gene locus_tag LOCUS_54720 gene prmC 6256168 6255290 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261470.1 protein_id gnl|my_center|LOCUS_54720 6257276 6256161 gene locus_tag LOCUS_54730 gene prfA 6257276 6256161 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_54730 6257682 6258752 gene locus_tag LOCUS_54740 6257682 6258752 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_54740 6258871 6259275 gene locus_tag LOCUS_54750 6258871 6259275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 6259505 6260146 gene locus_tag LOCUS_54760 6259505 6260146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 6261754 6260186 gene locus_tag LOCUS_54770 6261754 6260186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 6263175 6261922 gene locus_tag LOCUS_54780 gene hemA 6263175 6261922 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_54780 6263393 6265201 gene locus_tag LOCUS_54790 6263393 6265201 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_54790 6265217 6265855 gene locus_tag LOCUS_54800 gene lolB 6265217 6265855 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958471.1 protein_id gnl|my_center|LOCUS_54800 6265915 6266838 gene locus_tag LOCUS_54810 gene ispE 6265915 6266838 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 protein_id gnl|my_center|LOCUS_54810 6266891 6266965 gene locus_tag LOCUS_t00990 6266891 6266965 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6267071 6268012 gene locus_tag LOCUS_54820 6267071 6268012 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_54820 6269174 6268158 gene locus_tag LOCUS_54830 6269174 6268158 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847485.1 protein_id gnl|my_center|LOCUS_54830 6269384 6269178 gene locus_tag LOCUS_54840 6269384 6269178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 6269703 6269401 gene locus_tag LOCUS_54850 6269703 6269401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 6270525 6269761 gene locus_tag LOCUS_54860 6270525 6269761 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_54860 6271404 6270604 gene locus_tag LOCUS_54870 6271404 6270604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6271837 6271520 gene locus_tag LOCUS_54880 6271837 6271520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 6273212 6271839 gene locus_tag LOCUS_54890 6273212 6271839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 6273691 6273392 gene locus_tag LOCUS_54900 6273691 6273392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 6274051 6273809 gene locus_tag LOCUS_54910 6274051 6273809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 6274428 6274165 gene locus_tag LOCUS_54920 6274428 6274165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 6274781 6274506 gene locus_tag LOCUS_54930 6274781 6274506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 6275073 6274867 gene locus_tag LOCUS_54940 6275073 6274867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 6275702 6275325 gene locus_tag LOCUS_54950 6275702 6275325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 6275899 6275708 gene locus_tag LOCUS_54960 6275899 6275708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 6276402 6275899 gene locus_tag LOCUS_54970 6276402 6275899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 6278203 6276530 gene locus_tag LOCUS_54980 6278203 6276530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268008.1 protein_id gnl|my_center|LOCUS_54980 6279126 6278203 gene locus_tag LOCUS_54990 6279126 6278203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 6279332 6279123 gene locus_tag LOCUS_55000 6279332 6279123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 6279619 6279329 gene locus_tag LOCUS_55010 6279619 6279329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 6280281 6279877 gene locus_tag LOCUS_55020 6280281 6279877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 6280993 6280301 gene locus_tag LOCUS_55030 6280993 6280301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 6281109 6281384 gene locus_tag LOCUS_55040 6281109 6281384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 6281416 6282024 gene locus_tag LOCUS_55050 6281416 6282024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 6282021 6282962 gene locus_tag LOCUS_55060 6282021 6282962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 6282952 6283668 gene locus_tag LOCUS_55070 6282952 6283668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 6283652 6283864 gene locus_tag LOCUS_55080 6283652 6283864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 >Feature sequence2 565 341 gene locus_tag LOCUS_55090 565 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 1189 1530 gene locus_tag LOCUS_55100 1189 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 1548 1991 gene locus_tag LOCUS_55110 1548 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 2221 2715 gene locus_tag LOCUS_55120 2221 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 2712 3128 gene locus_tag LOCUS_55130 2712 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693479.1 protein_id gnl|my_center|LOCUS_55130 11095 3143 gene locus_tag LOCUS_55140 11095 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 12132 11095 gene locus_tag LOCUS_55150 12132 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 12943 12122 gene locus_tag LOCUS_55160 12943 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 13581 12970 gene locus_tag LOCUS_55170 13581 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 14038 13565 gene locus_tag LOCUS_55180 14038 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 14465 14082 gene locus_tag LOCUS_55190 14465 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 14835 14449 gene locus_tag LOCUS_55200 14835 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 15467 14841 gene locus_tag LOCUS_55210 15467 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 15970 15467 gene locus_tag LOCUS_55220 15970 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 16593 15967 gene locus_tag LOCUS_55230 16593 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 17357 16560 gene locus_tag LOCUS_55240 17357 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 18980 17361 gene locus_tag LOCUS_55250 18980 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146337.1 protein_id gnl|my_center|LOCUS_55250 19517 19017 gene locus_tag LOCUS_55260 19517 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 22412 19533 gene locus_tag LOCUS_55270 22412 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 22785 22423 gene locus_tag LOCUS_55280 22785 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 23367 22798 gene locus_tag LOCUS_55290 23367 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 24049 23360 gene locus_tag LOCUS_55300 24049 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 24441 24049 gene locus_tag LOCUS_55310 24441 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 25499 24540 gene locus_tag LOCUS_55320 25499 24540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 26497 25499 gene locus_tag LOCUS_55330 26497 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 26733 26539 gene locus_tag LOCUS_55340 26733 26539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 28772 26733 gene locus_tag LOCUS_55350 28772 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 29494 28772 gene locus_tag LOCUS_55360 29494 28772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55360 30236 29505 gene locus_tag LOCUS_55370 30236 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55370 30669 30202 gene locus_tag LOCUS_55380 30669 30202 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001838172.1 protein_id gnl|my_center|LOCUS_55380 30917 30669 gene locus_tag LOCUS_55390 30917 30669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 31333 30917 gene locus_tag LOCUS_55400 31333 30917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 31725 31330 gene locus_tag LOCUS_55410 31725 31330 CDS product DUF5675 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964411.1 protein_id gnl|my_center|LOCUS_55410 32187 32050 gene locus_tag LOCUS_55420 32187 32050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 32630 32184 gene locus_tag LOCUS_55430 32630 32184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 32971 32633 gene locus_tag LOCUS_55440 32971 32633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 33698 33072 gene locus_tag LOCUS_55450 33698 33072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 35365 33695 gene locus_tag LOCUS_55460 35365 33695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 36085 35435 gene locus_tag LOCUS_55470 36085 35435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 36341 36117 gene locus_tag LOCUS_55480 36341 36117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 36782 36345 gene locus_tag LOCUS_55490 36782 36345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 37099 36779 gene locus_tag LOCUS_55500 37099 36779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 37425 37096 gene locus_tag LOCUS_55510 37425 37096 CDS product Ref family recombination enhancement nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062266925.1 protein_id gnl|my_center|LOCUS_55510 37880 37419 gene locus_tag LOCUS_55520 37880 37419 CDS product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402092.1 protein_id gnl|my_center|LOCUS_55520 38096 37893 gene locus_tag LOCUS_55530 38096 37893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 38438 38226 gene locus_tag LOCUS_55540 38438 38226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 39138 38422 gene locus_tag LOCUS_55550 39138 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 40069 39128 gene locus_tag LOCUS_55560 40069 39128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 40674 40066 gene locus_tag LOCUS_55570 40674 40066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 40981 40706 gene locus_tag LOCUS_55580 40981 40706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 41097 41789 gene locus_tag LOCUS_55590 41097 41789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 41809 42213 gene locus_tag LOCUS_55600 41809 42213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 42471 42761 gene locus_tag LOCUS_55610 42471 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 42758 42967 gene locus_tag LOCUS_55620 42758 42967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55620 42964 43887 gene locus_tag LOCUS_55630 42964 43887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 43887 45560 gene locus_tag LOCUS_55640 43887 45560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268008.1 protein_id gnl|my_center|LOCUS_55640 45688 46191 gene locus_tag LOCUS_55650 45688 46191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 46191 46382 gene locus_tag LOCUS_55660 46191 46382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 46388 46765 gene locus_tag LOCUS_55670 46388 46765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 47017 47223 gene locus_tag LOCUS_55680 47017 47223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 47309 47584 gene locus_tag LOCUS_55690 47309 47584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 47662 47925 gene locus_tag LOCUS_55700 47662 47925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 48039 48281 gene locus_tag LOCUS_55710 48039 48281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 48399 48698 gene locus_tag LOCUS_55720 48399 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 48878 50251 gene locus_tag LOCUS_55730 48878 50251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 50253 50570 gene locus_tag LOCUS_55740 50253 50570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 50686 51486 gene locus_tag LOCUS_55750 50686 51486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 51565 52329 gene locus_tag LOCUS_55760 51565 52329 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_55760 52387 52689 gene locus_tag LOCUS_55770 52387 52689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 52706 52912 gene locus_tag LOCUS_55780 52706 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 52916 53932 gene locus_tag LOCUS_55790 52916 53932 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847485.1 protein_id gnl|my_center|LOCUS_55790